27611 Eksamen Sommer 2007

Størrelse: px
Starte visningen fra side:

Download "27611 Eksamen Sommer 2007"

Transkript

1 - Side 1 af Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00 13:00). DNA/Protein sekvenser kan kopieres direkte herfra det er ikke meningen at sekvenserne skal tastes ind i hånden. Lektionsplan: Svar til opgavesættes skal skrives enten i rå tekst (fx i Notepad/Wordpad/Nedit) eller i Microsoft Word (.doc) format. Dit studienummer skal fremgå af filnavnet (fx. s doc eller s txt) og skal stå i starten af dokumentet (fx: Studienummer: s ) Svaret skal oploades på CampusNet under kursus (under Afleveringer -> Eksamen 2007 ). Husk at gemme seneste version af dokumentet inden du oploader svaret. Underskriv desuden denne forside med studienummer og navn og aflever den til eksamensvagten. Lokalenummer og computernummer skal udfyldes med henblik på kontrol af netværkstrafikken. Navn: Studienummer: Lokalenummer: Computernummer: (For eksaminander i lokale 062, byg. 208 skriv nummeret på låget af den bærbære computer. For eksaminander i lokale 052 og 152 i byg. 210, brug oversigten på næste side).

2 - Side 2 af 10 - Oversigt over computernummerering i lokale 052 og 152 i bygning 210. Hvad gør man hvis en web-server ikke virker: 1) Verificer at input-data er i korrekt format. Forkert inputdata er i næsten alle tilfælde årsagen til problemet. 2) Rapporter fejlen til eksamensvagten den kursusansvarlige vil så blive tilkaldt.

3 - Side 3 af 10 - Opgave 1: Identifikation af ukendt DNA Denne opgave tæller 25% af sættet. Nedenstående sekvens er sekventeret direkte fra DNA som stammer fra en ukendt ikke-kultivérbar mikroorganisme. Det vides ikke hvorfra i genomet sekvensen stammer. Det er nu din opgave et finde ud af så meget som mulig om denne sekvens. Du skal i dit svar argumentere for valg af værktøjer og databaser, samt dokumentere dine svar med referencer til relevante sekvenser (fx. data i FASTA format, hvis du arbejder videre med sekvensen, eller referencer til GenBank/UniProt entries). 1. Bestem funktionen af sekvensen. a. Er det en sekvens der i forvejen er kendt? b. Er det muligt at finde beslægtede sekvenser med kendt funktion, der gør det muligt at bestemme funktionen? c. Beskriv den sandsynlige funktion. 2. a. Er sekvensen proteinkodende? b. Kan man forvente at sekvensen indeholder en komplet CDS? 3. Er det mulig at afgøre om sekvensen stammer fra en eukaryot eller prokaryot organisme? 4. Sekvensen indeholder enkelte bogstaver, der ikke er A,C, G eller T. a. Hvorfor kan dette forekomme? b. Hvad betyder det når der står S eller K? >unknown_fragment AATGGGCACGGGACGCATGTGGCAGGCACCATCGGGSCCGTCGGCAACAACGGTACGGGC GCAACTGGAATCAATTGGAACGTCCGCATCATGAGCCTGAAGTTCATGAGTTCCAGCGGC AGCGGCTACACCAGCGCCGCCGTGCAGGCGATCAACTACGCGGTGCGCATGGGCGCTAAG GTCATCAATAACAGTTGGGGTGGCGGCAGTTACGATCAGGCGCTGGCATCAACGATCCAG TTCGCTCAAAGCCGTGGTGTTATCGTGGTCAACGCGGCAGGAAACGACGGCGTTAACGTC GACGCTTCGCCATCGTACCCGGCGAGTCTGAATGGCGCCAACGTGCTGACGGTTGCCGCC ACCGATCAGAACAACAATCTCGCATCGTTCTCGAACTACGGTGCCGGCACGGTTGACATT GCCGCTCCGGGTGTGACCATTCTCAGCACTTACACCAGCGKCCGTTATGCATACATGAGC GGCACATCAATGGCCACTCCGAACGTCGCCGGCGTCGCC

4 - Side 4 af 10 - Opgave 2: Denne opgave tæller 30% af sættet. 2A): Psi-Blast 1) Hvis du kører en BLAST søgning med en protein sekvens mod NR og finder følgende tre hits, hvilket hit ville du vælge? a. 70% id, E værdi = 1.2 b. 25% id, E værdi = 10 c. 25%id, Eværdi = ) Hvad er protein sekvens (i FASTA format) for SwissProt entrien P11302? Brug Psi-Blast til at finde en homolog PDB struktur (med homolog forstås her en sekvens med en signifikant E værdi) 3) Hvor mange BLAST iterationer skal du køre for at finde en PDB struktur med en signifikant E værdi? 4) Hvad er navnet på den homologe PDB struktur, og hvad er E værdien for hittet? 2B): Spørgsmål Logo er og vægt matricer 1) Logo plottet nedenfor er genereret på baggrund af sekvenser, der vides at have en god binding til MHC. Hvilke er de to mest informative positioner?

5 - Side 5 af 10-2) Hvilke aminosyrer på position P2 vil give god binding? 3) Nedenfor er angivet en multiple alignment af et sæt peptider, der binder MHC. KPSEPGGVL SPALPGLKL SPKLPVSSL KPSLPFTSL SPYQNIKIL Benyt relationen for udregning af aminosyre frekvenser ud fra de observerede frekvenser og pseudo frekvenser til at udregne vægt matrice (log-odds) værdierne for E og K på position P1. Sæt β=4, og se bort fra sekvens vægtning.

6 - Side 6 af 10 - Opgave 3: Denne opgave tæller 5% af sættet. Hvilke af følgende sekvenser er i korrekt FASTA format. (Vælg en eller flere). (a): (b): (c): (d): (e): (f): (g): <Seq47 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >(gi 64141: , ) Oncorhynchus insulin gene for preproinsulin ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >(gi 64141: , ) Oncorhynchus insulin gene for preproinsulin Notice: Introns removed! ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >seq47 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >Seq47 1 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG 81 CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT 161 TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA 241 GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC 321 CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >seq47_2 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGT GTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGAC GCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAG GGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGT AAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAAC TGA LOCUS Seq47 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA

7 - Side 7 af 10 - Opgave 4: Sammenligning af insulin fra forskellige organismer Denne opgave tæller 40% af sættet. Som du måske husker fra øvelsen "Translation og proteindatabaser", bliver proteinhormonet insulin syntetiseret som et forstadium (precursor), hvorefter et signalpeptid og et propeptid spaltes fra før det når sin færdige (mature) form, som består af en A-kæde og en B-kæde. (Et tip som du får brug for senere: signalpeptider og propeptider findes i UniProt annoteret i feature-tabellen med betegnelsen (FtKey) henholdsvis "signal" og "propep"). Din opgave er nu at sammenligne insulin fra nogle forskellige organismer og finde ud af om signalpeptidet og propeptidet er mere eller mindre konserverede end A- og B-kæderne. 4A: SRS-søgning Først skal du ved hjælp af SRS fremstille et brugbart datasæt af aminosyresekvenser fra insulin. Vigtigt: Brug kun Swiss-Prot delen af UniProt. 1) Hvor mange entries i Swiss-Prot indeholder ordet "insulin" i beskrivelsen (altså ikke medregnet sammensætninger som "Insulin-activated" eller "Insulin-like")? Som du kan se, giver denne søgning en del resultater som ikke er insulin, men bare har noget at gøre med insulin. Nu skal du prøve at indsnævre denne søgning på forskellige måder. 2) Blad ned i resultatlisten til du kommer til hits med navnene "Insulin" og "Insulin precursor". Kig nærmere på nogle af dem. Hvad er helt præcist forskellen mellem dem der hedder "Insulin" og dem der hedder "Insulin precursor"? Det gælder nu om at begrænse søgningen til insulin-forstadier. Det ville naturligvis være nemmest hvis man kunne søge efter selve sammensætningen "Insulin precursor", men det virker ikke i SRS, idet SRS kun indekserer enkeltord, ikke hele sætninger/linier. Besvar i stedet følgende: 3) Hvor mange entries indeholder begge ordene "insulin" og "precursor" i beskrivelsen? Som du kan se, er der stadig andre proteiner end insulin med i sættet. Foreslå et eller flere ord, som kan tilføjes til søgningen for at begrænse sættet til insulin-forstadier.

8 - Side 8 af 10-4) 5) 6) 7) Hvilke(t) ord valgte du, og hvor mange er der nu tilbage? Undgå så de entries der ikke indeholder fuld længde sekvens (fragmenter). Hvor mange er der nu tilbage, og hvordan gennemførte du denne søgning? (NB: opgaven skal løses i SRS, det er ikke nok at tælle manuelt hvor mange der er!) Som sagt skal du analysere signalpeptider og propeptider. Det er derfor nødvendigt at begrænse sættet til de entries der både har et signalpeptid og et propeptid annoteret. Hvor mange entries med begge disse features findes der i hele Swiss-Prot (altså ikke kun blandt insulin-forstadier)? Kombiner dine to sidste søgninger for at besvare spørgsmålet: Hvor mange insulin-forstadier med annoteret signalpeptid og propeptid er der? (NB: hvis du ikke kunne løse spørgsmål 5, så kombiner resultaterne fra 4 og 6 i stedet). Resultatet af spørgsmål 7 er det ene af de to datasæt du skal bruge i anden halvdel af opgaven. Gem dette datasæt i FASTA format på den computer du arbejder på (Tip: i SRS skal du trykke "Save" og derefter sætte "Use view" til "FastaSeqs"). For at få et mere overskueligt datasæt at arbejde videre med, skal du også lave en udgave der er begrænset til primater (se følgende punkter): 8) 9) 10) Hvor mange entries fra primater findes der i hele Swiss-Prot? (Tip: hvis du ikke ved hvad primater hedder på latin, så kig nærmere på det humane entry fra dit tidligere datasæt og check feltet "Taxonomy"). Kombiner dine to sidste søgninger for at lave det lille datasæt af insulinforstadier med annoteret signalpeptid og propeptid fra primater. Hvor mange sekvenser indeholder det? Skriv alle entry-navnene (ID'erne) i dit svar! Kig nærmere på featuretabellerne i primat-datasættet. Angiv a. sidste position i signalpeptidet, b. første position i propeptidet, og c. sidste position i propeptidet. Hvis positionen varierer mellem de forskellige entries, så angiv et interval! Gem også primat-datasættet fra spørgsmål 9 i FASTA format.

9 - Side 9 af 10-4B: Multiple alignment (Hjælp til dem der ikke klarede 4A: Hvis du ikke har fået to datasæt i FASTA format ud af spørgsmål 7 og 9, kan du alligevel godt besvare 4B. Vi har lagt to erstatningsdatasæt på kursus-hjemmesiden, som du kan downloade: Erstatningen for datasættet fra spørgsmål 9 hedder insulin-primaterudennavn.fasta, og vi har ændret navnene på sekvenserne, så du kan ikke bruge det til at besvare spørgsmål 9. Erstatningen for datasættet fra spørgsmål 7 hedder insulin-25-udennavn.fasta, og her har vi både ændret navne og fjernet et antal sekvenser, så du kan ikke bruge det til at besvare spørgsmål 7. Du får også brug for at se på annoteringen af Swiss-Prot entry INS_HUMAN for at besvare 4B, hvis du ikke har besvaret spørgsmål 10). Brug ClustalW til at lave et multiple alignment af det lille primat-datasæt fra spørgsmål 9. Det er OK at lade alle parametre være default værdier. Du vil observere at insulin fra forskellige primater er temmelig ens. Besvar nu følgende spørgsmål: 11) 12) Hvor mange positioner i dette alignment er ikke 100% konserverede? Der er et enkelt gap i en af sekvenserne. Forekommer dette i signalpeptidet, A- kæden, propeptidet eller B-kæden? Lav et tilsvarende alignment af det større insulin-datasæt fra spørgsmål 7. Du skulle nu meget gerne se en større variation i sekvenserne. For at få et overblik over graden af konservering på hver position skal du bruge alignment-editoren Jalview: tryk på knappen "Start Jalview" på resultatsiden. Bemærk at det samlede alignment på grund af gaps er længere end de enkelte sekvenser der indgår i det. Prøv nu at finde hvor grænserne går mellem signalpeptidet, A-kæden, propeptidet og B-kæden i dette alignment. Tip: positionen i alignmentet fremgår af aksen øverst i vinduet, mens positionen i den enkelte sekvens vises nederst, når du peger på en aminosyre med musen. 13) Find en af primatsekvenserne, hvor du jo kender positionerne fra spørgsmål 10, og brug den til at finde, i forhold til det samlede alignment : a. sidste position i signalpeptidet, b. første position i propeptidet, og c. sidste position i propeptidet. (op til to positioners unøjagtighed bliver regnet som korrekt svar) Nederst i Jalview-vinduet ser du blokdiagrammer over tre mål for konservering: "Conservation", "Quality" og "Consensus" (% identitet). (Tip: Hvis du ikke kan se dem, skal du gå til menuen "View" og sætte markering ved "Show Annotations").

10 - Side 10 af 10 - Tænk ikke på forskellen mellem disse tre mål, du skal bare kvalitativt bedømme graden af konservering i de forskellige regioner. 14) Sammenlign nu signalpeptidet, A-kæden, propeptidet og B-kæden. a. Er signalpeptidet mere eller mindre konserveret end A- og B-kæderne, eller er der ingen forskel? b. Er propeptidet mere eller mindre konserveret end A- og B-kæderne, eller er der ingen forskel?

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Sådan opretter du en elektronisk aflevering

Sådan opretter du en elektronisk aflevering Sådan arbejder du med opgaver i Gradebook/karakterbog Denne vejledning indeholder en detaljeret beskrivelse af hvordan du bruger gradebook/karakterbogen når du vil arbejde med opgaver og give karakterer

Læs mere

Databasesøgning med BLAST

Databasesøgning med BLAST Databasesøgning med BLAST Denne vejledning giver en introduktion til databasesøgning med forskellige programmer i BLAST-familien. Vejledningen indeholder først en grundig introduktion og gennemgang af

Læs mere

Immunologisk bioinformatik

Immunologisk bioinformatik Immunologisk bioinformatik Øvelsesvejledning Introduktion til øvelsen Når man i dagligdagen taler om influenza, bliver virussen ofte forbundet med forbigående og ufarlig sygdom. Som regel har mennesker

Læs mere

Hvilke felter i GeoEnviron, der benyttes i tilsynsrapporter, er angivet i disse to pdf-filer:

Hvilke felter i GeoEnviron, der benyttes i tilsynsrapporter, er angivet i disse to pdf-filer: TILSYNSRAPPORT FOR LANDBRUG ELLER VIRKSOMHED Med kan I lave omfattende tilsynsrapporter. Begge rapporter skrives i Word med alle data fra GeoEnviron. Data overføres til Word via bogmærker i en prædefineret

Læs mere

Tilpas: Hurtig adgang

Tilpas: Hurtig adgang Tilpas: Hurtig adgang Genveje, Se skærmtips Se tips Hold alt tasten nede. Og brug bogstaver Word Fanen Filer PDF dokument Brug skabelon Visninger Husk Luk ved fuldskærmsvisning Brug zoom skyder Marker,

Læs mere

Introduktion til de praktiske øvelser

Introduktion til de praktiske øvelser Introduktion til de praktiske øvelser Vi vil i dag fokusere på tre forskellige online software til SNP analyser snptree NDtree CSIphylogony Introduktion til SNP analyser http://cge.cbs.dtu.dk/services/all.php

Læs mere

SÅDAN BRUGER DU REGNEARK INTRODUKTION

SÅDAN BRUGER DU REGNEARK INTRODUKTION SÅDAN BRUGER DU REGNEARK INTRODUKTION I vejledningen bruger vi det gratis program Calc fra OpenOffice som eksempel til at vise, hvordan man bruger nogle helt grundlæggende funktioner i regneark. De øvrige

Læs mere

vejledning sådan ARBejdeR du i ebg s RAppoRTvæRKTøj

vejledning sådan ARBejdeR du i ebg s RAppoRTvæRKTøj vejledning sådan arbejder du i ebg s rapportværktøj Vejledning for 2013/2014 Sådan arbejder du i EBG's rapportværktøj www.business-games.dk Indholdsfortegnelse: Forord... 2 Login... 2 Rapportværktøjet...

Læs mere

Qbrick s krav til video filtyper

Qbrick s krav til video filtyper Indhold Qbrick s krav til video filtyper... 1 Krav til ordningen/området... 1 Qbrick s krav til video leverandør... 1 Video og billede størrelser i WCM:... 1 Upload en video... 2 Trin 1: Mediefiler...

Læs mere

Skifte til Outlook 2010

Skifte til Outlook 2010 I denne vejledning Microsoft Microsoft Outlook 2010 ser meget anderledes ud end Outlook 2003, og vi har derfor oprettet denne vejledning, så du hurtigere kan komme i gang med at bruge programmet. Læs videre

Læs mere

TK/TBL / 25.08.2014 v.0.1. DigiMatch. Elektronisk Kamprapport

TK/TBL / 25.08.2014 v.0.1. DigiMatch. Elektronisk Kamprapport TK/TBL / 25.08.2014 v.0.1 DigiMatch Elektronisk Kamprapport 1 Procedure før kampstart... 3 DigiMatch download... 3 Registerniveau... 7 Indstillinger... 9 Login... 9 Tilpas knapperne... 10 Kampregistrering...

Læs mere

Undervisning Version 1.0 redigering af billeder til hjemmesiden

Undervisning Version 1.0 redigering af billeder til hjemmesiden Undervisning Version 1.0 redigering af billeder til hjemmesiden Nødvendigheden for at almindelig god bruger til edb. Her taler jeg ikke om at blive en superbruger men bare en bruger der styr på almindelig

Læs mere

Brug af IT-udstyr ved skriftlig eksamen

Brug af IT-udstyr ved skriftlig eksamen Brug af IT-udstyr ved skriftlig eksamen Ved brug af skolens IT-udstyr til skriftlig eksamen skal du: Medbringe dit UNI-login Oprette sidehoved/-fod til dine dokumenter (skolen har en færdig skabelon, som

Læs mere

Brugervejledning til Kørebog for Pocket PC

Brugervejledning til Kørebog for Pocket PC Brugervejledning til Kørebog for Pocket PC Denne vejledning beskriver kort anvendelsen af Kørebog for Pocket PC version 3.0 Programmet giver mulighed for registrering af den daglige kørsel. Registreringen

Læs mere

Kom godt igang med Indbo programmet fra PetriSoft Kort om Indbo: Indbo Free

Kom godt igang med Indbo programmet fra PetriSoft Kort om Indbo: Indbo Free Kom godt igang med Indbo programmet fra PetriSoft Kort om Indbo: Indbo er et Windows 98/NT/2000/Me/Xp/Vista/Win7/Win8 program, der kan holde rede på hjemmets, firmaets, foreningens eller skolens inventar

Læs mere

Hjemmesiden er opdelt i et sidehoved, en sidefod og mellem disse 3 kolonner: venstre, midterste og højre. Højre kolonne vises dog kun på forsiden.

Hjemmesiden er opdelt i et sidehoved, en sidefod og mellem disse 3 kolonner: venstre, midterste og højre. Højre kolonne vises dog kun på forsiden. Hjemmesiden er opdelt i et sidehoved, en sidefod og mellem disse 3 kolonner: venstre, midterste og højre. Højre kolonne vises dog kun på forsiden. VENSTRE kolonne indeholder flere elementer (se illustration

Læs mere

Kom godt igang med Inventar registrering

Kom godt igang med Inventar registrering Kom godt igang med Inventar registrering (InventoryDB) (Med stregkodesupport) programmet fra PetriSoft Introduktion... 1 Inventar registrering... 2 Værktøjsudleje... 3 Service database til reperationer

Læs mere

Svar på de mest almindelige Citrix spørgsmål

Svar på de mest almindelige Citrix spørgsmål Svar på de mest almindelige Citrix spørgsmål Henrik Meyer og Ajâja Hyttel Oprettet: 24/6-13 Sidst revideret 14/5-14 h t t p s : / / c i t r i x. a a b n e t. d k Hvad er nyt i Citrix?... 2 Hvis du ikke

Læs mere

Brugermanual SÅDAN GØR DU:

Brugermanual SÅDAN GØR DU: Brugermanual SÅDAN GØR DU: Uanset hvad du skal lave i Klubcms, skal du altid logge dig på og det gør du ved at indtaste følgende i din browser: http://klubcms.dbu.dk/admin/login.aspx Indtast dit brugernavn

Læs mere

På min hjemmeside under Libre Draw finder du nederst en skabelon Skabelon med 2 spalter. Det er den vi skal bruge i dette eksempel.

På min hjemmeside under Libre Draw finder du nederst en skabelon Skabelon med 2 spalter. Det er den vi skal bruge i dette eksempel. Side 1 Mange kender programmet Microsoft Publisher hvor man sætte forskellige ting op i, blade, skrivelser, sange m.m. Libre Office Draw der er en del af den gratis LibreOffice pakke kan noget i samme

Læs mere

VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER

VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER INDHOLDSFORTEGNELSE 1. Ludus - Log ind. side 3 2. Ludus - Skriv note til læreren, når du er syg side 4 3. Ludus

Læs mere

Når du har logget dig ind, ser du Randers Kommunes byvåben midt på siden. I venstre side er der en række mapper:

Når du har logget dig ind, ser du Randers Kommunes byvåben midt på siden. I venstre side er der en række mapper: DXP vejledning Generelt: DXP er et værktøj til at fremstille præsentationsmaterialer (foldere, brochurer, løbesedler mv.) DXP egner sig kun til mindre brochurer og lign., da den største skabelon kan rumme

Læs mere

Kort om CoinDB (Mønt- og seddelsamling):

Kort om CoinDB (Mønt- og seddelsamling): Kom godt i gang med CoinDB programmet fra PetriSoft (Holder styr på din Mønt- seddel- eller frimærkesamling) Kort om CoinDB (Mønt- og seddelsamling): CoinDB er et Windows program, der anvendes af mønt-

Læs mere

1.TILBUD NYT TILBUD 1.1 TRIN FORUDSÆTNINGER

1.TILBUD NYT TILBUD 1.1 TRIN FORUDSÆTNINGER 1.TILBUD Fanen Tilbud giver en oversigt over alle de tilbud, der ligger i din database. Det er også herfra, at du har mulighed for at oprette, kopiere eller redigere et eksisterende tilbud. Det følgende

Læs mere

Guide til DLG s elektroniske fakturalæsning. Sådan får du adgang til at læse alle dine tidligere bilag fra os

Guide til DLG s elektroniske fakturalæsning. Sådan får du adgang til at læse alle dine tidligere bilag fra os Guide til DLG s elektroniske fakturalæsning Sådan får du adgang til at læse alle dine tidligere bilag fra os Version nov. 2010 Indholdfortegnelse Trin 1 Adgang til landmandsportalen s. 3 Trin 2 Login til

Læs mere

WEB-DIRECT Brugerguide Eksportfunktion i WEB-DIRECT

WEB-DIRECT Brugerguide Eksportfunktion i WEB-DIRECT WEB-DIRECT Brugerguide Eksportfunktion i WEB-DIRECT Indhold 1. Kom godt i gang med eksportfunktionen... 3 2. Eksport... 4 2.1 Eksport i WEB-DIRECT... 4 2.2 Brugerdefineret eksport i WEB-DIRECT... 6 2.2.1

Læs mere

Vejledning til Photofiltre nr. 105 Side 1

Vejledning til Photofiltre nr. 105 Side 1 Side 1 Denne vejledning er et smalt grafikbillede man kan bruge i toppen af en mail lavet i PhotoFiltre 7 hvor man nu kan arbejde i lag. Med PhotoFiltre 7 er det nu endnu nemmere at sammensætte grafik

Læs mere

Vejledning KPK Online Prøverum

Vejledning KPK Online Prøverum Vejledning KPK Online Prøverum INDHOLD Introduktion side 2 Funktionsliste side 2 Få adgang til systemet side 3 Opload dine billeder side 4 Sådan bruges systemet side 5 Gem dine eksempler side 7 Side 1/7

Læs mere

BørneIntra hjemmesidekursus

BørneIntra hjemmesidekursus BørneIntra hjemmesidekursus hjemmesidekursus Januar 2012 Indhold 1 Introduktion... 5 1.1 Kursets formål... 5 1.2 Hjemmesiden opbygges i PersonaleIntra... 5 2 Hjemmesidens indhold... 6 2.1 Hjemmesidens

Læs mere

Mamut Enterprise Abonnementsfakturering

Mamut Enterprise Abonnementsfakturering Mamut Enterprise Abonnementsfakturering Mamut Enterprise Abonnementsfakturering er et værktøj til fakturering af kunder, som har faste aftaler eller abonnementer. Løsningen er inkluderet i Mamut Enterprise

Læs mere

Velkommen til IT for let øvede

Velkommen til IT for let øvede Velkommen til IT for let øvede at dias ligger på hjemmesiden, så I kan se dem igen hjemme. Peter har ordet Blev vi færdige med vinduerne?? Øvelse tastatur og mus vi ikke kunne sidste gang får I som hjemmeopgave

Læs mere

Opret CFU-kursusevaluering i Survey Xact

Opret CFU-kursusevaluering i Survey Xact Printvenlig side for Forsidetekst Opret CFU-kursusevaluering i Survey Xact www.survey-xact.dk Oprettelsen af en kursusevaluering består af flg. trin: 1. Oprettelse af spørgeskema ud fra en skabelon 2.

Læs mere

Brugersiderne for renteberegninger. Indhold. 1. Indledning. Anvendelse af. (Version 28. september 2014)

Brugersiderne for renteberegninger. Indhold. 1. Indledning. Anvendelse af. (Version 28. september 2014) Anvendelse af Brugersiderne for renteberegninger. (Version 28. september 2014) Indhold Brugersiderne for renteberegninger.... 1 1. Indledning... 1 2. Forudsætninger... 4 3. Indtastning af udbetaling/skyldigt

Læs mere

Regneark LibreOffice. Øvelseshæfte. Version: September 2013

Regneark LibreOffice. Øvelseshæfte. Version: September 2013 Regneark LibreOffice Øvelseshæfte Version: September 2013 Indholdsfortegnelse Øvelserne...4 Øvelse 1 Gem en kopi...4 Øvelse 2 Omdøb faneblad + lav en kopi...4 Øvelse 3 - tekstombrydning...5 Øvelse 4 Sorter

Læs mere

Mendeley er både en reference manager og et akademisk socialt netværk.

Mendeley er både en reference manager og et akademisk socialt netværk. Mendeley på Mac Mendeley er både en reference manager og et akademisk socialt netværk. Mendeley kan hjælpe dig med at organisere din forskning og samarbejde med andre online. Mendeley kan generere litteraturlister

Læs mere

Den digitale Underviser. Clouds. Dropbox

Den digitale Underviser. Clouds. Dropbox Den digitale Underviser Clouds Dropbox Indhold Indhold... 1 Dropbox... 1 Installer Dropbox... 2 Åbn Dropbox fra egen computer... 2 Åbn Dropbox fra en anden computer... 3 Lagre filer i Dropbox (offline

Læs mere

5. OPSÆTNING DOKUMENTSKABELONER 5.1 TRIN

5. OPSÆTNING DOKUMENTSKABELONER 5.1 TRIN 5. OPSÆTNING DOKUMENTSKABELONER Under fanen Dok. skabeloner kan du arbejde med de skabeloner som du har i systemet, eller du kan oprette nye. I denne vejledning kigger vi på hvordan du kan tilrette selve

Læs mere

Guide til, hvordan du tilføjer en GIPPLER- fane til din Facebook side

Guide til, hvordan du tilføjer en GIPPLER- fane til din Facebook side Guide til, hvordan du tilføjer en GIPPLER- fane til din Facebook side Bemærk! Vi bruger i denne guide både Facebook og en applikation på Facebook for, at lave din GIPPLER- fane. Vi kan af naturlige årsager

Læs mere

APPENDIX A INTRODUKTION TIL DERIVE

APPENDIX A INTRODUKTION TIL DERIVE APPENDIX A INTRODUKTION TIL DERIVE z x y z=exp( x^2 0.5y^2) CAS er en fællesbetegnelse for matematikprogrammer, som foruden numeriske beregninger også kan regne med symboler og formler. Det betyder: Computer

Læs mere

Orddeling. Automatisk orddeling. Manuel orddeling. Word 2010 18 thoremil.dk. Vælg fanebladet [Sidelayout] Vælg [Orddeling] Markér Automatisk orddeling

Orddeling. Automatisk orddeling. Manuel orddeling. Word 2010 18 thoremil.dk. Vælg fanebladet [Sidelayout] Vælg [Orddeling] Markér Automatisk orddeling Orddeling Automatisk orddeling Vælg [Orddeling] Markér Automatisk orddeling Manuel orddeling Vælg [Orddeling] Klik [Manuelt] For hvert ord, som vises, kan der gøres følgende: Accepter det foreslåede orddelingssted

Læs mere

Lederguide INNOMATE HR - Oplæg. Log på Log på https://www.innomate.com/innomate/oceanteam/default.aspx med: MUS

Lederguide INNOMATE HR - Oplæg. Log på Log på https://www.innomate.com/innomate/oceanteam/default.aspx med: MUS Lederguide INNOMATE HR - Oplæg Log på Log på https://www.innomate.com/innomate/oceanteam/default.aspx med: Bruger ID: personalenummer Password: (eget password) INNOMATE HR er et Internetbaseret system,

Læs mere

Sådan opdaterer og vedligeholder du din hjemmeside i Wordpress.

Sådan opdaterer og vedligeholder du din hjemmeside i Wordpress. Wordpress manual Sådan opdaterer og vedligeholder du din hjemmeside i Wordpress. Dette er en manual til de mest grundlæggende ting og funktioner i Wordpress, så du selv kan redigere indholdet eller tilføje

Læs mere

IT-Brugerkursus. Modul 1 - Introduktion til skolens netværk og FC. Modul 1 - Introduktion til FC og Lectio. Printvenligt format. Indholdsfortegnelse

IT-Brugerkursus. Modul 1 - Introduktion til skolens netværk og FC. Modul 1 - Introduktion til FC og Lectio. Printvenligt format. Indholdsfortegnelse Modul 1 - Introduktion til FC og Lectio IT-Brugerkursus Modul 1 - Introduktion til skolens netværk og FC Printvenligt format Indholdsfortegnelse Formål og opbygning Opgave Vejledning til intranettet Åbne

Læs mere

Statistik (deskriptiv)

Statistik (deskriptiv) Statistik (deskriptiv) Ikke-grupperede data For at behandle ikke-grupperede data i TI, skal data tastes ind i en liste. Dette kan gøres ved brug af List, hvis ikon er nr. 5 fra venstre på værktøjsbjælken

Læs mere

Oversigts billedet: Statistik siden:

Oversigts billedet: Statistik siden: 1 Tilslutning: Tilslut et nætværks kabel (medfølger ikke) fra serverens ethernet port til din router. Forbind derefter bus kablet til styringen, brun ledning til kl. 29, hvid ledning til kl. 30 Forbind

Læs mere

Undersøgelse af GVU og EUD for voksne

Undersøgelse af GVU og EUD for voksne Undersøgelse af GVU og EUD for voksne Forslag til beregning af tal til undersøgelse udsendt af Danmarks Evalueringsinstitut (EVA) sendt i mail til alle skoler 9. oktober 2012 09:45 EASY-P konsulenterne

Læs mere

MANUAL - Joomla! Version 1

MANUAL - Joomla! Version 1 MANUAL - Joomla! Version 1 Indhold Retningslinjer for hjemmesiden... 3 Log ind... 3 Ret i en artikel, der allerede er oprettet... 4 Opret ny artikel... 8 a) Skriv direkte i tekstfelt... 9 b) Indsæt tekst

Læs mere

Brugervejledning. Miljøministeriet A4. Opdateret den 25. oktober 2011

Brugervejledning. Miljøministeriet A4. Opdateret den 25. oktober 2011 Brugervejledning Miljøministeriet A4 Opdateret den 25. oktober 2011 Indholdsfortegnelse Introduktion... 3 Opret et nyt dokument... 3 Før du starter... 4 Om at arbejde med typografier:... 5 Menu: A4 - Publikation...

Læs mere

Billeder på hjemmeside

Billeder på hjemmeside Billeder på hjemmeside Indholdsfortegnelse Emne 1. Billedredigering (Microsoft Picture Manager) Side 3 a. Komprimer billeder b. Beskæring af billeder 3 9 2. Billeder og tekst ved hjælp af en skabelon (Template

Læs mere

Manual til at arbejde med POI på Garmin GPS.

Manual til at arbejde med POI på Garmin GPS. Manual til at arbejde med POI på Garmin GPS. Michael Pedersen (mike42dk) mike42dk@gratispoi.dk Juli 2009 Version 2.1 Jeg fralægger mig alt ansvar for den skade du kan komme til at forsage ved din GPS,

Læs mere

Manual til hjemmeside i Typo3

Manual til hjemmeside i Typo3 Manual til hjemmeside i Typo3 Gode tips og genvejstaster Ét linieskift Ctrl + A Ctrl + C Ctrl + X Ctrl + V shift + enter (tasten du normalt bruger til linieskift) Markér alt Kopier Klip Sæt ind Oprettelse

Læs mere

DANMARKS NATIONALBANK Kvikguide til FIONA Online. Indberetning af finansielle mellemværender til Nationalbanken

DANMARKS NATIONALBANK Kvikguide til FIONA Online. Indberetning af finansielle mellemværender til Nationalbanken DANMARKS NATIONALBANK Indberetning af finansielle mellemværender til Nationalbanken Kom på FIONA Online - 1 Indledning kun relevant for nye indberettere NB Kom på FIONA Online - 1 Indledning kun relevant

Læs mere

EVALUERING I SURVEYXACT TRIN FOR TRIN

EVALUERING I SURVEYXACT TRIN FOR TRIN EVALUERING I SURVEYXACT TRIN FOR TRIN LÆR AT TACKLE 2015 KOMITEEN FOR SUNDHEDSOPLYSNING 1 INDLEDNING Komiteen for Sundhedsoplysning stiller SurveyXact et internetbaseret redskab til kvalitetssikring til

Læs mere

Vejledning 2015. På bordene ligger omslag til din besvarelse, med dit navn på. Sæt dig ved bordet med dit omslag.

Vejledning 2015. På bordene ligger omslag til din besvarelse, med dit navn på. Sæt dig ved bordet med dit omslag. Vejledning 2015 Eksamen Indhold: 1. Ved prøvens begyndelse 2. Under prøven 3. Aflevering af din besvarelse 4. Regler for eksamen generelt 5. Brug af computer 6. Brug af ordbøger 7. Udeblivelse og snyd

Læs mere

Indhold. 1. Adgang og afslutning

Indhold. 1. Adgang og afslutning 1 Indhold 1. Adgang og afslutning 2. Menupunkter 3. Tekst 4. Billeder 5. Video 6. Lyd 7. Bannere 8. Bokse 9. Dokumenter 10. Links 11. Iframe 12. Markedspladsen 13. Nyheder 14. Job 15. Kalender 16. Selvbetjeningsbjælken

Læs mere

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold: Sådan opdaterer du din hjemmeside i Wordpress.

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold: Sådan opdaterer du din hjemmeside i Wordpress. Manual til Wordpress Sådan opdaterer du din hjemmeside i Wordpress. Dette er en manual til de mest grundlæggende ting, så du selv kan redigere indholdet og lægge nyt på din hjemmeside. Guiden er skrevet

Læs mere

Google Apps. Lær at oprette, organisere, dele og slette dokumenter. Udarbejdet af PLC, version 2013!!!!!!! Side 1 af 9

Google Apps. Lær at oprette, organisere, dele og slette dokumenter. Udarbejdet af PLC, version 2013!!!!!!! Side 1 af 9 Lær at oprette, organisere, dele og slette dokumenter. Udarbejdet af PLC, version 2013!!!!!!! Side 1 af 9 Arbejde i faner Google Apps arbejder i faner, derfor er det vigtigt, du er bekendt med det. Mappen

Læs mere

09/03 2009 Version 1.4 Side 1 af 37

09/03 2009 Version 1.4 Side 1 af 37 Login til DJAS Gå ind på adressen http://www.djas.dk I feltet Brugernavn skrives den e-mail adresse som brugeren er registeret med i systemet. I feltet Password skrives brugerens adgangskode. Ved at sætte

Læs mere

Daglig brug af JitBesked 2.0

Daglig brug af JitBesked 2.0 Daglig brug af JitBesked 2.0 Indholdsfortegnelse Oprettelse af personer (modtagere)...3 Afsendelse af besked...4 Valg af flere modtagere...5 Valg af flere personer der ligger i rækkefølge...5 Valg af flere

Læs mere

Sammenknytning af listedata fra MUD til tabel i MapInfo (SVM-eksempel)

Sammenknytning af listedata fra MUD til tabel i MapInfo (SVM-eksempel) Sammenknytning af listedata fra MUD til tabel i MapInfo (SVM-eksempel) Indhold Introduktion...1 Eksport og tilpasning af tabeldata MUD...1 Direkte til Excel...1 Via Rapport i Word-format til Excel...1

Læs mere

Hvis du ikke kan huske adgangskoden, har andre problemer med at logge på eller ikke er oprettet, skal du kontakte:

Hvis du ikke kan huske adgangskoden, har andre problemer med at logge på eller ikke er oprettet, skal du kontakte: Mini-guide til Retox Databasen er tilgængelig fra www.retox.dk, klik på linket Som udgangspunkt er der se-adgang til arbejdspladsbrugsanvisningerne. Hvis der skal tilføjes eller fjernes produkter, og hvis

Læs mere

My booking. Generelt. Forsiden. Version 9.0

My booking. Generelt. Forsiden. Version 9.0 My booking Version 9.0 System til at lave online bookinger, med mulighed for opdeling i grupper, forskellige booking typer, ændre layout indstillinger, status styring, sprogvalg samt en del mere, detaljer

Læs mere

VEJLEDNING I BRUG AF EBGs HJEMMESIDE

VEJLEDNING I BRUG AF EBGs HJEMMESIDE VEJLEDNING I BRUG AF EBGs HJEMMESIDE Vejledning i brug af EBG s hjemmeside 2014/2015 www.business-games.dk Indholdsfortegnelse: Forord... 2 Login... 2 Til lærerne... 3 Skoleprofil... 3 Holdoversigt...

Læs mere

SecureAware Compliance Analysis Manual

SecureAware Compliance Analysis Manual SecureAware Compliance Analysis Manual Manualen beskriver brugen af SecureAware version 3 Dokument opdateret: november 2009 Om dette dokument Dette dokument er en vejledning i, hvordan du opretter compliance-checks.

Læs mere

WELLPLOT VER. 3 BRUGERMANUAL

WELLPLOT VER. 3 BRUGERMANUAL WELLPLOT VER. 3 BRUGERMANUAL I GIS 2002 Wellplot ver. 3 BRUGERMANUAL Udarbejdet for: I GIS ApS Titel: Wellplot ver. 3 Brugermanual Dokumenttype: Software manual Udgave: 1 Dato: 20-09-02 Udarbejdet af:

Læs mere

Brugervejledning. Hjemmesider med Cmsimple.

Brugervejledning. Hjemmesider med Cmsimple. 1af23 Brugervejledning. Hjemmesider med Cmsimple. 1. Forord. Denne brugervejledning er fremstillet for at hjælpe personer ved Lokalhistorisk Arkiver i ny Sønderborg kommune, som kun har ringe kendskab

Læs mere

FSFIs lynguide til DFRs elektronisk bevissystem

FSFIs lynguide til DFRs elektronisk bevissystem FSFIs lynguide til DFRs elektronisk bevissystem Dette er en kort guide i anvendelsen af Dansk Førstehjælpsråd elektroniske bevissystem. Guiden viser og forklarer hvordan du som instruktør og medlem af

Læs mere

Introduktion til billeddatabasen

Introduktion til billeddatabasen Introduktion til billeddatabasen Colourbox.dk Colourbox.dk er den billeddatabase som Odense Kommune har købt licens til. Det er vigtigt at bemærke, at der ikke er ubegrænset download af billeder. I materialet

Læs mere

BRUGERMANUAL FOR KLUBKOORDINATORER. Version 2.0

BRUGERMANUAL FOR KLUBKOORDINATORER. Version 2.0 BRUGERMANUAL FOR KLUBKOORDINATORER Version 2.0 Login Du skal vælge den klub som du tilhøre og dernæst indtaste din kode i feltet: Password. Regionsgolf-Danmark Administration Når du er logget ind i system

Læs mere

Annemette Søgaard Hansen/www.dinwebvejleder.dk

Annemette Søgaard Hansen/www.dinwebvejleder.dk Google Docs Dokumenter Indholdsfortegnelse Værktøjer... Side 3 Menuer... Side 5 Opgave... Side 8 Få adgang til filerne fra din computer... Side 16 Vejledende løsning... Side 17 GoogleDocs Dokumenter 2

Læs mere

Vælg det emneord, du vil bruge og klik på Continue. Nu vises de subheadings som knytter sig til emneordet:

Vælg det emneord, du vil bruge og klik på Continue. Nu vises de subheadings som knytter sig til emneordet: Embase Quick Guide Fritekstsøgning (Basic Search) Skriv dine søgeord i søgefeltet og klik på Search. Der er mulighed for at gøre søgningen bredere ved at vælge Include Related Terms". Avanceret søgnng

Læs mere

Tre sideopsætninger: 1 Forside. 2 Standard 3 Liste. 1 Forside. 2 Underside. 3 Liste

Tre sideopsætninger: 1 Forside. 2 Standard 3 Liste. 1 Forside. 2 Underside. 3 Liste 1 Forside Tre sideopsætninger: 1 Forside 2 Standard 3 Liste 2 Underside 3 Liste Ret indhold på en side I systemet kan du let rette tekst, link og billeder på hjemmesiden Først skal du logge ind i systemet

Læs mere

SDBF EN VEJLEDNING TIL SKOLERNES DIGITALE BLANKET FLOW - VEJLEDNING EFTERUDDANNELSESKURSISTER

SDBF EN VEJLEDNING TIL SKOLERNES DIGITALE BLANKET FLOW - VEJLEDNING EFTERUDDANNELSESKURSISTER SDBF EN VEJLEDNING TIL SKOLERNES DIGITALE BLANKET FLOW - VEJLEDNING EFTERUDDANNELSESKURSISTER Ajourført okt. 2014 LOGIN SDBF er en webbaseret løsning, som du kan tilgå fra alle kendte browsere; Internet

Læs mere

Hvordan opretter jeg MultiUser med en access-database?

Hvordan opretter jeg MultiUser med en access-database? Hvordan opretter jeg MultiUser med en access-database? Hvis du vil starte MultiUser med en access-database, skal du som det første downloade en access-database og placere den på et fælles drev. Du kan

Læs mere

Hjælp til MV-ID Administration

Hjælp til MV-ID Administration Hjælp til MV-ID Administration - til brugere af MV-Login Mikro Værkstedet A/S Dokumentversion: 20131002A 1 Indholdsfortegnelse Forord... 3 Kapitel 1. Aktivér MV-Login administratorkontoen... 4 Kapitel

Læs mere

Seniorklubben TDC Jylland Cloud Computing Kursus 2011_5: Rev. 02.11.2011

Seniorklubben TDC Jylland Cloud Computing Kursus 2011_5: Rev. 02.11.2011 1. Om 2. Valg af Google som gratis udbyder ved 3. Valg af browser 4. Oprette en mail-adresse (G-mail) og en konto ved Google 5. Hierarkisk opbygning af mappe- og filsystem i Google 6. Oprette mapper i

Læs mere

Spiked Reality. Kvikguide til oprettelse af tilbud, nyheder og begivenheder. Version 2.0, september 2013

Spiked Reality. Kvikguide til oprettelse af tilbud, nyheder og begivenheder. Version 2.0, september 2013 Spiked Reality Kvikguide til oprettelse af tilbud, nyheder og begivenheder Version 2.0, september 2013 Indholdsfortegnelse Indledning... 3 Mine oplysninger... 3 Online Administration... 3 Dit log ind...

Læs mere

Kom godt igang med OpenMeetings

Kom godt igang med OpenMeetings Kom godt igang med OpenMeetings Kom godt igang med OpenMeetings Side 2 Indholdsfortegnelse 1. Log på / Registrer dig... 3 1.1 Find Forsvarets Elektroniske Skole på internettet... 3 1.2 Login skærmen...

Læs mere

Graph brugermanual til matematik C

Graph brugermanual til matematik C Graph brugermanual til matematik C Forord Efterfølgende er en guide til programmet GRAPH. Programmet kan downloades gratis fra nettet og gemmes på computeren/et usb-stik. Det betyder, det også kan anvendes

Læs mere

Nemme skabeloner til brevudsendelse med Oracle BI Publisher Desktop

Nemme skabeloner til brevudsendelse med Oracle BI Publisher Desktop Nemme skabeloner til brevudsendelse med Oracle BI Publisher Desktop Indhold Nemme skabeloner til brevudsendelse med Oracle BI Publisher Desktop... 1 Download og installation af Oracle BI Publisher Desktop...

Læs mere

Vejledning til brug af FirstClass

Vejledning til brug af FirstClass Vejledning til brug af FirstClass - opdateret januar 2013 Indhold Installation af FirstClass foretages kun første gang... 2 Hent FirstClass-klienten... 2 Installer FirstClass-klienten... 3 Ændre kodeord...

Læs mere

PORTFOLIO Version 2.0

PORTFOLIO Version 2.0 Nikolaj Lisberg Hansen Løsningsarkitekt og partner nikolaj.hansen@empisto.dk Tlf. 22 90 91 22 PORTFOLIO Version 2.0 Kvalitetsstyring med sags og dokumenthåndtering Teknisk revision af energimærker Portfolio

Læs mere

Kassekladde. Fordi penge tager tid.

Kassekladde. Fordi penge tager tid. Kassekladde Fordi penge tager tid. Manual til Kassekladde 2012 Indholdsfortegnelse 1. Intro... s. 03 2. Kassekladde... s. 04 Opret bilag... s. 06 Redigere bilag... s. 07 Slet bilag... s. 08 Download bilag...

Læs mere

Mendeley er både en reference manager og et akademisk socialt netværk.

Mendeley er både en reference manager og et akademisk socialt netværk. Mendeley på PC er Mendeley er både en reference manager og et akademisk socialt netværk. Mendeley kan hjælpe dig med at organisere din forskning og samarbejde med andre online. Mendeley kan generere litteraturlister

Læs mere

En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau)

En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau) Matematik i WordMat En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau) Indholdsfortegnelse 1. Introduktion... 3 2. Beregning... 4 3. Beregning med brøker...

Læs mere

QUICK GUIDE TIL INDBERETNING AF WHEREABOUTS

QUICK GUIDE TIL INDBERETNING AF WHEREABOUTS Brugernavn og password QUICK GUIDE TIL INDBERETNING AF WHEREABOUTS Log into ADAMS on the Internet Udleveres af din antidopingorganisation ved udtagelse til prioriteret testgruppe Brug evt Forgot password

Læs mere

OPLYSNINGER TIL DIG når du skal til folkeskolens skriftlige afgangsprøver 2010

OPLYSNINGER TIL DIG når du skal til folkeskolens skriftlige afgangsprøver 2010 OPLYSNINGER TIL DIG når du skal til folkeskolens skriftlige afgangsprøver 2010 (Specielt ved brug af computer se nederst.) 1. Du skal møde i god tid. Hvis du kommer for sent, kan du normalt ikke deltage

Læs mere

Edb-tekstbehandling, præsentation mm

Edb-tekstbehandling, præsentation mm Edb-tekstbehandling, præsentation mm I denne lektion skal du: - hente kopier et skærmbillede og sætte det ind i et dokument - beskære billedet, så det passer til dit dokument Der findes specielle programmer

Læs mere

Easy Guide i GallupPC

Easy Guide i GallupPC Easy Guide i GallupPC Version. 6.00.00 Gallup A/S Masnedøgade 22-26 DK 2100 København Ø Telefon 39 27 27 27 Fax 39 27 50 80 Indhold SÅDAN KOMMER DU I GANG MED AT ANVENDE GALLUPPC... 2 TILFØJELSE AF UNDERSØGELSER

Læs mere

Rapport generator til Microsoft C5

Rapport generator til Microsoft C5 Generelt Rapportgeneratoren til C5 kan benyttes sammen med alle versioner af C5 og kræver INGEN tillægsmoduler eller tilkøb af C5. Den kører på: C5 version 1.5x, 1.6x, 2.x, 3.x, 4.x, 2008, 2010 og 2012.

Læs mere

Kvikke sider om rapportskrivning: Word-7

Kvikke sider om rapportskrivning: Word-7 Kvikke sider om rapportskrivning: Word-7 Målet med denne vejledning er, at du ved hvordan du opstiller en rapport, og hvad den skal indeholde. Det er vigtigt, at en rapport er let læselig, overskuelig

Læs mere

7DVWHYHMOHGQLQJ#²#,QWHUQHW#([SORUHU

7DVWHYHMOHGQLQJ#²#,QWHUQHW#([SORUHU 7DVWHYHMOHGQLQJ#²#,QWHUQHW#([SORUHU,QGKROGVIRUWHJQHOVH BROWSEREN - DE VIGTIGSTE FUNKTIONER OG BEGREBER.... 2 TILPAS BROWSEREN... 3 GÅ DIREKTE TIL EN KENDT ADRESSE... 5 LAV ET BOGMÆRKE... 6 ORGANISÉR DINE

Læs mere

Læs med CD-ORD 8. 4. Gem en lydfil. 5. Download af CD-ORD, Billedlæser, Skan Read og ekstra stemmer.

Læs med CD-ORD 8. 4. Gem en lydfil. 5. Download af CD-ORD, Billedlæser, Skan Read og ekstra stemmer. 4. Gem en lydfil Du kan få en tekst gemt som en lydfil, som du kan få oplæst fra din mobiltelefon, en mp3 -afspiller eller en anden computer. Det kunne være en større tekst som er scannet ind til dig,

Læs mere

1. Opbygning af et regneark

1. Opbygning af et regneark 1. Opbygning af et regneark Et regneark er et skema. Vandrette rækker og lodrette kolonner danner celler, hvori man kan indtaste tal, tekst, datoer og formler. De indtastede tal og data kan bearbejdes

Læs mere

MAC. Hvorfor printe til PDF?

MAC. Hvorfor printe til PDF? Hvordan laver jeg en korrekt PDF-fil? MAC Hvorfor printe til PDF? En printet PDF er optimeret til print, og indeholder ikke unødvendig information der kan gøre filen tung at printe. En printet PDF er derfor

Læs mere

Lederguide INNOMATE HR Medarbejderplan EASY. Log på MUS. Inviter til MUS

Lederguide INNOMATE HR Medarbejderplan EASY. Log på MUS. Inviter til MUS Lederguide INNOMATE HR Medarbejderplan EASY Log på Log på http://www.medarbejderplan.dk med: Bruger ID: initialer Firma ID: sosuherning Password: (er tidligere blevet udsendt på mail, hvorefter du er blevet

Læs mere