DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam"

Transkript

1 DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam Notat fra DCE Nationalt Center for Miljø og Energi Dato: 5. september 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 5 Faglig kommentering: Aksel Bo Madsen Kvalitetssikring centret: Susanne Boutrup AARHUS AU UNIVERSITET DCE NATIONALT CENTER FOR MILJØ OG ENERGI Tel.:

2 Indhold Baggrund 3 Materiale 3 Metode 3 Artsidentifikation 3 Identifikation af individ 4 Køn 4 Reference 4 Bilag 1 5 2

3 Baggrund På foranledning af indleverede spytprøver fra dødfundne kalve, får og lam (se tabel) ønsker Naturstyrelsen (NST) at få be- eller afkræftet, om en ulv har spist af dyrene. Ligeledes ønskes identifikation til individniveau, såfremt det er muligt. Materiale I perioden 7. juni til 12. august 2013 blev der indleveret spytprøver, som var udtaget tre forskellige steder på en kalv fundet i Gludsted, fire forskellige steder på et lam fundet i Hodde og fire forskellige steder på en kalv fundet i Hemmet. Desuden blev der indleveret en spytprøve fra et får og to spytprøver fra et andet får, begge fundet ved Skærbæk (tabel 1). Spytprøverne er indleveret af Jens Henrik Jacobsen, Steen Fjederholdt og Svend Hansen fra Naturstyrelsens lokale enheder i Jylland. Tabel 1. Oversigt over spytprøver, resultat af undersøgelse samt status for individbestemmelse. Lokalitet Antal Dato Art Individbestemmelse Kalv Gludsted 3 29/ hund,ræv laves ikke Lam Hodde 4 13/ hund,ræv laves ikke Kalv Hemmet 4 7/ ulv,hund,ræv i gang Får1 Skærbæk 1 12/ ulv i gang Får2 Skærbæk 2 12/ ulv i gang Metode DNA blev ekstraheret fra de enkelte spytprøver. For at undgå kontaminering fra andre prøver er ekstraktionerne foretaget i et DNA-laboratorium, der kun bliver benyttet til prøver, hvor DNA koncentrationen forventes at være lille, som f.eks. i spytprøver fra de dødfundne dyr i denne undersøgelse. Opformeringen af både mitokondriemarkøren, der bliver benyttet til at identificere arten, og de gen-markører, der benyttes til at identificere individer (dvs. en DNA-profil), er foretaget i endnu et adskilt laboratorium for at undgå kontaminering fra andet materiale. Mitokondrie DNA-markøren er beskrevet i notatet (Andersen & Madsen 2013). Gen-markørerne (mikrosatelitter), der er benyttet til at identificere individer, er de samme som benyttes i den tyske database på Senckenberg Instituttet, Frankfurt (12 stk.) og samtidigt er kønnet bestemt ved markør for Y og X-kromosomet. Artsidentifikation Mitokondrie-markøren: Til artsidentifikationen blev prøverne sendt til sekvensering og analyseret som beskrevet i ovennævnte notat. Sekvenserne blev efterfølgende analyseret efter kvalitetskontrol af sekvenseringen ved at søge efter matchende sekvenser i den internationale NCBI s Genbank database. Resultatet af denne søgning viste: Spytprøver fra kalv fra Gludsted: to sekvenser viste 100% match for hund. 3

4 Spytprøver fra lam fra Hodde: tre sekvenser viste 100% match for hund. Spytprøver fra kalv ved Hemmet: en sekvens viste 100% hund, en sekvens viste 99% ulv og en sekvens viste 97% hund. Spytprøve fra får 1 fra Skærbæk: en sekvens viste 98% ulv. Spytprøver fra får 2: en sekvens viste 90% ulv. Ved undersøgelsen blev der i alle de indleverede prøver fra Gludsted og Hodde udelukkende fundet spor efter hund, mens der i prøverne fra Hemmet er fundet spor efter både ulv, hund og ræv. I prøverne fra Skærbæk er der kun fundet spor efter ulv. Alle de positive ulveprøver havde den typiske ulve-haplotype W1-LT. Sekvenserne fra de pågældende analyser er vedlagt i bilag 1. Identifikation af individ DNA-profil til identifikation af individ: De 13 gen-markører (12 mikrosatelitter) blev benyttet til at udforme DNA-profilerne for prøverne. Spytprøverne gav ikke tydelige DNA-profiler. Dog kan det fastslås, at det er samme individ, der har bidt de to får fundet ved Skærbæk. Ligeledes er det muligt i alle prøver, undtagen prøverne fra Skærbæk, at se spor efter ræv. Der arbejdes fortsat på identifikation af individ for om muligt at finde et match eller et slægtskab til et ulvekobbel i Tyskland. Køn For alle de analyserede prøver, der var positive for ulv, blev kønnet bestemt til at være hanner. Reference Andersen, LW & Madsen AB Notat vedr. DNA analyse af spyt-skrab fra tre nedlagte får. Notat til Naturstyrelsen. 3 sider. 4

5 Bilag 1 Mitokondriesekvensen Kalv Gludsted hund: TGTTTCTCGAGGCATGGTGATTAAGCCCTTATTGGACTAAGTGATAT- GCATTCGATTACTGTTGATAGATCAGTGAACTATGAGGTTGAGTTAA- GGTTTACCTGGAGATACTGACATAGCACAGTA Kalv Gludsted hund: TGTTTCTCGAGGCATGGTGATTAAGCCCTTATTGGACTAAGTGATAT- GCATTCGATTACTGTTGATAGATCAGTGAACTATGAGGTTGAGTTAA- GGTTTACCTGGAGATACTGACATAGCACAGTAGGGGTGATTCAA- TATATGAATGTAGGGGTGTCAGGGAATCCCCTT Lam Hodde hund: GTTTCTCGAGGCATGGTGATTAAGCCCTTATTGGACTAAGTGATATG- CATTTGATTACTGCTGACAGATCAATGAATTATGAGATTGAGTT- GATATGTCCTATGTAAGAATATAATATTATGTACATGCTTATATGCA- TGGGGCAAACCATTAATGCACGACGTATATAGGGGAGGGAAGAAG- GGTTTACCTGGAGATACTGACATAGCACAGTAGGGGTGATWCAA- TATATGAATGCC Kalv Hemmet ulv: GTCAGTATCTCCAGGTAAACCCTTCTTCCCTCCCCTATGTACGTCGT- GCATTAATGGTTTGCCCCATGCATATAAGCATGTACATAATAT- TACATTCTTACATAGGACATATTAACTCAATCTCATAATTCACT- GATCTATCAACAGTAATCAAATGCATATCACTTAGTCCA Kalv Hemmet hund: GTTTCTCGAGGCATGGTGATTAAGCCCTTATTGGACTAAGTGATATG- CATTCGATTACTGTTGAAAGATCAGTGAATTATGAGATTGAGTTAA- GGTTTACCTGGAGATACTGACATAGCACAGTAGGGG Får 1 Skærbæk ulv: CATGGTGATTAAGCCCTTATTGGACTAAGTGATATGCATTTGAT- TACTGTTGATAGATCAGTGAATTATGAGATTGAGTTAATATGTCC- TATGTAAGAATGTAATATTATGTACATGCTTATATGCATGGGGCA- AACCATTAATGCACGACGTACATAGGGGAGGGAAGAAGGGTT- TACCTGGAGATACTGACATAGCACAGTAGGGGTGATTCAAT Får 2 Skærbæk ulv: CATGGTGATTAAGCCCTTATTGGACTAAGTGATATGCATTTGAT- TACTGTTGATAGATCAGTGAATTATGAGATTGAGTTAATATGTCC- TATGTAAGAATGTAATATTATGTACATGCTTATATGCATGGGGCA- AACCATTAATGCACGACGTACATAGGGG 5

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får DNA analyse til artsidentifikation af spytprøver fra to dødfundne får Notat fra DCE -Nationalt Center for Miljø og Energi Dato: 22. oktober 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Liselotte Wesley Andersen Institut for Bioscience

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2014 Liselotte Wesley

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. oktober 2014 Liselotte Wesley Andersen Institut

Læs mere

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 19.oktober 2015 Liselotte Wesley Andersen

Læs mere

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12 juni 2014 Liselotte Wesley Andersen Institut

Læs mere

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm.

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Liselotte Wesley Andersen

Læs mere

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. august 2014 Liselotte Wesley Andersen & Aksel Bo Madsen Institut for Bioscience

Læs mere

DNA analyse af mulige odderekskrementer

DNA analyse af mulige odderekskrementer DNA analyse af mulige odderekskrementer indsamlet på Sjælland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. august 2017 Liselotte Wesley Andersen & Bjarne Søgaard Institut for Bioscience

Læs mere

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen 2013 Retningslinjer af 10. december 2013 Notat fra DCE - Nationalt Center for

Læs mere

DNA analyse af mulige odder-ekskrementer indsamlet på Fyn

DNA analyse af mulige odder-ekskrementer indsamlet på Fyn DNA analyse af mulige odder-ekskrementer indsamlet på Fyn Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12. juni 2017 Liselotte Wesley Andersen & Bjarne Søgaard Institut for Bioscience Rekvirent:

Læs mere

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. juni 2014 Tommy Asferg Institut for

Læs mere

DNA-analyser af ulv Ulve i Danmark

DNA-analyser af ulv Ulve i Danmark DNA-analyser af ulv Ulve i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. februar 2016 Liselotte Wesley Andersen Institut for Bioscience Antal sider: 6 Faglig kvalitetssikring: Flemming

Læs mere

Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører

Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. juli 2017 Peter Sunde 1 og Kent Olsen 2 1)

Læs mere

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. maj 2016 Tommy Asferg Institut for

Læs mere

Ynglende ringduer i september, oktober og november

Ynglende ringduer i september, oktober og november Ynglende ringduer i september, oktober og november Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. juni 2015 Kevin Kuhlmann Clausen & Thomas Kjær Christensen Institut for Bioscience Rekvirent:

Læs mere

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Notat fra DCE Nationalt Center for Miljø og Energi Dato: 31. oktober 2014 Tommy

Læs mere

Årsrapport 2013, kæbeindsamling Djursland

Årsrapport 2013, kæbeindsamling Djursland Årsrapport 2013, kæbeindsamling Djursland Lars Haugaard Institut for Bioscience Aarhus Universitet Grenåvej 14, 8410 Rønde. E. post.: laha@dmu.dk Faglig kommentering: Aksel Bo Madsen 1 1. Baggrund for

Læs mere

Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer

Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. november 2016 Jesper Fredshavn DCE Nationalt Center for Miljø og Energi

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2010/11

Vildtudbyttestatistik for jagtsæsonen 2010/11 Vildtudbyttestatistik for jagtsæsonen 2010/11 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. november 2011 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Indberetning af vildsvin til Vildtudbyttestatistikken

Indberetning af vildsvin til Vildtudbyttestatistikken Indberetning af vildsvin til Vildtudbyttestatistikken for sæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. januar 2015 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience

Læs mere

Reduktioner i overvågningsprogrammet

Reduktioner i overvågningsprogrammet Reduktioner i overvågningsprogrammet NOVANA Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. april 2015 Poul Nordemann Jensen DCE Nationalt Center for Miljø og Energi Antal sider: 5 Faglig

Læs mere

Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande

Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. oktober 2013 Rev.: 2. december 2013 Jørgen Windolf, Søren E.

Læs mere

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. april 2015 Ib Krag Petersen

Læs mere

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. juni 2012 Poul Nordemann Jensen Rekvirent: Naturstyrelsen Antal sider: 5

Læs mere

Notat om særlige danske udfordringer i forbindelse med de danske vandplaner

Notat om særlige danske udfordringer i forbindelse med de danske vandplaner Notat om særlige danske udfordringer i forbindelse med de danske vandplaner Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14. november 2012 Poul Nordemann Jensen DCE Nationalt Center for Miljø

Læs mere

Overvågning af bæver i Danmark 2011

Overvågning af bæver i Danmark 2011 Overvågning af bæver i Danmark 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 3. juli 2012 Jørn Pagh Berthelsen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 7 Redaktion:

Læs mere

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. september 2013 Ib Krag Petersen Jakob

Læs mere

Kravsspecifikation - overvågning af ulv

Kravsspecifikation - overvågning af ulv NOTAT Naturbeskyttelse Ref. Crnis/Lajen/Hes Den 13. juli 2017 Kravsspecifikation - overvågning af ulv 1. Baggrund og formål Ulven har været væk fra Danmark, og lande vi normalt sammenligner os med i Nordeuropa

Læs mere

Anskydning af vildt. Status for undersøgelser 2014

Anskydning af vildt. Status for undersøgelser 2014 Anskydning af vildt. Status for undersøgelser 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. december 2014 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 5. juli 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Optællinger af ynglefugle i det danske Vadehav 2012

Optællinger af ynglefugle i det danske Vadehav 2012 Optællinger af ynglefugle i det danske Vadehav 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 24. april 2013 Ole Thorup Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Notat vedr. interkalibrering af ålegræs

Notat vedr. interkalibrering af ålegræs Notat vedr. interkalibrering af ålegræs Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. januar 2012 Michael Bo Rasmussen Thorsten Balsby Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Anskydning af kortnæbbet gås - opdatering 2016

Anskydning af kortnæbbet gås - opdatering 2016 Anskydning af kortnæbbet gås - opdatering 2016 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. maj 2016 Jesper Madsen og Lars Haugaard Institut for Bioscience Antal sider: 5 Faglig kommentering:

Læs mere

Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb

Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. december 2011 Poul Nordemann Jensen DCE Nationalt Center for Miljø og

Læs mere

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14. oktober 2013 Forfatter Liselotte Sander Johansson Institut for

Læs mere

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. oktober 2013 Thomas Eske Holm Ib

Læs mere

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Artikel 17 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 28. juni 2013 Hanne Bach & Jesper Fredshavn

Læs mere

Ulves naturlige skyhed i områder med høj befolkningstæthed

Ulves naturlige skyhed i områder med høj befolkningstæthed Ulves naturlige skyhed i områder med høj befolkningstæthed Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 22. juni 2015 Peter Sunde Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden 2005-2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. april 2014 30. april 2014 Søren

Læs mere

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus ved Flakfortet Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. maj 2013 Jonas Teilmann Ib Krag Petersen

Læs mere

Anskydning af vildt. Status for undersøgelser

Anskydning af vildt. Status for undersøgelser Anskydning af vildt. Status for undersøgelser 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. november 2013 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Interkalibrering Sedimentprøvetagning i søer

Interkalibrering Sedimentprøvetagning i søer Interkalibrering Sedimentprøvetagning i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato:. december 2012 Liselotte Sander Johansson Martin Søndergaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

DCE S KVALITETSSIKRINGS- PROCEDURER

DCE S KVALITETSSIKRINGS- PROCEDURER DCE S KVALITETSSIKRINGS- PROCEDURER Susanne Boutrup Chefkonsulent 6. FEBRUAR 2017 KRAV TIL DEN FAGLIGE RÅDGIVNING Høj faglig kvalitet Rettidighed Intern koordinering Synlighed af resultater Dialog med

Læs mere

Rastende trækfugle på Tipperne 2012

Rastende trækfugle på Tipperne 2012 Rastende trækfugle på Tipperne 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2013 Ole Amstrup 1 Mogens Bak 1 Karsten Laursen 2 1 Amphi Consults 2 Institut for Bioscience Rekvirent:

Læs mere

Blue Reef. Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 AARHUS AU UNIVERSITET

Blue Reef. Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 AARHUS AU UNIVERSITET Blue Reef Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. juni 2013 Karsten Dahl Institut for Institut for Bioscience

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2011/12

Vildtudbyttestatistik for jagtsæsonen 2011/12 Vildtudbyttestatistik for jagtsæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 15. oktober 2012 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Forslag vedr. jagt på gæs på landjorden i januar

Forslag vedr. jagt på gæs på landjorden i januar Forslag vedr. jagt på gæs på landjorden i januar Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. april 2013 Thomas Kjær Christensen Jesper Madsen Tommy Asferg Institut for Bioscience Rekvirent:

Læs mere

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 01. december 2013 Rettet: 21. februar 2014 og 8. marts 2014 Lars M. Svendsen

Læs mere

Rastefugle på Tipperne 2013

Rastefugle på Tipperne 2013 Rastefugle på Tipperne 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. marts 2014 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Internt notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. april 2016 Forfattere: Peter Wiberg-Larsen Institut

Læs mere

Notat vedr. tidlig såning af vintersæd i Landovervågningen

Notat vedr. tidlig såning af vintersæd i Landovervågningen Notat vedr. tidlig såning af vintersæd i Landovervågningen Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. februar 217 Anton Rasmussen Institut for Bioscience Rekvirent: Landbrugs- og Fiskeristyrelsen

Læs mere

Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark

Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. april 2017 Liselotte W. Andersen Institut for

Læs mere

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 16. april 2013 Thomas Eske Holm Karsten Dahl Jonas Teilmann

Læs mere

Statistisk analyse af næringsstoffers stabilitet

Statistisk analyse af næringsstoffers stabilitet Statistisk analyse af næringsstoffers stabilitet Notat fra DCE Nationalt Center for Miljø og Energi Dato: 4. august 216 Jacob Carstensen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 21

Læs mere

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016 Tillæg til Notat om omfordeling af arealdelen af husdyrgodkendelser i den nuværende regulering og ved forslag til ny husdyrregulering og effekter på kvælstofudledningen Notat fra DCE - Nationalt Center

Læs mere

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11-06-2014 Forfatter: Steen Solvang Jensen

Læs mere

Vurdering af to vandindtag, der bruges til udsanding af muslinger

Vurdering af to vandindtag, der bruges til udsanding af muslinger Vurdering af to vandindtag, der bruges til udsanding af muslinger Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14-06-2016 Hans H Jakobsen Christian Mohn Institut for Bioscience Rekvirent:

Læs mere

Vurdering af algeområder tilhørende nye produktionsområder 2016

Vurdering af algeområder tilhørende nye produktionsområder 2016 Vurdering af algeområder tilhørende nye produktionsområder 2016 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 17. oktober 2016 Forfatter Christian Mohn og Hans H Jakobsen Institut for Bioscience

Læs mere

DNA-baseret bestandsovervågning afslører ulve (Canis lupus) i Danmark

DNA-baseret bestandsovervågning afslører ulve (Canis lupus) i Danmark DNA-baseret bestandsovervågning afslører ulve (Canis lupus) i Danmark Liselotte Wesley Andersen 1, Morten Elmeros 1, Peter Sunde 1, Kent Olsen 2, Christina Vedel-Smith 2, Thomas Secher Jensen 2 & Aksel

Læs mere

Spørgsmål Hvad kan ministeren oplyse om den kommende forvaltningsplan for ulve i Danmark

Spørgsmål Hvad kan ministeren oplyse om den kommende forvaltningsplan for ulve i Danmark Udvalget for Landdistrikter og Øer 2012-13 ULØ Alm.del Bilag 164 Offentligt J.nr. NST-4101-00479 25. juni 2013 Miljøministerens besvarelse af spørgsmål nr. R stillet af Folketingets Udvalg for landdistrikter

Læs mere

Forventet synlighed og adfærd af ynglende ulve i Danmark

Forventet synlighed og adfærd af ynglende ulve i Danmark Forventet synlighed og adfærd af ynglende ulve i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. september 2015 Peter Sunde Institut for Bioscience Rekvirent: Naturstyrelsen Antal

Læs mere

Bortsprængning af miner i nordlige Storebælt

Bortsprængning af miner i nordlige Storebælt Bortsprængning af miner i nordlige Storebælt Notat fra DCE - Nationalt Center for Miljø og Energi Jakob Tougaard, Ib Krag Pedersen & Karsten Dahl Institut for Bioscience Rekvirent: Forsvarets Bygnings-

Læs mere

DNA-analyser af odderekskrementer fra Sjælland

DNA-analyser af odderekskrementer fra Sjælland DNA-analyser af odderekskrementer fra Sjælland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. juli 2016 Liselotte Wesley Andersen, Bjarne Søgaard & Aksel Bo Madsen Institut for Bioscience

Læs mere

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. september 2015 Bettina Nygaard & Jesper Bladt Institut for Bioscience

Læs mere

Udviklingen i luftkoncentrationen af svovldioxid i Danmark set i forbindelse med svovlreduktion i skibsbrændstof

Udviklingen i luftkoncentrationen af svovldioxid i Danmark set i forbindelse med svovlreduktion i skibsbrændstof Udviklingen i luftkoncentrationen af svovldioxid i Danmark set i forbindelse med svovlreduktion i skibsbrændstof Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. oktober 2016 Thomas Ellermann

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2012/13

Vildtudbyttestatistik for jagtsæsonen 2012/13 Vildtudbyttestatistik for jagtsæsonen 2012/13 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 8. november 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 9 Faglig

Læs mere

Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder

Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12. maj 2014 Gitte Blicher-Mathiesen

Læs mere

Den Danske Vildtudbyttestatistik

Den Danske Vildtudbyttestatistik Underbilag F: Beskrivelse af database for vildtudbyttestatistik I udbuddet indgår to datasamlinger/databaser over henholdsvis den årlige Vildtudbyttestatistik (jf. nedenstående) og Vingeundersøgelser fra

Læs mere

AARHUS UNIVERSITET. Fødevarestyrelsen. Vedrørende notat om Vurdering af to vandindtag, der bruges til udsanding af muslinger

AARHUS UNIVERSITET. Fødevarestyrelsen. Vedrørende notat om Vurdering af to vandindtag, der bruges til udsanding af muslinger AARHUS UNIVERSITET DCA - NATIONALT CENTER FOR FØDEVARER OG JORDBRUG Fødevarestyrelsen Vedrørende notat om Vurdering af to vandindtag, der bruges til udsanding af muslinger Fødevarestyrelsen har i mail

Læs mere

1 Interviewdata: datateknisk anvisning Version: 1

1 Interviewdata: datateknisk anvisning Version: 1 Titel: Interviewdata i LOOP Dokumenttype: Teknisk anvisning Forfattere: FDC Stofudvaskning fra dyrkede arealer: Anton Rasmussen og Gitte Blicher-Mathiesen NST: Kirsten Broch TA henvisninger TA. nr.: Version:

Læs mere

Berigtigelse vedrørende tre ulve-artikler i Flora og Fauna 121 (1+2)

Berigtigelse vedrørende tre ulve-artikler i Flora og Fauna 121 (1+2) Berigtigelse vedrørende tre ulve-artikler i Flora og Fauna 121 (1+2) Thomas Secher Jensen, Aksel Bo Madsen & Liselotte Wesley Andersen Kontaktperson: Peter Sunde, Institut for Bioscience - Kalø, Aarhus

Læs mere

Kriterier for ringduers yngletid og forårstræktid

Kriterier for ringduers yngletid og forårstræktid Kriterier for ringduers yngletid og forårstræktid Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Kevin Kuhlmann Clausen & Thomas Eske Holm Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16

Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16 Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 28. juni 2016 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen Antal

Læs mere

DNA fingeraftryk: Hvordan kan vi bruge DNA - baserede metoder ved drikkevandsforureninger? Anna Krestine Nørgaard Teknologisk Institut

DNA fingeraftryk: Hvordan kan vi bruge DNA - baserede metoder ved drikkevandsforureninger? Anna Krestine Nørgaard Teknologisk Institut DNA fingeraftryk: Hvordan kan vi bruge DNA - baserede metoder ved drikkevandsforureninger? Anna Krestine Nørgaard Teknologisk Institut INTRODUKTION Teknologisk Institut; - Hvem er vi?! Anvendte metoder

Læs mere

Sådan er udledningerne omkring år 1900 fastsat En proxy for kvælstofkoncentrationen i vandløb omkring år 1900

Sådan er udledningerne omkring år 1900 fastsat En proxy for kvælstofkoncentrationen i vandløb omkring år 1900 Sådan er udledningerne omkring år 1900 fastsat En proxy for kvælstofkoncentrationen i vandløb omkring år 1900 Brian Kronvang, Hans Thodsen, Jane R. Poulsen, Mette V. Carstensen, Henrik Tornbjerg og Jørgen

Læs mere

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen Arealer, urbanisering og naturindhold i, strandbeskyttelseslinjen og klitfredningslinjen Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. september 2015 Gregor Levin Institut for Miljøvidenskab,

Læs mere

Referat af tredje møde i Rådgivningspanelet for DCE Nationalt Center for

Referat af tredje møde i Rådgivningspanelet for DCE Nationalt Center for Møde den 26. juni 2014 kl. 10.00 14.00 Sted: Høgh-Guldbergs Gade 4, Bygning 1653, 8000 Aarhus C Til stede: Prodekan Kurt Nielsen; Direktør Hanne Bach; Direktør Carl-Emil Larsen; Chefkonsulent Carl Åge

Læs mere

Ynglefuglene på Tipperne 2014

Ynglefuglene på Tipperne 2014 Ynglefuglene på Tipperne 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. august 2014 Ole Thorup og Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 7 Redaktør:

Læs mere

Modeller for danske fjorde og kystnære havområder

Modeller for danske fjorde og kystnære havområder NST projektet Implementeringen af modeller til brug for vandforvaltningen Modeller for danske fjorde og kystnære havområder Indsatsoptimering i henhold til inderfjorde og yderfjorde Naturstyrelsen Rapport

Læs mere

Titel: Stoftransport. Dokumenttype: Teknisk anvisning B01. 08.08.2014 Gyldig fra: 01.01.2012 Sider: 7 Sidst ændret: 26.08.2014

Titel: Stoftransport. Dokumenttype: Teknisk anvisning B01. 08.08.2014 Gyldig fra: 01.01.2012 Sider: 7 Sidst ændret: 26.08.2014 Titel: Stoftransport Dokumenttype: Teknisk anvisning Forfattere: FDC Ferskvand: Jens Bøgestrand og Jytte Erfurt TA henvisninger TA. nr.: Version: Oprettet: DB01 1 08.08.2014 Gyldig fra: 01.01.2012 Sider:

Læs mere

Vurdering af udviklingen i kvælstofudvaskning fra rodzonen opgjort for landovervågningsoplandene i Landovervågning 2011

Vurdering af udviklingen i kvælstofudvaskning fra rodzonen opgjort for landovervågningsoplandene i Landovervågning 2011 Vurdering af udviklingen i kvælstofudvaskning fra rodzonen opgjort for landovervågningsoplandene i Landovervågning 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 15. januar 2015 Gitte

Læs mere

Vurdering af øget fosfortilførsel til jorden

Vurdering af øget fosfortilførsel til jorden Vurdering af øget fosfortilførsel til jorden Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 17. juni 2014 Hans Estrup Andersen, Gitte Blicher-Mathiesen & Brian Kronvang Institut for Bioscience

Læs mere

H ELLE B ØDKER M ADSEN. Privatisering. og patientrettigheder. Jurist- og Økonomforbundets Forlag

H ELLE B ØDKER M ADSEN. Privatisering. og patientrettigheder. Jurist- og Økonomforbundets Forlag H ELLE B ØDKER M ADSEN Privatisering og patientrettigheder Jurist- og Økonomforbundets Forlag Helle Bødker Madsen Privatisering og patientrettigheder Jurist- og Økonomforbundets Forlag 2010 Privatisering

Læs mere

Kommentarer vedr. Basisanalyse 2013: Opgave 3.2 Marin Justering af vandområde-inddeling med tilhørende opland

Kommentarer vedr. Basisanalyse 2013: Opgave 3.2 Marin Justering af vandområde-inddeling med tilhørende opland Kommentarer vedr. Basisanalyse 2013: Opgave 3.2 Marin Justering af vandområde-inddeling med tilhørende opland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. oktober 2013 Henrik Fossing &

Læs mere

DÅVILDT I DANMARK STATUS FOR BE- STAND OG UDBYTTE 2017

DÅVILDT I DANMARK STATUS FOR BE- STAND OG UDBYTTE 2017 DÅVILDT I DANMARK STATUS FOR BE- STAND OG UDBYTTE 2017 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. november 2017 Thomas Kjær Christensen og Lars Haugaard Institut for Bioscience Rekvirent:

Læs mere

Ulvene i Danmark. Kronologien i ulvens genkomst i Danmark

Ulvene i Danmark. Kronologien i ulvens genkomst i Danmark Ulvene i Danmark Kronologien i ulvens genkomst i Danmark Den generelle opfattelse er, at den første ulv i Danmark i nyere tid er den såkaldte Thy-ulv, som blev set i oktober 2012 og fundet død af en byld

Læs mere

Vedrørende miljøpositivliste for de af producentorganisationers driftsfonde, hvor investeringer kan støttes med 60 % fra EU

Vedrørende miljøpositivliste for de af producentorganisationers driftsfonde, hvor investeringer kan støttes med 60 % fra EU DCA - NATIONALT CENTER FOR FØDEVARER OG JORDBRUG AARHUS UNIVERSITET NaturErhvervstyrelsen Vedrørende miljøpositivliste for de af producentorganisationers driftsfonde, hvor investeringer kan støttes med

Læs mere

Årsrapport 2011, kæbeindsamling Djursland

Årsrapport 2011, kæbeindsamling Djursland Årsrapport 2011, kæbeindsamling Djursland Lars Haugaard Danmarks Miljøundersøgelser, Aarhus Universitet Afdeling for vildtbiologi og biodiversitet Grenåvej 14, 8420 Rønde. Tlf.: 89 20 15 50 E. post.: laha@dmu.dk

Læs mere

Peter Sunde (Seniorforsker) Ændr 2. linje i overskriften til AU Passata Light AARHUS UNIVERSITET SKOVDYRKERFORENINGEN 23.

Peter Sunde (Seniorforsker) Ændr 2. linje i overskriften til AU Passata Light AARHUS UNIVERSITET SKOVDYRKERFORENINGEN 23. til Passata Light ULVETIMEN - FÅ STYR PÅ FAKTA til Passata Light Peter Sunde (Seniorforsker) Aarhus Universitet Institut for Bioscience Faunaøkologi - Kalø til Passata Light ULVETIMEN - FÅ STYR PÅ FAKTA

Læs mere

0 Indhold NATIONALT CENTER FOR MILJØ OG ENERGI AARHUS UNIVERSITET. Version:

0 Indhold NATIONALT CENTER FOR MILJØ OG ENERGI AARHUS UNIVERSITET. Version: Dokumenttype: Teknisk anvisning Forfattere: Liselotte Sander Johansson Peter Wiberg-Larsen Fagdatacenter for Ferskvand Institut for Bioscience TA henvisninger TA. nr.: S08 Version: 1 Oprettet: 03.02.2012

Læs mere

Bekendtgørelse om erhvervsmæssig konservering af visse dyrearter 1)

Bekendtgørelse om erhvervsmæssig konservering af visse dyrearter 1) BEK nr 328 af 19/03/2013 (Historisk) Udskriftsdato: 27. maj 2016 Ministerium: Miljøministeriet Journalnummer: Miljømin., Naturstyrelsen, j.nr. NST-304-00061 Senere ændringer til forskriften BEK nr 1914

Læs mere

Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen

Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen Jens Carl Streibig, KU Claus Tonni Hansen, Christian Ritz, KU,. Daniel Gerhard NZ Jens Erik Jensen, Seges

Læs mere

BESKRIVER DANSK VANDLØBS FAUNA INDEKS ET VANDLØBS SANDE TILSTAND?

BESKRIVER DANSK VANDLØBS FAUNA INDEKS ET VANDLØBS SANDE TILSTAND? 30. JANUAR 2013 BESKRIVER ET VANDLØBS SANDE TILSTAND? - OG SIKRER DET REELT GOD ØKOLOGISK TILSTAND?, ESBEN A. KRISTENSEN & ANNETTE BAATTRUP-PEDERSEN DET KORTE SVAR ER: NEJ IKKE NØDVENDIGVIS Vandrammedirektivet

Læs mere

Dødelighed hos ringdueunger som konsekvens af jagtlig regulering af forældrefugle

Dødelighed hos ringdueunger som konsekvens af jagtlig regulering af forældrefugle Dødelighed hos ringdueunger som konsekvens af jagtlig regulering af forældrefugle Notat fra DCE Nationalt Center for Miljø og Energi Dato: 31. oktober 2014 Thomas Eske Holm & Rasmus Due Nielsen Institut

Læs mere

KVALITETSSTYRING AF RÅDGIVNING

KVALITETSSTYRING AF RÅDGIVNING KVALITETSSTYRING AF RÅDGIVNING Susanne Boutrup Forsknings-, Overvågnings- og Rådgivningssekretariatet Siden sidst (mødet den 4. juni 2009) Møde mellem DJF og DMU med præsentation af initiativer Udkast

Læs mere

Betydningen af vildtreservatet Gamborg Inddæmning for fuglearter på udpegningsgrundlaget for Natura område nr.

Betydningen af vildtreservatet Gamborg Inddæmning for fuglearter på udpegningsgrundlaget for Natura område nr. Betydningen af vildtreservatet Gamborg Inddæmning for fuglearter på udpegningsgrundlaget for Natura 2000- område nr. 112, Lillebælt Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 8. januar

Læs mere

NATIONALT CENTER FOR MILJØ OG ENERGI 1

NATIONALT CENTER FOR MILJØ OG ENERGI 1 1 Titel: Udtagning af sedimentprøve til analyse for miljøfremmede stoffer i søer. Dokumenttype: Teknisk anvisning Forfatter: Liselotte Sander Johansson Fagdatacenter for Ferskvand Institut for Bioscience

Læs mere

Vandindtag og kontinuert måling af vandmængder på dambrug

Vandindtag og kontinuert måling af vandmængder på dambrug Vandindtag og kontinuert måling af vandmængder på dambrug Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 01. december 2013 Rettet: 21. februar 2014 og 8. marts 2014 Lars M. Svendsen DCE Nationalt

Læs mere