27611 Eksamen Sommer 2007

Størrelse: px
Starte visningen fra side:

Download "27611 Eksamen Sommer 2007"

Transkript

1 - Side 1 af Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00 13:00). DNA/Protein sekvenser kan kopieres direkte herfra det er ikke meningen at sekvenserne skal tastes ind i hånden. Lektionsplan: Svar til opgavesættes skal skrives enten i rå tekst (fx i Notepad/Wordpad/Nedit) eller i Microsoft Word (.doc) format. Dit studienummer skal fremgå af filnavnet (fx. s doc eller s txt) og skal stå i starten af dokumentet (fx: Studienummer: s ) Svaret skal oploades på CampusNet under kursus (under Afleveringer -> Eksamen 2007 ). Husk at gemme seneste version af dokumentet inden du oploader svaret. Underskriv desuden denne forside med studienummer og navn og aflever den til eksamensvagten. Lokalenummer og computernummer skal udfyldes med henblik på kontrol af netværkstrafikken. Navn: Studienummer: Lokalenummer: Computernummer: (For eksaminander i lokale 062, byg. 208 skriv nummeret på låget af den bærbære computer. For eksaminander i lokale 052 og 152 i byg. 210, brug oversigten på næste side).

2 - Side 2 af 10 - Oversigt over computernummerering i lokale 052 og 152 i bygning 210. Hvad gør man hvis en web-server ikke virker: 1) Verificer at input-data er i korrekt format. Forkert inputdata er i næsten alle tilfælde årsagen til problemet. 2) Rapporter fejlen til eksamensvagten den kursusansvarlige vil så blive tilkaldt.

3 - Side 3 af 10 - Opgave 1: Identifikation af ukendt DNA Denne opgave tæller 25% af sættet. Nedenstående sekvens er sekventeret direkte fra DNA som stammer fra en ukendt ikke-kultivérbar mikroorganisme. Det vides ikke hvorfra i genomet sekvensen stammer. Det er nu din opgave et finde ud af så meget som mulig om denne sekvens. Du skal i dit svar argumentere for valg af værktøjer og databaser, samt dokumentere dine svar med referencer til relevante sekvenser (fx. data i FASTA format, hvis du arbejder videre med sekvensen, eller referencer til GenBank/UniProt entries). 1. Bestem funktionen af sekvensen. a. Er det en sekvens der i forvejen er kendt? b. Er det muligt at finde beslægtede sekvenser med kendt funktion, der gør det muligt at bestemme funktionen? c. Beskriv den sandsynlige funktion. 2. a. Er sekvensen proteinkodende? b. Kan man forvente at sekvensen indeholder en komplet CDS? 3. Er det mulig at afgøre om sekvensen stammer fra en eukaryot eller prokaryot organisme? 4. Sekvensen indeholder enkelte bogstaver, der ikke er A,C, G eller T. a. Hvorfor kan dette forekomme? b. Hvad betyder det når der står S eller K? >unknown_fragment AATGGGCACGGGACGCATGTGGCAGGCACCATCGGGSCCGTCGGCAACAACGGTACGGGC GCAACTGGAATCAATTGGAACGTCCGCATCATGAGCCTGAAGTTCATGAGTTCCAGCGGC AGCGGCTACACCAGCGCCGCCGTGCAGGCGATCAACTACGCGGTGCGCATGGGCGCTAAG GTCATCAATAACAGTTGGGGTGGCGGCAGTTACGATCAGGCGCTGGCATCAACGATCCAG TTCGCTCAAAGCCGTGGTGTTATCGTGGTCAACGCGGCAGGAAACGACGGCGTTAACGTC GACGCTTCGCCATCGTACCCGGCGAGTCTGAATGGCGCCAACGTGCTGACGGTTGCCGCC ACCGATCAGAACAACAATCTCGCATCGTTCTCGAACTACGGTGCCGGCACGGTTGACATT GCCGCTCCGGGTGTGACCATTCTCAGCACTTACACCAGCGKCCGTTATGCATACATGAGC GGCACATCAATGGCCACTCCGAACGTCGCCGGCGTCGCC

4 - Side 4 af 10 - Opgave 2: Denne opgave tæller 30% af sættet. 2A): Psi-Blast 1) Hvis du kører en BLAST søgning med en protein sekvens mod NR og finder følgende tre hits, hvilket hit ville du vælge? a. 70% id, E værdi = 1.2 b. 25% id, E værdi = 10 c. 25%id, Eværdi = ) Hvad er protein sekvens (i FASTA format) for SwissProt entrien P11302? Brug Psi-Blast til at finde en homolog PDB struktur (med homolog forstås her en sekvens med en signifikant E værdi) 3) Hvor mange BLAST iterationer skal du køre for at finde en PDB struktur med en signifikant E værdi? 4) Hvad er navnet på den homologe PDB struktur, og hvad er E værdien for hittet? 2B): Spørgsmål Logo er og vægt matricer 1) Logo plottet nedenfor er genereret på baggrund af sekvenser, der vides at have en god binding til MHC. Hvilke er de to mest informative positioner?

5 - Side 5 af 10-2) Hvilke aminosyrer på position P2 vil give god binding? 3) Nedenfor er angivet en multiple alignment af et sæt peptider, der binder MHC. KPSEPGGVL SPALPGLKL SPKLPVSSL KPSLPFTSL SPYQNIKIL Benyt relationen for udregning af aminosyre frekvenser ud fra de observerede frekvenser og pseudo frekvenser til at udregne vægt matrice (log-odds) værdierne for E og K på position P1. Sæt β=4, og se bort fra sekvens vægtning.

6 - Side 6 af 10 - Opgave 3: Denne opgave tæller 5% af sættet. Hvilke af følgende sekvenser er i korrekt FASTA format. (Vælg en eller flere). (a): (b): (c): (d): (e): (f): (g): <Seq47 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >(gi 64141: , ) Oncorhynchus insulin gene for preproinsulin ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >(gi 64141: , ) Oncorhynchus insulin gene for preproinsulin Notice: Introns removed! ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >seq47 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >Seq47 1 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG 81 CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT 161 TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA 241 GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC 321 CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA >seq47_2 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGT GTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGAC GCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAG GGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGT AAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAAC TGA LOCUS Seq47 ATGGCCTTCTGGCTCCAAGCTGCATCTCTGCTGGTGTTGCTGGCGCTCTCCCCCGGGGTAGATGCTGCAG CTGCCCAGCACCTGTGTGGCTCTCACCTGGTGGACGCCCTCTATCTGGTGTGTGGAGAGAAAGGATTCTT TTACACCCCAAAGAGAGATGTGGATCCCCTTATAGGGTTCCTCTCTCCAAAATCAGCAAAGGAGAACGAA GAGTACCCCTTCAAAGACCAGACGGAGATGATGGTAAAGAGAGGTATTGTAGAGCAGTGCTGTCACAAGC CCTGCAACATCTTCGACCTGCAAAACTACTGCAACTGA

7 - Side 7 af 10 - Opgave 4: Sammenligning af insulin fra forskellige organismer Denne opgave tæller 40% af sættet. Som du måske husker fra øvelsen "Translation og proteindatabaser", bliver proteinhormonet insulin syntetiseret som et forstadium (precursor), hvorefter et signalpeptid og et propeptid spaltes fra før det når sin færdige (mature) form, som består af en A-kæde og en B-kæde. (Et tip som du får brug for senere: signalpeptider og propeptider findes i UniProt annoteret i feature-tabellen med betegnelsen (FtKey) henholdsvis "signal" og "propep"). Din opgave er nu at sammenligne insulin fra nogle forskellige organismer og finde ud af om signalpeptidet og propeptidet er mere eller mindre konserverede end A- og B-kæderne. 4A: SRS-søgning Først skal du ved hjælp af SRS fremstille et brugbart datasæt af aminosyresekvenser fra insulin. Vigtigt: Brug kun Swiss-Prot delen af UniProt. 1) Hvor mange entries i Swiss-Prot indeholder ordet "insulin" i beskrivelsen (altså ikke medregnet sammensætninger som "Insulin-activated" eller "Insulin-like")? Som du kan se, giver denne søgning en del resultater som ikke er insulin, men bare har noget at gøre med insulin. Nu skal du prøve at indsnævre denne søgning på forskellige måder. 2) Blad ned i resultatlisten til du kommer til hits med navnene "Insulin" og "Insulin precursor". Kig nærmere på nogle af dem. Hvad er helt præcist forskellen mellem dem der hedder "Insulin" og dem der hedder "Insulin precursor"? Det gælder nu om at begrænse søgningen til insulin-forstadier. Det ville naturligvis være nemmest hvis man kunne søge efter selve sammensætningen "Insulin precursor", men det virker ikke i SRS, idet SRS kun indekserer enkeltord, ikke hele sætninger/linier. Besvar i stedet følgende: 3) Hvor mange entries indeholder begge ordene "insulin" og "precursor" i beskrivelsen? Som du kan se, er der stadig andre proteiner end insulin med i sættet. Foreslå et eller flere ord, som kan tilføjes til søgningen for at begrænse sættet til insulin-forstadier.

8 - Side 8 af 10-4) 5) 6) 7) Hvilke(t) ord valgte du, og hvor mange er der nu tilbage? Undgå så de entries der ikke indeholder fuld længde sekvens (fragmenter). Hvor mange er der nu tilbage, og hvordan gennemførte du denne søgning? (NB: opgaven skal løses i SRS, det er ikke nok at tælle manuelt hvor mange der er!) Som sagt skal du analysere signalpeptider og propeptider. Det er derfor nødvendigt at begrænse sættet til de entries der både har et signalpeptid og et propeptid annoteret. Hvor mange entries med begge disse features findes der i hele Swiss-Prot (altså ikke kun blandt insulin-forstadier)? Kombiner dine to sidste søgninger for at besvare spørgsmålet: Hvor mange insulin-forstadier med annoteret signalpeptid og propeptid er der? (NB: hvis du ikke kunne løse spørgsmål 5, så kombiner resultaterne fra 4 og 6 i stedet). Resultatet af spørgsmål 7 er det ene af de to datasæt du skal bruge i anden halvdel af opgaven. Gem dette datasæt i FASTA format på den computer du arbejder på (Tip: i SRS skal du trykke "Save" og derefter sætte "Use view" til "FastaSeqs"). For at få et mere overskueligt datasæt at arbejde videre med, skal du også lave en udgave der er begrænset til primater (se følgende punkter): 8) 9) 10) Hvor mange entries fra primater findes der i hele Swiss-Prot? (Tip: hvis du ikke ved hvad primater hedder på latin, så kig nærmere på det humane entry fra dit tidligere datasæt og check feltet "Taxonomy"). Kombiner dine to sidste søgninger for at lave det lille datasæt af insulinforstadier med annoteret signalpeptid og propeptid fra primater. Hvor mange sekvenser indeholder det? Skriv alle entry-navnene (ID'erne) i dit svar! Kig nærmere på featuretabellerne i primat-datasættet. Angiv a. sidste position i signalpeptidet, b. første position i propeptidet, og c. sidste position i propeptidet. Hvis positionen varierer mellem de forskellige entries, så angiv et interval! Gem også primat-datasættet fra spørgsmål 9 i FASTA format.

9 - Side 9 af 10-4B: Multiple alignment (Hjælp til dem der ikke klarede 4A: Hvis du ikke har fået to datasæt i FASTA format ud af spørgsmål 7 og 9, kan du alligevel godt besvare 4B. Vi har lagt to erstatningsdatasæt på kursus-hjemmesiden, som du kan downloade: Erstatningen for datasættet fra spørgsmål 9 hedder insulin-primaterudennavn.fasta, og vi har ændret navnene på sekvenserne, så du kan ikke bruge det til at besvare spørgsmål 9. Erstatningen for datasættet fra spørgsmål 7 hedder insulin-25-udennavn.fasta, og her har vi både ændret navne og fjernet et antal sekvenser, så du kan ikke bruge det til at besvare spørgsmål 7. Du får også brug for at se på annoteringen af Swiss-Prot entry INS_HUMAN for at besvare 4B, hvis du ikke har besvaret spørgsmål 10). Brug ClustalW til at lave et multiple alignment af det lille primat-datasæt fra spørgsmål 9. Det er OK at lade alle parametre være default værdier. Du vil observere at insulin fra forskellige primater er temmelig ens. Besvar nu følgende spørgsmål: 11) 12) Hvor mange positioner i dette alignment er ikke 100% konserverede? Der er et enkelt gap i en af sekvenserne. Forekommer dette i signalpeptidet, A- kæden, propeptidet eller B-kæden? Lav et tilsvarende alignment af det større insulin-datasæt fra spørgsmål 7. Du skulle nu meget gerne se en større variation i sekvenserne. For at få et overblik over graden af konservering på hver position skal du bruge alignment-editoren Jalview: tryk på knappen "Start Jalview" på resultatsiden. Bemærk at det samlede alignment på grund af gaps er længere end de enkelte sekvenser der indgår i det. Prøv nu at finde hvor grænserne går mellem signalpeptidet, A-kæden, propeptidet og B-kæden i dette alignment. Tip: positionen i alignmentet fremgår af aksen øverst i vinduet, mens positionen i den enkelte sekvens vises nederst, når du peger på en aminosyre med musen. 13) Find en af primatsekvenserne, hvor du jo kender positionerne fra spørgsmål 10, og brug den til at finde, i forhold til det samlede alignment : a. sidste position i signalpeptidet, b. første position i propeptidet, og c. sidste position i propeptidet. (op til to positioners unøjagtighed bliver regnet som korrekt svar) Nederst i Jalview-vinduet ser du blokdiagrammer over tre mål for konservering: "Conservation", "Quality" og "Consensus" (% identitet). (Tip: Hvis du ikke kan se dem, skal du gå til menuen "View" og sætte markering ved "Show Annotations").

10 - Side 10 af 10 - Tænk ikke på forskellen mellem disse tre mål, du skal bare kvalitativt bedømme graden af konservering i de forskellige regioner. 14) Sammenlign nu signalpeptidet, A-kæden, propeptidet og B-kæden. a. Er signalpeptidet mere eller mindre konserveret end A- og B-kæderne, eller er der ingen forskel? b. Er propeptidet mere eller mindre konserveret end A- og B-kæderne, eller er der ingen forskel?

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 af 1 Danmarks Tekniske Universitet Side 1 af 11 sider Skriftlig prøve, den 27/5-2010 Kursus navn: Kursus nr. 27611 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 16 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side 1 af 14 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Sådan opretter du en elektronisk aflevering

Sådan opretter du en elektronisk aflevering Sådan arbejder du med opgaver i Gradebook/karakterbog Denne vejledning indeholder en detaljeret beskrivelse af hvordan du bruger gradebook/karakterbogen når du vil arbejde med opgaver og give karakterer

Læs mere

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik Danmarks Tekniske Universitet Løsningsforslag til Øvelse i Immonologisk Bioinformatik Indledning De følgende sider giver en gennemgang af de øverlser i har lavet under jeres besøg på DTU, som en del af

Læs mere

Digital Eksamen Når du er logget ind i Digital Eksamen, bliver du mødt med en oversigt som vist nedenfor:

Digital Eksamen Når du er logget ind i Digital Eksamen, bliver du mødt med en oversigt som vist nedenfor: Bedømmerguide til Digital Eksamen Indhold Bedømmerguide til Digital Eksamen... 1 Oversigten... 1 Prøven... 2 Download og upload af besvarelserne... 4 Annoteringsværktøjet... 6 Noter og feedback... 8 Oversigten

Læs mere

I denne manual kan du finde en hurtig introduktion til hvordan du:

I denne manual kan du finde en hurtig introduktion til hvordan du: VORES NORDSJÆLLAND HURTIGT I GANG MANUAL 01: Bruger HVAD INDEHOLDER DENNE MANUAL? I denne manual kan du finde en hurtig introduktion til hvordan du: 1. Finder Vores Nordsjælland hjemmesiden 2. Opretter

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 13 Danmarks Tekniske Universitet Skriftlig prøve, den 22/2-2013 Kursus navn: Introduktion til SystemBiologi Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle opgaver. Kursusansvarlig

Læs mere

Bioinformatik Open Source Software i biologiens tjeneste

Bioinformatik Open Source Software i biologiens tjeneste Bioinformatik Open Source Software i biologiens tjeneste Kenneth Geisshirt kneth@silex.dk Silex Science ApS Bioinformatik p.1/19 Om Silex Science ApS Grundlagt maj 2002 Ejeren er Cortex Holding Fokusområderne

Læs mere

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Per Tøfting 23. september 2008 Speciale i softwarekonstruktion IT-Vest Aarhus Universitet Agenda Formål microrna Strategien

Læs mere

ViKoSys. Virksomheds Kontakt System

ViKoSys. Virksomheds Kontakt System ViKoSys Virksomheds Kontakt System 1 Hvad er det? Virksomheds Kontakt System er udviklet som et hjælpeværkstøj til iværksættere og andre virksomheder som gerne vil have et værktøj hvor de kan finde og

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 af 8 Danmarks Tekniske Universitet Side 1 af 8 sider Skriftlig prøve, den 29/5-2009 Kursus navn: Kursus nr. 27611 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved

Læs mere

Hvilke felter i GeoEnviron, der benyttes i tilsynsrapporter, er angivet i disse to pdf-filer:

Hvilke felter i GeoEnviron, der benyttes i tilsynsrapporter, er angivet i disse to pdf-filer: TILSYNSRAPPORT FOR LANDBRUG ELLER VIRKSOMHED Med kan I lave omfattende tilsynsrapporter. Begge rapporter skrives i Word med alle data fra GeoEnviron. Data overføres til Word via bogmærker i en prædefineret

Læs mere

Vejledning til online blanketten Prisindekset i producent og importleddet

Vejledning til online blanketten Prisindekset i producent og importleddet Vejledning til online blanketten Prisindekset i producent og importleddet Din vej gennem blanketten Her er en kort vejledning om hvordan du udfylder online blanketten trin for trin. Har du spørgsmål, er

Læs mere

Genetiske afstande og afstandsmatricer

Genetiske afstande og afstandsmatricer Genetiske afstande og afstandsmatricer Denne vejledning indeholder en række små øvelser og opgaver der illustrerer, hvordan man ud fra genetiske sekvenser kan udregne en gennemsnitlig evolutionær afstand

Læs mere

Tilpas: Hurtig adgang

Tilpas: Hurtig adgang Tilpas: Hurtig adgang Genveje, Se skærmtips Se tips Hold alt tasten nede. Og brug bogstaver Word Fanen Filer PDF dokument Brug skabelon Visninger Husk Luk ved fuldskærmsvisning Brug zoom skyder Marker,

Læs mere

Større skriftlige opgaver i Microsoft Word 2007 Indhold

Større skriftlige opgaver i Microsoft Word 2007 Indhold Større skriftlige opgaver i Microsoft Word 2007 Indhold Større skriftlige opgaver i Microsoft Word 2007... 1 Inddeling i afsnit... 2 Sideskift... 2 Sidetal og Sektionsskift... 3 Indholdsfortegnelse...

Læs mere

HOFTEALLOPLASTIK - DATAUDTRÆK OG IMPORT TIL EXCEL

HOFTEALLOPLASTIK - DATAUDTRÆK OG IMPORT TIL EXCEL HOFTEALLOPLASTIK - DATAUDTRÆK OG IMPORT TIL EXCEL Når man er logget på KMS systemet, vælges Dataudtræk under punktet Vælg modul, hvorefter der klikkes på Gå til: På næste side klikkes på knappen Opret:

Læs mere

Qbrick s krav til video filtyper

Qbrick s krav til video filtyper Indhold Qbrick s krav til video filtyper... 1 Krav til ordningen/området... 1 Qbrick s krav til video leverandør... 1 Video og billede størrelser i WCM:... 1 Upload en video... 2 Trin 1: Mediefiler...

Læs mere

Databasesøgning med BLAST

Databasesøgning med BLAST Databasesøgning med BLAST Denne vejledning giver en introduktion til databasesøgning med forskellige programmer i BLAST-familien. Vejledningen indeholder først en grundig introduktion og gennemgang af

Læs mere

Navigationsrude Tryk på Ctrl+F for at få vist navigationsruden. Du kan omorganisere et dokument ved at trække dokumentets overskrift i denne rude.

Navigationsrude Tryk på Ctrl+F for at få vist navigationsruden. Du kan omorganisere et dokument ved at trække dokumentets overskrift i denne rude. Startvejledning Microsoft Word 2013 ser anderledes ud end tidligere versioner, så vi har oprettet denne vejledning, så du hurtigere kan lære programmet at kende. Værktøjslinjen Hurtig adgang Kommandoer

Læs mere

Kom godt i gang med OneDrive

Kom godt i gang med OneDrive Kom godt i gang med OneDrive Office365 er en mulighed for lærere og elever at bruge en office-pakke på egne enheder - man kan downloade det til brug på pc - mac - tablets og smartphones, i alt op til 5

Læs mere

VITAS Registrering af aftale om Integrationsgrunduddannelse

VITAS Registrering af aftale om Integrationsgrunduddannelse IGU i VITAS I VITAS er det muligt at registrere en aftale om, såfremt din virksomhed ønsker at indgå en aftale med en borger (udlænding). Du registrerer i VITAS din aftale inkl. undervisningsplanen ved

Læs mere

Hvordan opretter jeg MultiUser med en access-database?

Hvordan opretter jeg MultiUser med en access-database? Hvordan opretter jeg MultiUser med en access-database? Hvis du vil starte MultiUser med en access-database, skal du som det første downloade en access-database og placere den på et fælles drev. Du kan

Læs mere

Skifte til Outlook 2010

Skifte til Outlook 2010 I denne vejledning Microsoft Microsoft Outlook 2010 ser meget anderledes ud end Outlook 2003, og vi har derfor oprettet denne vejledning, så du hurtigere kan komme i gang med at bruge programmet. Læs videre

Læs mere

Indholdsfortegnelse. Indholdsfortegnelse.. side 2. Adgang til webgraf 3. Opslag adresse... 4. Styring af layout.. 5. Zoom funktioner..

Indholdsfortegnelse. Indholdsfortegnelse.. side 2. Adgang til webgraf 3. Opslag adresse... 4. Styring af layout.. 5. Zoom funktioner.. Indholdsfortegnelse Indholdsfortegnelse.. side 2 Adgang til webgraf 3 Opslag adresse... 4 Styring af layout.. 5 Zoom funktioner.. 6 Panorere på skærmen. 7 Information om grafikken.... 8-10 Print et udsnit.....

Læs mere

Medarbejderguide til INNOMATE HR Medarbejderplan. Indhold: Log på MUS. Forberedelse til MUS

Medarbejderguide til INNOMATE HR Medarbejderplan. Indhold: Log på MUS. Forberedelse til MUS Medarbejderguide til INNOMATE HR Medarbejderplan Indhold: 1. Log på 2. MUS 3. Øvrigt om Medarbejderplan 4. Rekruttering behandling af ansøgere Log på Log på www.medarbejderplan.dk med: Bruger ID: initialer

Læs mere

Vejledning til online blanketten Industriens salg af varer

Vejledning til online blanketten Industriens salg af varer Vejledning til online blanketten Industriens salg af varer Din vej gennem blanketten Her er en kort vejledning om hvordan du udfylder online blanketten trin for trin. Har du spørgsmål, er du velkommen

Læs mere

Kort om CoinDB (Mønt- og seddelsamling):

Kort om CoinDB (Mønt- og seddelsamling): Kom godt i gang med CoinDB programmet fra PetriSoft (Holder styr på din Mønt- seddel- eller frimærkesamling) Kort om CoinDB (Mønt- og seddelsamling): CoinDB er et Windows program, der anvendes af mønt-

Læs mere

VITAS Digital ansøgning

VITAS Digital ansøgning Hvis du har fundet en virksomhed, som gerne vil ansætte dig i enten løntilskud, i en praktikplads eller som voksenlærling, kan du komme hurtigt i gang og sætte fart på sagsbehandlingen, ved at bede virksomheden

Læs mere

TK/TBL / 25.08.2014 v.0.1. DigiMatch. Elektronisk Kamprapport

TK/TBL / 25.08.2014 v.0.1. DigiMatch. Elektronisk Kamprapport TK/TBL / 25.08.2014 v.0.1 DigiMatch Elektronisk Kamprapport 1 Procedure før kampstart... 3 DigiMatch download... 3 Registerniveau... 7 Indstillinger... 9 Login... 9 Tilpas knapperne... 10 Kampregistrering...

Læs mere

Manual til Vandværksløsninger

Manual til Vandværksløsninger Formularer Flytte- og måleraflæsning 1 Manual til Vandværksløsninger 8. Formularer Flytte- og måleraflæsning Formularer Flytte- og måleraflæsning 2 Sådan arbejder du med formularen Formularer er et modul,

Læs mere

Brug af IT-udstyr ved skriftlig eksamen

Brug af IT-udstyr ved skriftlig eksamen Brug af IT-udstyr ved skriftlig eksamen Ved brug af skolens IT-udstyr til skriftlig eksamen skal du: Medbringe dit UNI-login Oprette sidehoved/-fod til dine dokumenter (skolen har en færdig skabelon, som

Læs mere

Vejledning til online blanketten Beskæftigede inden for bygge og anlæg

Vejledning til online blanketten Beskæftigede inden for bygge og anlæg Vejledning til online blanketten Beskæftigede inden for bygge og anlæg Din vej gennem blanketten Her er en kort vejledning om hvordan du udfylder online blanketten trin for trin. Har du spørgsmål, er du

Læs mere

Manual til eksaminator / intern medbedømmer

Manual til eksaminator / intern medbedømmer Manual til eksaminator / intern medbedømmer Indhold o Log på Digital Eksamen Side 2 o Oversigten Mine Prøver Side 3 o Funktioner i Digital Eksamen Side 4 10 o Åbn besvarelse i browser Side 11 o Gennemgang

Læs mere

Kom godt igang med Inventar registrering

Kom godt igang med Inventar registrering Kom godt igang med Inventar registrering (InventoryDB) (Med stregkodesupport) programmet fra PetriSoft Introduktion... 1 Inventar registrering... 2 Værktøjsudleje... 3 Service database til reperationer

Læs mere

Immunologisk bioinformatik

Immunologisk bioinformatik Immunologisk bioinformatik Øvelsesvejledning Introduktion til øvelsen Når man i dagligdagen taler om influenza, bliver virussen ofte forbundet med forbigående og ufarlig sygdom. Som regel har mennesker

Læs mere

Svar på de mest almindelige Citrix spørgsmål

Svar på de mest almindelige Citrix spørgsmål Svar på de mest almindelige Citrix spørgsmål Henrik Meyer og Ajâja Hyttel Oprettet: 24/6-13 Sidst revideret 14/5-14 h t t p s : / / c i t r i x. a a b n e t. d k Hvad er nyt i Citrix?... 2 Hvis du ikke

Læs mere

Kom godt igang med Indbo programmet fra PetriSoft Kort om Indbo: Indbo Free

Kom godt igang med Indbo programmet fra PetriSoft Kort om Indbo: Indbo Free Kom godt igang med Indbo programmet fra PetriSoft Kort om Indbo: Indbo er et Windows 98/NT/2000/Me/Xp/Vista/Win7/Win8 program, der kan holde rede på hjemmets, firmaets, foreningens eller skolens inventar

Læs mere

SÅDAN BRUGER DU REGNEARK INTRODUKTION

SÅDAN BRUGER DU REGNEARK INTRODUKTION SÅDAN BRUGER DU REGNEARK INTRODUKTION I vejledningen bruger vi det gratis program Calc fra OpenOffice som eksempel til at vise, hvordan man bruger nogle helt grundlæggende funktioner i regneark. De øvrige

Læs mere

1.TILBUD NYT TILBUD 1.1 TRIN FORUDSÆTNINGER

1.TILBUD NYT TILBUD 1.1 TRIN FORUDSÆTNINGER 1.TILBUD Fanen Tilbud giver en oversigt over alle de tilbud, der ligger i din database. Det er også herfra, at du har mulighed for at oprette, kopiere eller redigere et eksisterende tilbud. Det følgende

Læs mere

DMX styring med USB-interface

DMX styring med USB-interface DMX styring med USB-interface Introduktion...2 DMX bibliotek...3 Programmering af kanaler...7 Sådan skabes et show/en lyssekvens...11 Introduktion DMX LightPlayer er en avanceret men meget brugervenlig

Læs mere

Brugervejledning ViseOrd til Mac Version 1.0, August 2015

Brugervejledning ViseOrd til Mac Version 1.0, August 2015 Side 1 Version 1.0, August 2015 Indholdsfortegnelse Copyright bestemmelser... 2 Hvad er ViseOrd... 3 Opstart og ViseOrd menuen... 4 Skrivestøtte... 6 Ordforslagslisten... 6 Ordforudsigelse... 7 Ordfuldendelse...

Læs mere

Oprettelse af Titelblok i Capture og Capture CIS

Oprettelse af Titelblok i Capture og Capture CIS e-service Titelblok i OrCAD Capture og Capture CIS Side 1 af 11 Oprettelse af Titelblok i Capture og Capture CIS Note skrevet af : Nordcad Systems Technical Support Revision : April 2003, Release 14.2/9.2.3,

Læs mere

Vejledning KPK Online Prøverum

Vejledning KPK Online Prøverum Vejledning KPK Online Prøverum INDHOLD Introduktion side 2 Funktionsliste side 2 Få adgang til systemet side 3 Opload dine billeder side 4 Sådan bruges systemet side 5 Gem dine eksempler side 7 Side 1/7

Læs mere

Brugermanual til Assignment hand in

Brugermanual til Assignment hand in Brugermanual til Assignment hand in Indhold: Undervisere:...2 Hvor finder jeg Assignment hand in?...2 Opret en opgave...4 Slet en opgave...5 Rediger en opgave...5 Hvor finder jeg de afleverede filer?...5

Læs mere

BørneIntra hjemmesidekursus

BørneIntra hjemmesidekursus BørneIntra hjemmesidekursus hjemmesidekursus Januar 2012 Indhold 1 Introduktion... 5 1.1 Kursets formål... 5 1.2 Hjemmesiden opbygges i PersonaleIntra... 5 2 Hjemmesidens indhold... 6 2.1 Hjemmesidens

Læs mere

Hvilke felter i GeoEnviron, der benyttes i tilsynsrapporter, er angivet i disse to pdf-filer:

Hvilke felter i GeoEnviron, der benyttes i tilsynsrapporter, er angivet i disse to pdf-filer: TILSYNSRAPPORT FOR LANDBRUG ELLER VIRKSOMHED Med kan I lave omfattende tilsynsrapporter. Begge rapporter skrives i Word med alle data fra GeoEnviron. Data overføres til Word via bogmærker i en prædefineret

Læs mere

Microsoft Word 2003 - fremgangsmåde til Blomsterhuset Side 1 af 11

Microsoft Word 2003 - fremgangsmåde til Blomsterhuset Side 1 af 11 Microsoft Word 2003 - fremgangsmåde til Blomsterhuset Side 1 af 11 Åbn Word 2003 Skriv: Blomsterhuset A/S - tryk enter en gang Skriv: Blomster for alle - tryk enter 5 gange Skriv: I anledning af at - tryk

Læs mere

Introduktion til de praktiske øvelser

Introduktion til de praktiske øvelser Introduktion til de praktiske øvelser Vi vil i dag fokusere på tre forskellige online software til SNP analyser snptree NDtree CSIphylogony Introduktion til SNP analyser http://cge.cbs.dtu.dk/services/all.php

Læs mere

Vejledning til brug af MobilGIS til NST- 3- registreringsprojekt

Vejledning til brug af MobilGIS til NST- 3- registreringsprojekt Digital forvaltning og GIS J.nr. Ref. Rune Heidemann Bjarne Aabrandt Jensen bjaje@nst.dk/72543737 Den 1. juli 2011 Vejledning til brug af MobilGIS til NST- 3- registreringsprojekt Det er meget vigtigt

Læs mere

Mamut Enterprise Abonnementsfakturering

Mamut Enterprise Abonnementsfakturering Mamut Enterprise Abonnementsfakturering Mamut Enterprise Abonnementsfakturering er et værktøj til fakturering af kunder, som har faste aftaler eller abonnementer. Løsningen er inkluderet i Mamut Enterprise

Læs mere

Modul 8: Clouds (Lagring af filer)

Modul 8: Clouds (Lagring af filer) Det sprogpædagogiske kørekort 2012/2013 Modul 8: Clouds (Lagring af filer) Del II Sabine Kramer Indholdsfortegnelse side Opret en Google konto (punkt 1-4).. 3 Upload filer fra computeren til Google docs

Læs mere

Quick Guide til Visit Gæstesystem i Backend.

Quick Guide til Visit Gæstesystem i Backend. 12.12.2016 Quick Guide til Visit Gæstesystem i Backend. Version: 2.5.2 Indholdsfortegnelse. Side 1: Side 2: Side 3-4: Side 5: Side 6-15: Side 16-17: Side 18-19: Side 20: Indholdsfortegnelse. Opsætning

Læs mere

WELLPLOT VER. 3 BRUGERMANUAL

WELLPLOT VER. 3 BRUGERMANUAL WELLPLOT VER. 3 BRUGERMANUAL I GIS 2002 Wellplot ver. 3 BRUGERMANUAL Udarbejdet for: I GIS ApS Titel: Wellplot ver. 3 Brugermanual Dokumenttype: Software manual Udgave: 1 Dato: 20-09-02 Udarbejdet af:

Læs mere

gembart. I et skriv og PDF dokumenter Hvordan 1. Åbn 2. Åbn åbnes. filen 1 af 6

gembart. I et skriv og PDF dokumenter Hvordan 1. Åbn 2. Åbn åbnes. filen 1 af 6 PDF dokumenter Her kan du læse om: Hvordan man gør et PDF dokument skrivbart og efterfølgende gembart. Hvilken version af Adobe Readeren, derr er nødvendig for at mann kan skrive i og efterfølgende gemme

Læs mere

Vejledning PROPHIX 11. Driftsbudgettering ved åbning af templates (Kun til Avanceret-brugere)

Vejledning PROPHIX 11. Driftsbudgettering ved åbning af templates (Kun til Avanceret-brugere) PROPHIX 11 Systemansvarlige Michael Siglev Økonomiafdelingen 9940 3959 msi@adm.aau.dk Daniel Nygaard Ricken Økonomiafdelingen 9940 9785 dnr@adm.aau.dk Vejledning (Kun til Avanceret-brugere) Opdateret:

Læs mere

Opret CFU-kursusevaluering i Survey Xact

Opret CFU-kursusevaluering i Survey Xact Printvenlig side for Forsidetekst Opret CFU-kursusevaluering i Survey Xact www.survey-xact.dk Oprettelsen af en kursusevaluering består af flg. trin: 1. Oprettelse af spørgeskema ud fra en skabelon 2.

Læs mere

Indholdsfortegnelse. PBX Switchboard. Manual. Introduktion... 2. Grafisk omstillingsbord... 2. Let at tilpasse layout... 2. Om manualen...

Indholdsfortegnelse. PBX Switchboard. Manual. Introduktion... 2. Grafisk omstillingsbord... 2. Let at tilpasse layout... 2. Om manualen... Indholdsfortegnelse Introduktion... 2 Grafisk omstillingsbord... 2 Let at tilpasse layout... 2 Om manualen... 2 For at komme i gang... 2 Download... 2 Bruger login og password... 2 Omstillingsbord... 3

Læs mere

Protein syntese. return

Protein syntese. return Protein syntese. I artiklen redegøres for principperne i, hvordan octapeptidet SCHTFGDI kan syntetiseres. Som yderligere illustration heraf kan peptidet opbygges og visualiseres i Chem3D-Pro. Herved kan

Læs mere

Billeder på hjemmeside

Billeder på hjemmeside Billeder på hjemmeside Indholdsfortegnelse Emne 1. Billedredigering (Microsoft Picture Manager) Side 3 a. Komprimer billeder b. Beskæring af billeder 3 9 2. Billeder og tekst ved hjælp af en skabelon (Template

Læs mere

Statistik (deskriptiv)

Statistik (deskriptiv) Statistik (deskriptiv) Ikke-grupperede data For at behandle ikke-grupperede data i TI, skal data tastes ind i en liste. Dette kan gøres ved brug af List, hvis ikon er nr. 5 fra venstre på værktøjsbjælken

Læs mere

Introduktion til de praktiske øvelser

Introduktion til de praktiske øvelser Introduktion til de praktiske øvelser Vi vil i dag fokusere på tre forskellige online so4ware 6l SNP analyser snptree NDtree CSIphylogony Introduktion til SNP analyser h@p://cge.cbs.dtu.dk/services/all.php

Læs mere

Sådan opdaterer og vedligeholder du din hjemmeside i Wordpress.

Sådan opdaterer og vedligeholder du din hjemmeside i Wordpress. Wordpress manual Sådan opdaterer og vedligeholder du din hjemmeside i Wordpress. Dette er en manual til de mest grundlæggende ting og funktioner i Wordpress, så du selv kan redigere indholdet eller tilføje

Læs mere

Når du har logget dig ind, ser du Randers Kommunes byvåben midt på siden. I venstre side er der en række mapper:

Når du har logget dig ind, ser du Randers Kommunes byvåben midt på siden. I venstre side er der en række mapper: DXP vejledning Generelt: DXP er et værktøj til at fremstille præsentationsmaterialer (foldere, brochurer, løbesedler mv.) DXP egner sig kun til mindre brochurer og lign., da den største skabelon kan rumme

Læs mere

Manual til udvidet abonnement

Manual til udvidet abonnement Manual til udvidet abonnement April 2009 info@bookscan.dk (alle tal er fiktive) 1 LOG PÅ s. 3 FORSIDEN s. 4 TOP 500 s. 5 FORMATER s. 7 TIMELINE OG TRENDED TIMELINE s. 8 CHART WITH PROMPTS s. 14 SKEMASÆTNING

Læs mere

SDU Assignment - undervisere

SDU Assignment - undervisere SDU Assignment - undervisere SDU Assignment giver mulighed for såvel anonym, som ikke anonym opgaveaflevering. Der kan afleveres flere filer på en gang. De studerende får en kvittering for afleveringen

Læs mere

GENEREL VEJLEDNING KOM GODT I GANG FOR DIG SOM ER UDDANNELSES- ANSVARLIG

GENEREL VEJLEDNING KOM GODT I GANG FOR DIG SOM ER UDDANNELSES- ANSVARLIG GENEREL VEJLEDNING KOM GODT I GANG FOR DIG SOM ER UDDANNELSES- ANSVARLIG Generel vejledning for uddannelsesansvarlige Introduktion Denne vejledning giver dig en kort gennemgang af nogle af de muligheder

Læs mere

My booking. Generelt. Forsiden. Version 9.0

My booking. Generelt. Forsiden. Version 9.0 My booking Version 9.0 System til at lave online bookinger, med mulighed for opdeling i grupper, forskellige booking typer, ændre layout indstillinger, status styring, sprogvalg samt en del mere, detaljer

Læs mere

WEB-DIRECT Brugerguide Eksportfunktion i WEB-DIRECT

WEB-DIRECT Brugerguide Eksportfunktion i WEB-DIRECT WEB-DIRECT Brugerguide Eksportfunktion i WEB-DIRECT Indhold 1. Kom godt i gang med eksportfunktionen... 3 2. Eksport... 4 2.1 Eksport i WEB-DIRECT... 4 2.2 Brugerdefineret eksport i WEB-DIRECT... 6 2.2.1

Læs mere

Vælg det emneord, du vil bruge og klik på Continue. Nu vises de subheadings som knytter sig til emneordet:

Vælg det emneord, du vil bruge og klik på Continue. Nu vises de subheadings som knytter sig til emneordet: Embase Quick Guide Fritekstsøgning (Basic Search) Skriv dine søgeord i søgefeltet og klik på Search. Der er mulighed for at gøre søgningen bredere ved at vælge Include Related Terms". Avanceret søgnng

Læs mere

Brugervejledning Optagelse.dk. Afhentning af ansøgninger til de videregående uddannelser

Brugervejledning Optagelse.dk. Afhentning af ansøgninger til de videregående uddannelser Brugervejledning Optagelse.dk Afhentning af ansøgninger til de videregående uddannelser Brugervejledning i Optagelse.dk Afhentning af ansøgninger til de videregående uddannelser Forfatter: Sara Holm Kristensen

Læs mere

Bevægelses analyse med SkillSpector. Version 1.0 Sidste opdatering: 14/05-2008

Bevægelses analyse med SkillSpector. Version 1.0 Sidste opdatering: 14/05-2008 Bevægelses analyse med SkillSpector Version 1.0 Sidste opdatering: 14/05-2008 Hvad er SkillSpector SkillSpector er software program til video baseret bevægelses analyse. Der er følgende muligheder med

Læs mere

VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER

VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER VEJLEDNING TIL LUDUS, WORD og ONLINE ORDBØGER INDHOLDSFORTEGNELSE 1. Ludus - Log ind. side 3 2. Ludus - Skriv note til læreren, når du er syg side 4 3. Ludus

Læs mere

IDAP manual Emission

IDAP manual Emission IDAP manual Emission Dato: 08-06-2005 16:32:35 Indhold INDHOLD... 1 1 EMISSION... 2 1.1 KURVER... 2 1.2 RAPPORTER... 5 1.3 DATA REDIGERING... 6 1.3.1 Masse redigering... 7 1.3.2 Enkelt redigering... 10

Læs mere

SDBF EN VEJLEDNING TIL SKOLERNES DIGITALE BLANKET FLOW - VEJLEDNING EFTERUDDANNELSESKURSISTER

SDBF EN VEJLEDNING TIL SKOLERNES DIGITALE BLANKET FLOW - VEJLEDNING EFTERUDDANNELSESKURSISTER SDBF EN VEJLEDNING TIL SKOLERNES DIGITALE BLANKET FLOW - VEJLEDNING EFTERUDDANNELSESKURSISTER Ajourført okt. 2014 LOGIN SDBF er en webbaseret løsning, som du kan tilgå fra alle kendte browsere; Internet

Læs mere

vejman.dk Brugerdokumentation - kortmodul 14. marts 2012 Version 1.9

vejman.dk Brugerdokumentation - kortmodul 14. marts 2012 Version 1.9 Brugerdokumentation - kortmodul 14. marts 2012 Version 1.9 Indholdsfortegnelse 1 Indledning... 3 1.1 Anbefalinger... 4 1.2 Datahjælp... 4 1.3 Brugerindstillinger... 5 2 Generel funktionalitet... 6 2.1

Læs mere

Dannelse af PDF-dokumenter

Dannelse af PDF-dokumenter Dannelse af PDF-dokumenter Indhold Generere PDF-dokumenter... 2 Håndtering af PDF-dokumentet... 6 Hvordan indsætter man sidetal i PDF-dokumentet?... 6 Hvordan laver man bookmarks i PDF-dokumentet?... 7

Læs mere

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Isa Kirk Biotech Academy Institut for Systembiologi, Danmarks Tekniske Universitet 2. november 2010 1 Indhold 1 Introduktion

Læs mere

Brugervejledning til Doc2Mail

Brugervejledning til Doc2Mail ** Brugervejledning til Doc2Mail Version 3.5 KMD Doc2Mail Indholdsfortegnelse Forord... 1-3 1 Introduktion... 1-4 2 Sådan bruger du Doc2Mail... 2-5 2.1 Doc2Mail-dialogvinduet... 2-6 2.2 Udskrivning med

Læs mere

Sammenknytning af listedata fra MUD til tabel i MapInfo (SVM-eksempel)

Sammenknytning af listedata fra MUD til tabel i MapInfo (SVM-eksempel) Sammenknytning af listedata fra MUD til tabel i MapInfo (SVM-eksempel) Indhold Introduktion...1 Eksport og tilpasning af tabeldata MUD...1 Direkte til Excel...1 Via Rapport i Word-format til Excel...1

Læs mere

JAR Øvelse nr. 7. JAR-Manual, Version 1.0. Matrikler i JAR. Regionsvejledning

JAR Øvelse nr. 7. JAR-Manual, Version 1.0. Matrikler i JAR. Regionsvejledning JAR Øvelse nr. 7 Matrikler i JAR Regionsvejledning JAR-Manual, Version 1.0 Øvelse ID: 7 Øvelsesemne: Stamdata for matrikler Øvelsesbeskrivelse: Giver dig et overblik over oplysninger omkring matrikel i

Læs mere

Mini-vejledning til edoc4 med grundlæggende funktioner

Mini-vejledning til edoc4 med grundlæggende funktioner Mini-vejledning til edoc4 med grundlæggende funktioner Denne vejledning indeholder en kort præsentation af portalen i edoc version 4.1 og præsenterer de mest anvendte funktioner og arbejdsgange inkl. søgninger.

Læs mere

DigiMatch Elektronisk Kamprapport

DigiMatch Elektronisk Kamprapport TK/TBL / 17.08.2015 v.0.3 DigiMatch Elektronisk Kamprapport 1 Procedure før kampstart Link til vejledning, login data, og Digimatch kan findes her: http://boxerligaerne.dk/klubsider/kamprapport/ Det er

Læs mere

Brugervejledning til Kørebog for Pocket PC

Brugervejledning til Kørebog for Pocket PC Brugervejledning til Kørebog for Pocket PC Denne vejledning beskriver kort anvendelsen af Kørebog for Pocket PC version 3.0 Programmet giver mulighed for registrering af den daglige kørsel. Registreringen

Læs mere

Integralregning med TI-Interactive! Stamfunktioner Integraler Arealer Jan Leffers (2005)

Integralregning med TI-Interactive! Stamfunktioner Integraler Arealer Jan Leffers (2005) Integralregning med TI-Interactive! Stamfunktioner Integraler Arealer Jan Leffers (005) Indholdsfortegnelse Indholdsfortegnelse... Stamfunktion og integralregning...3 Numerisk integration...3 Areal under

Læs mere

Kom godt i gang med Fronter

Kom godt i gang med Fronter 1 Kom godt i gang med Fronter. Introduktion for studerende på diplomuddannelse, området Pædagogik Kom godt i gang med Fronter Introduktion for studerende på Pædagogisk diplomuddannelse Sådan logger du

Læs mere

Versionsbrev. LUDUS Web version 2.28.0. Den 8. august 2012. J.nr. 4004-V1046-12

Versionsbrev. LUDUS Web version 2.28.0. Den 8. august 2012. J.nr. 4004-V1046-12 Versionsbrev LUDUS Web version 2.28.0 Den 8. august 2012 J.nr. 4004-V1046-12 CSC Scandihealth A/S, P.O. Pedersens Vej 2, DK-8200 Århus N Tlf. +45 3614 4000, fax +45 3614 7324, www.csc.com/ludus, sc-ludus@csc.com

Læs mere

Huskesedler. Design og automatisering af regneark. Microsoft Excel 2013

Huskesedler. Design og automatisering af regneark. Microsoft Excel 2013 Huskesedler Design og automatisering af regneark Microsoft Excel 2013 Januar 2017 Knord Side 2 Indholdsfortegnelse Ark... 4 Beskyttelse... 6 Diagram... 7 Eksport af data... 8 Fejlretning i formler... 9

Læs mere

7DVWHYHMOHGQLQJ#²#,QWHUQHW#([SORUHU

7DVWHYHMOHGQLQJ#²#,QWHUQHW#([SORUHU 7DVWHYHMOHGQLQJ#²#,QWHUQHW#([SORUHU,QGKROGVIRUWHJQHOVH BROWSEREN - DE VIGTIGSTE FUNKTIONER OG BEGREBER.... 2 TILPAS BROWSEREN... 3 GÅ DIREKTE TIL EN KENDT ADRESSE... 5 LAV ET BOGMÆRKE... 6 ORGANISÉR DINE

Læs mere

Hjemmesiden er opdelt i et sidehoved, en sidefod og mellem disse 3 kolonner: venstre, midterste og højre. Højre kolonne vises dog kun på forsiden.

Hjemmesiden er opdelt i et sidehoved, en sidefod og mellem disse 3 kolonner: venstre, midterste og højre. Højre kolonne vises dog kun på forsiden. Hjemmesiden er opdelt i et sidehoved, en sidefod og mellem disse 3 kolonner: venstre, midterste og højre. Højre kolonne vises dog kun på forsiden. VENSTRE kolonne indeholder flere elementer (se illustration

Læs mere

Quickguide til PM5. De enkelte punkter er beskrevet løst kig i manualen hvis du har brug for en dybere forklaring.

Quickguide til PM5. De enkelte punkter er beskrevet løst kig i manualen hvis du har brug for en dybere forklaring. Her er en hurtig guide til hvordan du kommer godt i gang med PM5. Der er visse ting der skal gøres i den rigtige rækkefølge, for at du får det bedste ud af systemet fra starten af. De enkelte punkter er

Læs mere

OPRET OG IGANGSÆT JOB

OPRET OG IGANGSÆT JOB DATO DOKUMENT SAGSBEHANDLER MAIL TELEFON 12. maj 2016 Version 1.1 JobManager supporten Jobmanager@vd.dk 7244 7300 OPRET OG IGANGSÆT JOB ENTREPRENØR Guldalderen 12 2640 Hedehusene vd@vd.dk EAN 5798000893450

Læs mere

En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau)

En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau) Matematik i WordMat En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau) Indholdsfortegnelse 1. Introduktion... 3 2. Beregning... 4 3. Beregning med brøker...

Læs mere