DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement

Størrelse: px
Starte visningen fra side:

Download "DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement"

Transkript

1 DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 5 Faglig kommentering: Aksel Bo Madsen Kvalitetssikring, centret: Susanne Boutrup AARHUS AU UNIVERSITET DCE NATIONALT CENTER FOR MILJØ OG ENERGI Tel.:

2 Indhold Baggrund 3 Materiale 3 Metode 3 Artsidentifikation 3 Identifikation af individ 4 Køn 4 Reference 4 Bilag 1 5 2

3 Baggrund På foranledning af indleverede spyt-prøver fra et dødfundet får og et dødfundet rådyr ønsker Naturstyrelsen (NST) at få be- eller afkræftet om en ulv har spist af dyrene. Ligeledes ønskes en arts-identifikation ud fra et indleveret formodet ulve-ekskrement. For begge kilder af DNA ønskes også en identifikation af individet, såfremt det er muligt. Materiale Den blev indleveret tre spytprøver af Jens Henrik Jacobsen taget fra et enkelt dødfundet får syd for Holstebro. Den blev ligeledes indleveret tre spytprøver fra et dødfundet rådyr af Steen Fjederholdt. Nærmere stedsangivelse er ikke givet, men det formodes, at det er Naturstyrelsen, Midtjylland. Den blev der indleveret et ekskrement indsamlet ved Dejbjerg. Metode På baggrund af antallet af tilsendte prøver er der ekstraheret DNA separat fra hver indleveret prøve. Der blev ekstraheret DNA fra hver af de tre spytprøver fra henholdsvis Holstebro og Feldborg og en fra det indleverede ekskrement. For at undgå kontaminering fra andre prøver er ekstraktionerne foretaget i et DNA-laboratorium, der kun bliver benyttet til prøver, hvor DNA koncentrationen forventes at være lille, som f.eks. i de tilsendte spytprøver fra de dødfundne dyr. Opformeringen af både mitokondriemarkøren, der bliver benyttet til at identificere arten, og de gen-markører, der benyttes til at identificere individer (dvs. en DNA-profil), er foretaget i endnu et adskilt laboratorium for at undgå kontaminering fra andet materiale. Mitokondrie DNA-markøren er beskrevet i notatet (Andersen & Madsen 2013). Gen-markørerne (mikrosatelitter), der er benyttet til at identificere individer, er de samme som benyttes i den tyske database på Senckenberg Instituttet, Frankfurt (12 stk.) og samtidigt er kønnet bestemt ved markør for Y og X- kromosomet. Artsidentifikation Mitokondrie-markøren: Til artsidentifikationen blev prøverne (i alt 7 stk) sendt til sekvensering og analyseret som beskrevet i ovennævnte notat. Sekvenserne blev efterfølgende analyseret efter kvalitetskontrol af sekvenseringen ved at søge efter matchende sekvenser i den internationale NCBI s Genbank database. Resultatet af denne søgning viste: Spytprøve fra får: Ribben 1= 99% match for hund, Ribben 2 = 99% match for ulv og Bov 1= 99% match for hund. Spytprøve fra rådyr: Rådyr Feldborg= 99% match for ulv. Formodet ulveekskrement: UV 14 (ekskrement) = 99% ulv. Resultaterne viser, at der i alle de indleverede prøver er spor efter ulv. De viser også, at metoden kan skelne mellem hund og ulv, da analysen viser, at der har været en hund, der har afsat spyt på fåret. 3

4 Sekvenserne fra de pågældende analyser er vedlagt dette notat i bilag 1. Identifikation af individ DNA-profil til identifikation af individ: De 13 gen-markører (12 mikrosatelitter) blev benyttet til at udforme DNA-profilerne for prøverne fra de 3 forskellige områder. Formodet ulveekskrement: Det lykkedes at få en DNA-profil for UV14 prøven, hvor DNA et er ekstraheret fra et friskt ekskrement. Efter kalibrering med det tyske DNA-register på Senckenberg Instituttet i Frankfurt blev der udført en analyse for at finde en matchende DNA-profil i registret. Dette blev ikke fundet. Det tyske DNA-register indeholder DNA-profiler fra et stort udsnit af de ulve, der findes i Tyskland, men langt fra alle, og et mindre udsnit af DNA-profiler fra de ulve, der findes i Polen. Det skal understreges, at de ulve, der findes i Tyskland, er polske ulve. De vandrer frem og tilbage over grænsen mellem de to lande. En sandsynlig mulighed er således, at det pågældende individ er en ulv, som endnu ikke er i DNA-registret. Muligheden for at det pågældende individ er en hybrid med ulve-tæve som mor og hund som far kan ikke afskrives på baggrund af de foreliggende analyser. Dog er det normale ved den tjekkiske ulvehunde race, at det er hunden som er tæve. Det kan afskrives her, da mitokondrierne nedarves fra mor til afkom, og der blev påvist ulve-mitokondrie (se sekvensen nedenfor). Analyserne af flere øst polske ulve er i gang på Senckenberg Instituttet, og der afventes resultater af disse, før der kan gives et endegyldigt svar omkring individets identitet og tilhørsforhold. Spytprøver fra får og rådyr: For spyt-prøverne var det vanskeligt at få en klar DNA-profil, der kun tilhørte et individ. Som beskrevet ovenfor blev der fundet spor efter hund fra den ene lokalitet, og i DNA-profilen, blev der i prøver fra begge lokaliteter, fundet spor efter ræv. Prøverne kunne derfor ikke benyttes til at identificere individer. Køn For alle de analyserede prøver blev kønnet bestemt til at være hanner. Reference Andersen, LW & Madsen AB Notat vedr. DNA analyse af spyt-skrab fra tre nedlagte får, pp 2. 4

5 Bilag 1 Mitokondriesekvensen Spytprøve fra rådyr, Feldborg TATTGAATCACCCCTACTGTGCTTTGTCAGTATCTCCAGG- TAATTCCTTCTTCCCTCCCCTATGTACGTCGTGCATTAATGGT- TTGCCCCATGCATATAAGCATGTACATAATATTATATTCTTACATAG- GACATATTAACTCAATCTCATAATTCACTGATCTATCAACAGTAAT- CAAATGCATATCACTTAGTCCAATAAGGGCTTAATCACCAT- GCCTCGAGAAACA(ulv) Spytprøve fra får Ribben 1 TCCCTGACACCCCTACATTCATATATTGAATCACCCCTACTGTGC- TATGTCAGTATCTCCAGGTAAACCCTTCTTCCCTCCCCTATGTACGT- CGTGCATTAATGGTTTGCCCCATGCATATAAGCATGTACATAATAT- TATATCCTTACATAGGACATATTAACTCAATCTCATAATTCACT- GATCTGTCAACAGTAATCGAATGCATATCACTTAGTCCAATAAG- GGCTTAATCACCATG (hund) Spytprøve fra får Ribben 2 TTCCCTGACACCCCTACATTCATATATTGAATCACCCCTACTGTGC- TATGTCAGTATCTCCAGGTAAACCCTTCTTCCCTCCCCTATGTACGT- CGTGCATTAATGGTTTGCCCCATGCATATAAGCATGTACATAATAT- TATATTCTTACATAGGACATATTAACTCAATCTCATAATTCACT- GATCTATCAACAGTAATCAAATGCATATCACTTAGTCCAATAAG- GGCTTAATCACCAT (ulv) Spytprøve fra får Bov TATTGAATCACCCCTACTGTGCTATGTCAGTATCTCCAGG- TAAACCCTTCTTCCCTCCCCTATGTACGTCGTGCATTAATGGT- TTGCCCCATGCATATAAGCATGTACATAATATTATATCCTTACATAG- GACATATTAACTCAATCTCATAATTCACTGATCTGTCAACAGTAAT- CGAATGCATATCACTTAGTCCAATAAGGGCTTAATCACCAT (hund) Formodet ulveekskrement UV14 Dejbjerg TGGTTTCTCGAGGCATGGTGATTAAGCCCTTATTGGACTAAGT- GATATGCATTTGATTACTGTTGATAGATCAGTGAATTATGAGATTG- AGTTAATATGTCCTATGTAAGAATGTAATATTATGTACATGCT- TATATGCATGGGGCAAACCATTAATGCACGACGTACATAGGGGAG- GGAAGAAGGGTTTACCTGGAGATACTGACATAGCACAGTAGGGGT- GATTCAATATATGAATGTAGGGG(ulv) 5

DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam

DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam Notat fra DCE Nationalt Center for Miljø og Energi Dato: 5. september 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får DNA analyse til artsidentifikation af spytprøver fra to dødfundne får Notat fra DCE -Nationalt Center for Miljø og Energi Dato: 22. oktober 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2014 Liselotte Wesley

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. oktober 2014 Liselotte Wesley Andersen Institut

Læs mere

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 19.oktober 2015 Liselotte Wesley Andersen

Læs mere

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12 juni 2014 Liselotte Wesley Andersen Institut

Læs mere

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm.

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Liselotte Wesley Andersen

Læs mere

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. august 2014 Liselotte Wesley Andersen & Aksel Bo Madsen Institut for Bioscience

Læs mere

DNA analyse af mulige odderekskrementer

DNA analyse af mulige odderekskrementer DNA analyse af mulige odderekskrementer indsamlet på Sjælland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. august 2017 Liselotte Wesley Andersen & Bjarne Søgaard Institut for Bioscience

Læs mere

DNA-analyser af ulv Ulve i Danmark

DNA-analyser af ulv Ulve i Danmark DNA-analyser af ulv Ulve i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. februar 2016 Liselotte Wesley Andersen Institut for Bioscience Antal sider: 6 Faglig kvalitetssikring: Flemming

Læs mere

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. juni 2014 Tommy Asferg Institut for

Læs mere

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen 2013 Retningslinjer af 10. december 2013 Notat fra DCE - Nationalt Center for

Læs mere

DNA analyse af mulige odder-ekskrementer indsamlet på Fyn

DNA analyse af mulige odder-ekskrementer indsamlet på Fyn DNA analyse af mulige odder-ekskrementer indsamlet på Fyn Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12. juni 2017 Liselotte Wesley Andersen & Bjarne Søgaard Institut for Bioscience Rekvirent:

Læs mere

Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører

Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. juli 2017 Peter Sunde 1 og Kent Olsen 2 1)

Læs mere

Indberetning af vildsvin til Vildtudbyttestatistikken

Indberetning af vildsvin til Vildtudbyttestatistikken Indberetning af vildsvin til Vildtudbyttestatistikken for sæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Ynglende ringduer i september, oktober og november

Ynglende ringduer i september, oktober og november Ynglende ringduer i september, oktober og november Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. juni 2015 Kevin Kuhlmann Clausen & Thomas Kjær Christensen Institut for Bioscience Rekvirent:

Læs mere

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. maj 2016 Tommy Asferg Institut for

Læs mere

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Notat fra DCE Nationalt Center for Miljø og Energi Dato: 31. oktober 2014 Tommy

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2010/11

Vildtudbyttestatistik for jagtsæsonen 2010/11 Vildtudbyttestatistik for jagtsæsonen 2010/11 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. november 2011 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Reduktioner i overvågningsprogrammet

Reduktioner i overvågningsprogrammet Reduktioner i overvågningsprogrammet NOVANA Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. april 2015 Poul Nordemann Jensen DCE Nationalt Center for Miljø og Energi Antal sider: 5 Faglig

Læs mere

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. september 2013 Ib Krag Petersen Jakob

Læs mere

Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer

Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. november 2016 Jesper Fredshavn DCE Nationalt Center for Miljø og Energi

Læs mere

Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande

Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. oktober 2013 Rev.: 2. december 2013 Jørgen Windolf, Søren E.

Læs mere

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. januar 2015 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience

Læs mere

Årsrapport 2013, kæbeindsamling Djursland

Årsrapport 2013, kæbeindsamling Djursland Årsrapport 2013, kæbeindsamling Djursland Lars Haugaard Institut for Bioscience Aarhus Universitet Grenåvej 14, 8410 Rønde. E. post.: laha@dmu.dk Faglig kommentering: Aksel Bo Madsen 1 1. Baggrund for

Læs mere

Anskydning af vildt. Status for undersøgelser 2014

Anskydning af vildt. Status for undersøgelser 2014 Anskydning af vildt. Status for undersøgelser 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. december 2014 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Notat om særlige danske udfordringer i forbindelse med de danske vandplaner

Notat om særlige danske udfordringer i forbindelse med de danske vandplaner Notat om særlige danske udfordringer i forbindelse med de danske vandplaner Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14. november 2012 Poul Nordemann Jensen DCE Nationalt Center for Miljø

Læs mere

Notat vedr. interkalibrering af ålegræs

Notat vedr. interkalibrering af ålegræs Notat vedr. interkalibrering af ålegræs Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. januar 2012 Michael Bo Rasmussen Thorsten Balsby Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. juni 2012 Poul Nordemann Jensen Rekvirent: Naturstyrelsen Antal sider: 5

Læs mere

Overvågning af bæver i Danmark 2011

Overvågning af bæver i Danmark 2011 Overvågning af bæver i Danmark 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 3. juli 2012 Jørn Pagh Berthelsen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 7 Redaktion:

Læs mere

DNA-baseret bestandsovervågning afslører ulve (Canis lupus) i Danmark

DNA-baseret bestandsovervågning afslører ulve (Canis lupus) i Danmark DNA-baseret bestandsovervågning afslører ulve (Canis lupus) i Danmark Liselotte Wesley Andersen 1, Morten Elmeros 1, Peter Sunde 1, Kent Olsen 2, Christina Vedel-Smith 2, Thomas Secher Jensen 2 & Aksel

Læs mere

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Internt notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. april 2016 Forfattere: Peter Wiberg-Larsen Institut

Læs mere

Blue Reef. Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 AARHUS AU UNIVERSITET

Blue Reef. Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 AARHUS AU UNIVERSITET Blue Reef Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. juni 2013 Karsten Dahl Institut for Institut for Bioscience

Læs mere

Optællinger af ynglefugle i det danske Vadehav 2012

Optællinger af ynglefugle i det danske Vadehav 2012 Optællinger af ynglefugle i det danske Vadehav 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 24. april 2013 Ole Thorup Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb

Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. december 2011 Poul Nordemann Jensen DCE Nationalt Center for Miljø og

Læs mere

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. april 2015 Ib Krag Petersen

Læs mere

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 5. juli 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Anskydning af kortnæbbet gås - opdatering 2016

Anskydning af kortnæbbet gås - opdatering 2016 Anskydning af kortnæbbet gås - opdatering 2016 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. maj 2016 Jesper Madsen og Lars Haugaard Institut for Bioscience Antal sider: 5 Faglig kommentering:

Læs mere

Anskydning af vildt. Status for undersøgelser

Anskydning af vildt. Status for undersøgelser Anskydning af vildt. Status for undersøgelser 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. november 2013 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Forslag vedr. jagt på gæs på landjorden i januar

Forslag vedr. jagt på gæs på landjorden i januar Forslag vedr. jagt på gæs på landjorden i januar Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. april 2013 Thomas Kjær Christensen Jesper Madsen Tommy Asferg Institut for Bioscience Rekvirent:

Læs mere

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden 2005-2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. april 2014 30. april 2014 Søren

Læs mere

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. oktober 2013 Thomas Eske Holm Ib

Læs mere

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Artikel 17 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 28. juni 2013 Hanne Bach & Jesper Fredshavn

Læs mere

DCE S KVALITETSSIKRINGS- PROCEDURER

DCE S KVALITETSSIKRINGS- PROCEDURER DCE S KVALITETSSIKRINGS- PROCEDURER Susanne Boutrup Chefkonsulent 6. FEBRUAR 2017 KRAV TIL DEN FAGLIGE RÅDGIVNING Høj faglig kvalitet Rettidighed Intern koordinering Synlighed af resultater Dialog med

Læs mere

Rastende trækfugle på Tipperne 2012

Rastende trækfugle på Tipperne 2012 Rastende trækfugle på Tipperne 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2013 Ole Amstrup 1 Mogens Bak 1 Karsten Laursen 2 1 Amphi Consults 2 Institut for Bioscience Rekvirent:

Læs mere

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14. oktober 2013 Forfatter Liselotte Sander Johansson Institut for

Læs mere

Statistisk analyse af næringsstoffers stabilitet

Statistisk analyse af næringsstoffers stabilitet Statistisk analyse af næringsstoffers stabilitet Notat fra DCE Nationalt Center for Miljø og Energi Dato: 4. august 216 Jacob Carstensen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 21

Læs mere

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus ved Flakfortet Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. maj 2013 Jonas Teilmann Ib Krag Petersen

Læs mere

Ulves naturlige skyhed i områder med høj befolkningstæthed

Ulves naturlige skyhed i områder med høj befolkningstæthed Ulves naturlige skyhed i områder med høj befolkningstæthed Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 22. juni 2015 Peter Sunde Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

Peter Sunde (Seniorforsker) Ændr 2. linje i overskriften til AU Passata Light AARHUS UNIVERSITET SKOVDYRKERFORENINGEN 23.

Peter Sunde (Seniorforsker) Ændr 2. linje i overskriften til AU Passata Light AARHUS UNIVERSITET SKOVDYRKERFORENINGEN 23. til Passata Light ULVETIMEN - FÅ STYR PÅ FAKTA til Passata Light Peter Sunde (Seniorforsker) Aarhus Universitet Institut for Bioscience Faunaøkologi - Kalø til Passata Light ULVETIMEN - FÅ STYR PÅ FAKTA

Læs mere

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 16. april 2013 Thomas Eske Holm Karsten Dahl Jonas Teilmann

Læs mere

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 01. december 2013 Rettet: 21. februar 2014 og 8. marts 2014 Lars M. Svendsen

Læs mere

Rastefugle på Tipperne 2013

Rastefugle på Tipperne 2013 Rastefugle på Tipperne 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. marts 2014 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

Forventet synlighed og adfærd af ynglende ulve i Danmark

Forventet synlighed og adfærd af ynglende ulve i Danmark Forventet synlighed og adfærd af ynglende ulve i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. september 2015 Peter Sunde Institut for Bioscience Rekvirent: Naturstyrelsen Antal

Læs mere

Interkalibrering Sedimentprøvetagning i søer

Interkalibrering Sedimentprøvetagning i søer Interkalibrering Sedimentprøvetagning i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato:. december 2012 Liselotte Sander Johansson Martin Søndergaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Notat vedr. tidlig såning af vintersæd i Landovervågningen

Notat vedr. tidlig såning af vintersæd i Landovervågningen Notat vedr. tidlig såning af vintersæd i Landovervågningen Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. februar 217 Anton Rasmussen Institut for Bioscience Rekvirent: Landbrugs- og Fiskeristyrelsen

Læs mere

Berigtigelse vedrørende tre ulve-artikler i Flora og Fauna 121 (1+2)

Berigtigelse vedrørende tre ulve-artikler i Flora og Fauna 121 (1+2) Berigtigelse vedrørende tre ulve-artikler i Flora og Fauna 121 (1+2) Thomas Secher Jensen, Aksel Bo Madsen & Liselotte Wesley Andersen Kontaktperson: Peter Sunde, Institut for Bioscience - Kalø, Aarhus

Læs mere

Vurdering af to vandindtag, der bruges til udsanding af muslinger

Vurdering af to vandindtag, der bruges til udsanding af muslinger Vurdering af to vandindtag, der bruges til udsanding af muslinger Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14-06-2016 Hans H Jakobsen Christian Mohn Institut for Bioscience Rekvirent:

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2011/12

Vildtudbyttestatistik for jagtsæsonen 2011/12 Vildtudbyttestatistik for jagtsæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 15. oktober 2012 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016 Tillæg til Notat om omfordeling af arealdelen af husdyrgodkendelser i den nuværende regulering og ved forslag til ny husdyrregulering og effekter på kvælstofudledningen Notat fra DCE - Nationalt Center

Læs mere

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. september 2015 Bettina Nygaard & Jesper Bladt Institut for Bioscience

Læs mere

Holstebro Kommunes. Årsberetning. for

Holstebro Kommunes. Årsberetning. for Holstebro Kommunes Årsberetning for 2011 2 årsberetning 2011 Holstebro Kommune årsberetning 2011 Holstebro Kommune 3 4 årsberetning 2011 Holstebro Kommune årsberetning 2011 Holstebro Kommune 5 6 årsberetning

Læs mere

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11-06-2014 Forfatter: Steen Solvang Jensen

Læs mere

Forekomst af diarré hos danske rådyr i 2010/11 og 2011/12 analyseret på baggrund af oplysninger fra jægere og andre borgere

Forekomst af diarré hos danske rådyr i 2010/11 og 2011/12 analyseret på baggrund af oplysninger fra jægere og andre borgere Videnblad nr. 3 14. juni 2013 Forekomst af diarré hos danske rådyr i 2010/11 og 2011/12 analyseret på baggrund af oplysninger fra jægere og andre borgere Ole Roland Therkildsen 1, Karsten Laursen 1, Peter

Læs mere

Vurdering af algeområder tilhørende nye produktionsområder 2016

Vurdering af algeområder tilhørende nye produktionsområder 2016 Vurdering af algeområder tilhørende nye produktionsområder 2016 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 17. oktober 2016 Forfatter Christian Mohn og Hans H Jakobsen Institut for Bioscience

Læs mere

Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark

Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. april 2017 Liselotte W. Andersen Institut for

Læs mere

Udviklingen i luftkoncentrationen af svovldioxid i Danmark set i forbindelse med svovlreduktion i skibsbrændstof

Udviklingen i luftkoncentrationen af svovldioxid i Danmark set i forbindelse med svovlreduktion i skibsbrændstof Udviklingen i luftkoncentrationen af svovldioxid i Danmark set i forbindelse med svovlreduktion i skibsbrændstof Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. oktober 2016 Thomas Ellermann

Læs mere

DNA-analyser af odderekskrementer fra Sjælland

DNA-analyser af odderekskrementer fra Sjælland DNA-analyser af odderekskrementer fra Sjælland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. juli 2016 Liselotte Wesley Andersen, Bjarne Søgaard & Aksel Bo Madsen Institut for Bioscience

Læs mere

AARHUS UNIVERSITET. Fødevarestyrelsen. Vedrørende notat om Vurdering af to vandindtag, der bruges til udsanding af muslinger

AARHUS UNIVERSITET. Fødevarestyrelsen. Vedrørende notat om Vurdering af to vandindtag, der bruges til udsanding af muslinger AARHUS UNIVERSITET DCA - NATIONALT CENTER FOR FØDEVARER OG JORDBRUG Fødevarestyrelsen Vedrørende notat om Vurdering af to vandindtag, der bruges til udsanding af muslinger Fødevarestyrelsen har i mail

Læs mere

Spørgsmål Hvad kan ministeren oplyse om den kommende forvaltningsplan for ulve i Danmark

Spørgsmål Hvad kan ministeren oplyse om den kommende forvaltningsplan for ulve i Danmark Udvalget for Landdistrikter og Øer 2012-13 ULØ Alm.del Bilag 164 Offentligt J.nr. NST-4101-00479 25. juni 2013 Miljøministerens besvarelse af spørgsmål nr. R stillet af Folketingets Udvalg for landdistrikter

Læs mere

NATIONALT CENTER FOR MILJØ OG ENERGI 1

NATIONALT CENTER FOR MILJØ OG ENERGI 1 1 Titel: Udtagning af sedimentprøve til analyse for miljøfremmede stoffer i søer. Dokumenttype: Teknisk anvisning Forfatter: Liselotte Sander Johansson Fagdatacenter for Ferskvand Institut for Bioscience

Læs mere

Kriterier for ringduers yngletid og forårstræktid

Kriterier for ringduers yngletid og forårstræktid Kriterier for ringduers yngletid og forårstræktid Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Kevin Kuhlmann Clausen & Thomas Eske Holm Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2012/13

Vildtudbyttestatistik for jagtsæsonen 2012/13 Vildtudbyttestatistik for jagtsæsonen 2012/13 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 8. november 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 9 Faglig

Læs mere

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen Arealer, urbanisering og naturindhold i, strandbeskyttelseslinjen og klitfredningslinjen Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. september 2015 Gregor Levin Institut for Miljøvidenskab,

Læs mere

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler DNA-profil analyse Indledning DNA-profil analyser eller i daglig tale DNA-fingeraftryk er en metode, der bruges, når man skal finde ud af, hvem der er far et barn, hvis der altså er flere muligheder. Det

Læs mere

Referat af tredje møde i Rådgivningspanelet for DCE Nationalt Center for

Referat af tredje møde i Rådgivningspanelet for DCE Nationalt Center for Møde den 26. juni 2014 kl. 10.00 14.00 Sted: Høgh-Guldbergs Gade 4, Bygning 1653, 8000 Aarhus C Til stede: Prodekan Kurt Nielsen; Direktør Hanne Bach; Direktør Carl-Emil Larsen; Chefkonsulent Carl Åge

Læs mere

Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder

Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12. maj 2014 Gitte Blicher-Mathiesen

Læs mere

Vedrørende miljøpositivliste for de af producentorganisationers driftsfonde, hvor investeringer kan støttes med 60 % fra EU

Vedrørende miljøpositivliste for de af producentorganisationers driftsfonde, hvor investeringer kan støttes med 60 % fra EU DCA - NATIONALT CENTER FOR FØDEVARER OG JORDBRUG AARHUS UNIVERSITET NaturErhvervstyrelsen Vedrørende miljøpositivliste for de af producentorganisationers driftsfonde, hvor investeringer kan støttes med

Læs mere

Genetiske fingeraftryk identificerer torsk

Genetiske fingeraftryk identificerer torsk Genetiske fingeraftryk identificerer torsk Einar Eg Nielsen (een@dfu.min.dk) Michael Møller Hansen (mmh@dfu.min.dk) Danmarks Fiskeriundersøgelser, Afdeling for Ferskvandsfiskeri Forskere ved DFU har vist

Læs mere

Konklusion vedrørende fakultetets organisering, faglig identitet og sammenhæng på institutter

Konklusion vedrørende fakultetets organisering, faglig identitet og sammenhæng på institutter Notat Konklusion vedrørende fakultetets organisering, faglig identitet og sammenhæng på institutter 1. Baggrund Der er i november/december 2014, som en del af opfølgningen på den interne problemanalyse,

Læs mere

Forekomst af diarré hos danske rådyr i 2010-11 analyseret på baggrund af oplysninger fra jægere og andre borgere.

Forekomst af diarré hos danske rådyr i 2010-11 analyseret på baggrund af oplysninger fra jægere og andre borgere. Videnblad nr. 1 11. maj 2011 Forekomst af diarré hos danske rådyr i 2010-11 analyseret på baggrund af oplysninger fra jægere og andre borgere. Peter Sunde 1, Ole Roland Therkildsen 1, Anne Sofie Hammer

Læs mere

1 Interviewdata: datateknisk anvisning Version: 1

1 Interviewdata: datateknisk anvisning Version: 1 Titel: Interviewdata i LOOP Dokumenttype: Teknisk anvisning Forfattere: FDC Stofudvaskning fra dyrkede arealer: Anton Rasmussen og Gitte Blicher-Mathiesen NST: Kirsten Broch TA henvisninger TA. nr.: Version:

Læs mere

Ulvene i Danmark. Kronologien i ulvens genkomst i Danmark

Ulvene i Danmark. Kronologien i ulvens genkomst i Danmark Ulvene i Danmark Kronologien i ulvens genkomst i Danmark Den generelle opfattelse er, at den første ulv i Danmark i nyere tid er den såkaldte Thy-ulv, som blev set i oktober 2012 og fundet død af en byld

Læs mere

Titel: Stoftransport. Dokumenttype: Teknisk anvisning B01. 08.08.2014 Gyldig fra: 01.01.2012 Sider: 7 Sidst ændret: 26.08.2014

Titel: Stoftransport. Dokumenttype: Teknisk anvisning B01. 08.08.2014 Gyldig fra: 01.01.2012 Sider: 7 Sidst ændret: 26.08.2014 Titel: Stoftransport Dokumenttype: Teknisk anvisning Forfattere: FDC Ferskvand: Jens Bøgestrand og Jytte Erfurt TA henvisninger TA. nr.: Version: Oprettet: DB01 1 08.08.2014 Gyldig fra: 01.01.2012 Sider:

Læs mere

Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen

Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen Jens Carl Streibig, KU Claus Tonni Hansen, Christian Ritz, KU,. Daniel Gerhard NZ Jens Erik Jensen, Seges

Læs mere

Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl

Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA.

Læs mere

Analyse. Er politisk selvværd bestemt af geografisk. 1 februar Af Julie Hassing Nielsen

Analyse. Er politisk selvværd bestemt af geografisk. 1 februar Af Julie Hassing Nielsen Analyse 1 februar 2017 Er politisk selvværd bestemt af geografisk placering? Af Julie Hassing Nielsen Danskernes geografiske placering og deres relation til centraladministrationen og det politisk system

Læs mere

Ynglefuglene på Tipperne 2014

Ynglefuglene på Tipperne 2014 Ynglefuglene på Tipperne 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. august 2014 Ole Thorup og Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 7 Redaktør:

Læs mere

Den Danske Vildtudbyttestatistik

Den Danske Vildtudbyttestatistik Underbilag F: Beskrivelse af database for vildtudbyttestatistik I udbuddet indgår to datasamlinger/databaser over henholdsvis den årlige Vildtudbyttestatistik (jf. nedenstående) og Vingeundersøgelser fra

Læs mere

Nye procedurer for IndFak

Nye procedurer for IndFak Modtager(e): Medarbejdere med tjenestested Roskilde, Silkeborg og Kalø NOTAT Nye procedurer for IndFak Sanne Olofsson Dolmer Økonomileder ST Dato: 29. maj 2012 Side 1/5 Som følge af den igangværende harmonisering

Læs mere

Bekendtgørelse om erhvervsmæssig konservering af visse dyrearter 1)

Bekendtgørelse om erhvervsmæssig konservering af visse dyrearter 1) BEK nr 328 af 19/03/2013 (Historisk) Udskriftsdato: 27. maj 2016 Ministerium: Miljøministeriet Journalnummer: Miljømin., Naturstyrelsen, j.nr. NST-304-00061 Senere ændringer til forskriften BEK nr 1914

Læs mere

SSOG Scandinavian School of Gemology

SSOG Scandinavian School of Gemology SSOG Scandinavian School of Gemology Lektion 12: Syntetisk smaragd Indledning Det er min forventning, med den viden du allerede har opnået, at du nu kan kigge på dette 20x billede til venstre af en syntetisk

Læs mere

BESKRIVER DANSK VANDLØBS FAUNA INDEKS ET VANDLØBS SANDE TILSTAND?

BESKRIVER DANSK VANDLØBS FAUNA INDEKS ET VANDLØBS SANDE TILSTAND? 30. JANUAR 2013 BESKRIVER ET VANDLØBS SANDE TILSTAND? - OG SIKRER DET REELT GOD ØKOLOGISK TILSTAND?, ESBEN A. KRISTENSEN & ANNETTE BAATTRUP-PEDERSEN DET KORTE SVAR ER: NEJ IKKE NØDVENDIGVIS Vandrammedirektivet

Læs mere

Beskæftigelsesundersøgelse 2011

Beskæftigelsesundersøgelse 2011 Beskæftigelsesundersøgelse 2011 Rapport for ph.d.-dimittender Januar 2012 For 2011 findes også rapporter for bachelordimittender og kandidatdimittender samt et notat med en opsummering af årets resultater.

Læs mere

Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16

Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16 Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 28. juni 2016 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen Antal

Læs mere

Nordsjælland J.nr. NST 229-00027 Ref. iddni Den 20. december 2014. Skovrejsningsrådet for Skævinge Skov

Nordsjælland J.nr. NST 229-00027 Ref. iddni Den 20. december 2014. Skovrejsningsrådet for Skævinge Skov Skovrejsningsrådet for Skævinge Skov Nordsjælland J.nr. NST 229-00027 Ref. iddni Den 20. december 2014 Mødereferat fra møde i Skovrejsningsrådet for Skævinge Skov. Mødet blev afholdt torsdag den 25. september

Læs mere

Anvendelse af DNA markører i planteforædlingen

Anvendelse af DNA markører i planteforædlingen Anvendelse af DNA markører i planteforædlingen Forsker Gunter Backes, Afdeling for Planteforskning, Forskningscentret Risø DNA-markører på kontaktfladen mellem molekylær genetik og klassisk planteforædling

Læs mere

Danskernes e-julehandel i 2013 Gang i e-julegavehandlen

Danskernes e-julehandel i 2013 Gang i e-julegavehandlen Notat Danskernes e-julehandel i 2013 Traditionen tro er julehandlen gået i gang, og danskerne bruger meget tid og mange penge på at købe julegaver til familie og venner. Dansk Erhverv har, på baggrund

Læs mere

0 Indhold NATIONALT CENTER FOR MILJØ OG ENERGI AARHUS UNIVERSITET. Version:

0 Indhold NATIONALT CENTER FOR MILJØ OG ENERGI AARHUS UNIVERSITET. Version: Dokumenttype: Teknisk anvisning Forfattere: Liselotte Sander Johansson Peter Wiberg-Larsen Fagdatacenter for Ferskvand Institut for Bioscience TA henvisninger TA. nr.: S08 Version: 1 Oprettet: 03.02.2012

Læs mere

Naturstyrelsens Referencelaboratorium for Kemiske Miljømålinger NOTAT

Naturstyrelsens Referencelaboratorium for Kemiske Miljømålinger NOTAT Naturstyrelsens Referencelaboratorium for Kemiske Miljømålinger NOTAT Til: Brugere af Bekendtgørelse om kvalitetskrav til miljømålinger udført af akkrediterede laboratorier, certificerede personer mv.

Læs mere