SNP håndtering og datavalidering. Kevin Byskov

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "SNP håndtering og datavalidering. Kevin Byskov"

Transkript

1 SNP håndtering og datavalidering Kevin Byskov

2 Disposition Principperne bag genotypning Kontrolprocedurer: Kontrol af Sample ID Mendel Error Check Kontrol af omtypede dyr

3 Cytosin (C) Guanin (G) Homologe kromosomer 1 kromosom fra hhv. mor og far Thymin (T) Adenin (A)

4 GAAATC CTTTAG Streng 1 Streng 2 DNA dobbel-helix lynes op og basesekvensen aflæses på streng 1 Vi kender strengen vi læser på og vi ved hvor langt inde på strengen vi er

5 GAAATC Homologe kromosomer Streng 1 GAACTC Streng 1 Far Mor Nogle steder ses variation mellem homologe kromosomer på en given placering Nogle gange ses fx et A på streng 1 og andre gange et C Det er hvad vi kalder en SNP (Single Nucleotide Polymorphism) Vi arbejder kun med bi-allele SNP er Det viste dyr har genotypen AC Andre dyr vil kunne have AA, AC eller CC for den pågældende SNP

6 SNP resultaterne lægges på den nye SNP database BC SNPmax I BC SNPmax er der pt dyr med en Genotype foretaget i Danmark, Sverige og Finland I alt ca. 1,25 mia. obserservationer på enkelt SNP er Endvidere data fra samarbejde med EuroGenomics og GENO

7 Kontrolprocedurer for Genotype-data Mål for kontrolprocedurer Avlsmæssige beslutninger for typede dyr tages på et så korrekt grundlag som muligt Fejlkilderne Fejl i angivelse af ID DNA prøve er taget af forkert dyr Dyret har fejl i den indberettede afstamning Ombytning af DNA prøver Laboratoriefejl Fejl i håndtering af data

8 Kontrol af Sample ID Sample ID er det ID som dyret er genotypet under Eksempel på Sample ID for tyren D Limbo er: HOLDNKM (inden stb.) HOLDNKM (efter stb.)

9 Kontrol af Sample ID DNA materiale sendes til laboratorie Liste med Sample ID er tilsendes fra VG Sample ID er holdes op mod NAV og Interbull afstamningsfilerne NAV afstamningsfilen opdateres inden kontrol ID er som ikke genfindes i afstamningsfilerne returneres til manual kontrol/retning hos VG

10 Kontrol af Sample ID Fil med kontrollerede/rettede ID er modtages fra VG Nogle ID er findes fortsat ikke i NAV afstamningsfil Ikke muligt at gennemføre Mendel Error Check Dyret vil indgå i den genomiske evaluering med ukendt afstamning

11 Mendel Error Check For dyr med mindst én genotypet forælder foretages Mendel Error Check Kontrol både mod dyr testet i NAV-landene og tyre fra EuroGenomics Mendel Error Check foretages på ét kromosom Kromosom 20

12 Mendel Error Check 1 forælder genotypet Analyseværktøjet kan kun håndtere når begge forældre er typet For dyr med kun én genotypet forælder dannes en dummy-forælder for at opnå to typede forældre Dummy forælder genotype = afkoms genotype Kun fejl hvor genotypet forælder og afkom begge er homozygote findes

13 Mendel Error Check 1 forælder genotypet Far attgcgaaatccgtatgcattgcaatacg ccgtatgcattgcaatacgattgcgaaat Afkom ccgtatgacctcgattgcgatgcagatcg ctttaggccttggatcgcaattcaattcg Mor (dummy) ccgtatgacctcgattgcgatgcagatcg ctttaggccttggatcgcaattcaattcg Homologe kromosomer

14 Mendel Error Check 2 forældre genotypet I tilfælde hvor begge forældre er genotypet, testes for hver SNP, om afkom er en mulig kombination af mor og far

15 Mendel Error Check 2 parents genotyped Far attgcgaaatccgtatgcattgcaatacg ccgtatgcattgcaatacgattgcgaaat Afkom ccgtatgacctcgattgagatgcagatcg ctttaggccttggatcgcaattcaattcg Mor attgaggacctcgattgcgatgcagatcg ccggatgcattggatcgcatttcaataat

16 Mendel Error Resultater Sample ID Antal Mendel Errors Forældre typet HOLDNKM Begge forældre typet HOLDNKF Far typet JERDNKM Far typet JERDNKM Begge forældre typet HOLDNKM Far typet Nogle gange findes mange uoverensstemmelser Ingen tvivl om, at der er fejl i data Data udelades af avlsværdiberegninger

17 Mendel Error Resultater Sample ID Antal Mendel Errors (ME) Forældre typet HOLDNKM Far typet HOLDNKF Far typet JERDNKM Begge forældre typet JERDNKM Begge forældre typet HOLDNKM Far typet Nogle gange findes få uoverensstemmelser Kan skyldes typningsfejl Hvis kun én forælder er typet antages > 2 ME for fejl i data Hvis begge forældre er typet antages > 3 ME for fejl i data

18 Mendel Error Resultater Mendel Errors kan skyldes: Fejl i dyrets registrerede afstamning Forkert dyr, der er udtaget DNA fra Ombytning af prøver Fejl i laboratoriet Fejl i håndtering af data Mendel Error Testen fanger bl.a. ikke: Ombytninger af prøver udtaget på fx ET-helsøskende Halvsøskende efter samme tyr, hvis ikke mor er typet

19 Mendel Error Resultater Genotyper fra dyr med Mendel Errors tages ikke med i de genomiske avlsværdiberegninger Genotyperne gemmes i en separat tabel i databasen Mendel testen er ikke en officiel faderskabstest Alle 17 tyre erklæret fejl med Mendel Error Test, som efterfølgende er faderskabstestet, har fået afvist faderskab

20 Kontrol af omtypede dyr Udvalgte tyre omtypes på nyt DNA Ekstra sikkerhed for korrekt genotype Den nye genotype sammenlignes med den første genotype på dyret for alle SNP er Ikke kun på kromosom 20 Tydelig opdeling mellem tyre med hhv. samme DNA og forskelligt DNA ved de to typninger

21 Kontrol af omtypede dyr I august-data var der 21 omtypede tyre Alle OK mellem 3 og 12 uoverensstemmelser pr tyr Hvis begge alleler for en SNP er forkerte tælles det som 2 uoverensstemmelser Ved uoverensstemmelse mellem genotyper ses tusindvis af uoverensstemmelser Fanger fejl som ikke opdages ved Mendel Error Test Ny uafhængig test

22 Spørgsmål?

23 Anerkendelse Den Europæiske Union ved Den Europæiske Fond for Udvikling af Landdistrikter og Ministeriet for Fødevarer, Landbrug og Fiskeri har deltaget i finansieringen af projektet.

Beregningsprocedure og offentliggørelse af avlsværdital

Beregningsprocedure og offentliggørelse af avlsværdital Beregningsprocedure og offentliggørelse af avlsværdital Gert Pedersen Aamand og Anders Fogh Genomisk avlsværdivurdering Husk En helt ny metode - startet i 2008 Meget hurtig udvikling Meget hurtig flytning

Læs mere

Nyt fra Interbull og NAV udviklingsaktiviteter

Nyt fra Interbull og NAV udviklingsaktiviteter Nyt fra Interbull og NAV udviklingsaktiviteter Gert Pedersen Aamand og Anders Fogh Interbull møder seneste år Februar 2012 Verona, Italien teknisk workshop fokus GMACE Årsmøde Juni 2012 Cork, Irland Interbull

Læs mere

Klik på ikonet for at tilføje et billede NAV blended indeks

Klik på ikonet for at tilføje et billede NAV blended indeks NAV blended indeks Gert Pedersen Aamand og Anders Fogh NAV Blended indeks 1. Hvilke dyr skal have blended indeks? 2. Bag om DGV og EBV 3. Metode 4. Eksempel - input data til beregning 5. Foreløbige resultater

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

Nyheder - NAV rutine evaluering 2. maj 2014

Nyheder - NAV rutine evaluering 2. maj 2014 Nyheder - NAV rutine evaluering 2. maj 2014 Den seneste NAV evaluering af ydelse, frugtbarhed, eksteriør, yversundhed, øvrige sygdomme, kælvningsevne, malketid, temperament, vækst, holdbarhed, klovsundhed

Læs mere

Nyheder - NAV rutine evaluering 2. november 2013

Nyheder - NAV rutine evaluering 2. november 2013 Nyheder - NAV rutine evaluering 2. november 13 Den seneste NAV evaluering af ydelse, frugtbarhed, eksteriør, yversundhed, øvrige sygdomme, kælvningsevne, malketid, temperament, vækst, holdbarhed, klovsundhed

Læs mere

Fælles nordisk avlsværdital for vækst

Fælles nordisk avlsværdital for vækst Fælles nordisk avlsværdital for vækst Projektgruppe K. Johansson, U.S. Nielsen, J. Pösö, J.-Å. Eriksson and G.P. Aamand Vækst i forbindelse med malkekvæg Specialiserede slagtekalvebesætninger malkekvægs

Læs mere

Velkommen til ABC Analyzer! Grundkursusmanual 2 vil introducere dig til ABC Analyzers mere avancerede funktioner, bl.a.:

Velkommen til ABC Analyzer! Grundkursusmanual 2 vil introducere dig til ABC Analyzers mere avancerede funktioner, bl.a.: Velkommen til ABC Analyzer! Grundkursusmanual 2 vil introducere dig til ABC Analyzers mere avancerede funktioner, bl.a.: Kategoriseringer uden ABC-kategorier Krydstabel (trebenede) Beregnede og avancerede

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

Status på data og avl

Status på data og avl Status på data og avl Avlsforum for RDM Brædstrup 9. december 2010 Anders Fogh Disposition Malketid Ny håndterminal Klovsundhed Data fra malkerobotter Afstamningsfejl Hvorfor er inddragelse af data fra

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

Bananfluer og nedarvning

Bananfluer og nedarvning Bananfluer og nedarvning Teori: Bananflue-genetik Bananfluens livscyklus Bananfluen, Drosophila melanogaster, har været brugt til at studere genetik i mere end 100 år. Denne diploide organisme har fuldstændig

Læs mere

På nedenstående billede skal du finde den figur som optræder nøjagtig 3 gange.

På nedenstående billede skal du finde den figur som optræder nøjagtig 3 gange. Navn: Klasse: Materiale ID: PIC.33.1.1.da Lærer: Dato: Klasse: Materiale ID: PIC.33.1.1.da Navn: Klasse: Materiale ID: PIC.33.2.1.da Lærer: Dato: Klasse: Materiale ID: PIC.33.2.1.da Navn: Klasse: Materiale

Læs mere

Information om nyt indeks for HD Schæferhundeklubben 2010. Kevin Byskov Dansk Kvæg Team for avlsværdivurdering

Information om nyt indeks for HD Schæferhundeklubben 2010. Kevin Byskov Dansk Kvæg Team for avlsværdivurdering Information om nyt indeks for HD Schæferhundeklubben 2010 Kevin Byskov Dansk Kvæg Team for avlsværdivurdering Disposition Grundlæggende forskelle på ny og gammel model Teoretisk del Aktuelle data Præsentation

Læs mere

Genomisk selektion ny teknologi, der virker i praksis

Genomisk selektion ny teknologi, der virker i praksis Genomisk selektion ny teknologi, der virker i praksis Mogens Sandø Lund Guosheng Su Bernt Guldbrandtsen Aarhus Universitet DJF Inst for Genetik og Bioteknologi Foulum Dansk Kvæg Kongres 23. Februar 2009

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Nyhedsbrev NAV rutine avlsværdivurdering 1. november 2016

Nyhedsbrev NAV rutine avlsværdivurdering 1. november 2016 Nyhedsbrev NAV rutine avlsværdivurdering 1. november 2016 Den seneste NAV evaluering af ydelse, frugtbarhed, eksteriør, yversundhed, øvrige sygdomme, kælvningsevne, malketid, temperament, vækst, holdbarhed,

Læs mere

Cellens livscyklus GAP2. Celledeling

Cellens livscyklus GAP2. Celledeling Cellens livscyklus Cellens livscyklus inddeles i to faser, interfase og mitose. GAP1 (G1). Tiden lige efter mitosen hvor der syntetiseres RNA og protein. Syntese fasen. Tidsrummet hvor DNAet duplikeres

Læs mere

Genhæmning: et overblik

Genhæmning: et overblik Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Genhæmning tager et målrettet skridt fremad Målrettet hæmning af det mutante Huntington's chorea-gen,

Læs mere

Modul 3: Sandsynlighedsregning

Modul 3: Sandsynlighedsregning Forskningsenheden for Statistik ST01: Elementær Statistik Bent Jørgensen Modul 3: Sandsynlighedsregning 3.1 Sandsynligheder................................... 1 3.2 Tilfældig udtrækning fra en mængde........................

Læs mere

Syddanmark 2007 2011. Monitorering og effektmåling Strukturfondsindsatsen i

Syddanmark 2007 2011. Monitorering og effektmåling Strukturfondsindsatsen i Monitorering og effektmåling Strukturfondsindsatsen i Syddanmark 2007 Design og kreative erhverv Energieffektivisering Offshore Sundheds- og velfærdsinnovation Turisme Brede indsatser DEN EUROPÆISKE UNION

Læs mere

Opret og godkend betalinger i mapper

Opret og godkend betalinger i mapper Kort beskrivelse Opret betaling i mappe Formålet med dette dokument er at beskrive, hvordan du opretter og godkender betalinger i mapper - inklusive: Opret mappe Gem én eller flere betalinger i mapper

Læs mere

Eksterne Sundhedsinstitutioners import af sundhedsenheder til SOR

Eksterne Sundhedsinstitutioners import af sundhedsenheder til SOR Eksterne Sundhedsinstitutioners import af sundhedsenheder til SOR Vedrører Sundhedsvæsenets organisationsregister, SOR version 1.2.1 November 2008. Indhold 1 Introduktion 1 2 Forudsætninger 1 2.1 SKS-SHAK

Læs mere

Indholdsfortegnelse resultat- & kritikprogrammet.

Indholdsfortegnelse resultat- & kritikprogrammet. Indholdsfortegnelse resultat- & kritikprogrammet. Ringsekretærers indtastning af resultater og kritikker... 2 Kom i gang Opstart af programmet... 2 En anden bruger er i gang med ringen... 3 Dommer ændringer

Læs mere

Avlsværdital for ungdyrdødelighed. Line Hjortø Buch

Avlsværdital for ungdyrdødelighed. Line Hjortø Buch Avlsværdital for ungdyrdødelighed Line Hjortø Buch Tidligere undersøgelser Dødelighed blandt Holstein kalve 9,4 % blandt kviekalve fra 1 dag efter fødslen til 1 dag før første kælvning 1 9,3 og 5,1 % (hhv.

Læs mere

Dette dokument beskriver den nye grænseflade med udgangspunkt i den nye MS Dynamics NAV 5.0 SP1 klient.

Dette dokument beskriver den nye grænseflade med udgangspunkt i den nye MS Dynamics NAV 5.0 SP1 klient. Side 1 af 18 Navision Stat 5.0 ØKO/CPS 24.08.2008 Den nye grænseflade Dette dokument beskriver den nye grænseflade med udgangspunkt i den nye MS Dynamics NAV 5.0 SP1 klient. Overblik Introduktion Følgende

Læs mere

MDR1 og DM Introduktion Hvad er MDR1

MDR1 og DM Introduktion Hvad er MDR1 MDR1 og DM Introduktion MDR1 og DM er to sygdomme som pt. er meget oppe at vende i hundeverden, da der er fundet flere hunde som har vist sig at være bærer af en af disse. Flere og flere opdrættere er

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

Naturstyrelsens Referencelaboratorium for Kemiske og Mikrobiologiske Miljømålinger NOTAT

Naturstyrelsens Referencelaboratorium for Kemiske og Mikrobiologiske Miljømålinger NOTAT Naturstyrelsens Referencelaboratorium for Kemiske og Mikrobiologiske Miljømålinger NOTAT Til: Følgegruppen for Naturstyrelsens Referencelaboratorium cc: Fra: Anders Svaneborg Dato: 6. oktober 2014 QA:

Læs mere

Udviklingsmuligheder for små og mellemstore virksomheder i Region Midtjylland

Udviklingsmuligheder for små og mellemstore virksomheder i Region Midtjylland 25. marts 2008 Udviklingsmuligheder for små og mellemstore virksomheder i Region Midtjylland Næsten en ud af ti er utilfreds med udviklingsmulighederne hvor de bor Nogle virksomheder mangler arbejdskraft,

Læs mere

Avlsværdital for klovsundhed

Avlsværdital for klovsundhed Avlsværdital for klovsundhed Jørn Pedersen Jan-Åke Eriksson Kjell Johansson Jukka Pösö Morten Kargo Sørensen Ulrik Sander Nielsen Gert Pedersen Aamand Anders Fogh Oversigt Generelt om klovsundhed registreringer

Læs mere

Velkommen til ABC Analyzer! Denne basis manual indeholder introduktion til: De primære funktioner De 6 faneblade Dataslicers Rapporter og klikrapport

Velkommen til ABC Analyzer! Denne basis manual indeholder introduktion til: De primære funktioner De 6 faneblade Dataslicers Rapporter og klikrapport Velkommen til ABC Analyzer! Denne basis manual indeholder introduktion til: De primære funktioner De 6 faneblade Dataslicers Rapporter og klikrapport Manual opdateret Oktober 2015 Copyright ABC Softwork

Læs mere

Denne artikel tager dig igennem de grundliggende teorier bag ABC Analyzer og introducerer dig til 80/20 Analytics.

Denne artikel tager dig igennem de grundliggende teorier bag ABC Analyzer og introducerer dig til 80/20 Analytics. Evnen til at prioritere tid og ressourcer bygger på, at noget er vigtigere end andet. Dvs. at dine produkter, kunder og leverandører ikke er lige vigtige: De bidrager ikke lige meget til bundlinjen i din

Læs mere

KAPITEL 8: OPRETTELSE OG ADMINISTRATION AF DOKUMENTGODKENDELSE

KAPITEL 8: OPRETTELSE OG ADMINISTRATION AF DOKUMENTGODKENDELSE Kapitel 8: Oprettelse og administration af dokumentgodkendelse KAPITEL 8: OPRETTELSE OG ADMINISTRATION AF DOKUMENTGODKENDELSE Målsætninger Introduktion Målsætningerne er at: Oprette dokumentgodkendelsessystemets

Læs mere

Vejledende besvarelse

Vejledende besvarelse Side 1 Vejledende besvarelse 1. Skitse af et andengradspolynomium Da a>0 og da parablen går gennem (3,-1) skal f(3)=-1. Begge dele er opfyldt, hvis f (x )=x 2 10, hvor en skitse ses her: Da grafen skærer

Læs mere

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side 1 af 14 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

"Teknikken" i testdagsmodellen Jørn Pedersen, Afdeling for Specialviden, Dansk Kvæg

Teknikken i testdagsmodellen Jørn Pedersen, Afdeling for Specialviden, Dansk Kvæg "Teknikken" i testdagsmodellen Jørn Pedersen, Afdeling for Specialviden, Dansk Kvæg Nordisk avlsværdivurdering kort opsummering 3 racegrupper: Nordisk Holstein: Dansk, Svensk og Finsk Holstein samt Dansk

Læs mere

Quick Guide til. MATCH IT! DNA software. Til in vitro-diagnostisk brug. Til anvendelse med IMMUCOR LIFECODES HLA SSO-analyser 1 LC1497DA.

Quick Guide til. MATCH IT! DNA software. Til in vitro-diagnostisk brug. Til anvendelse med IMMUCOR LIFECODES HLA SSO-analyser 1 LC1497DA. Quick Guide til MATCH IT! DNA software Til anvendelse med IMMUCOR LIFECODES HLA SSO-analyser Til in vitro-diagnostisk brug 1 LC1497DA.1 (09/15) Denne manual er fremstillet til anvendelse med MIDNA MATCH

Læs mere

Email menuen 15.1. Email kan sende e-mails ud til forbrugerne både til alle eller til nogle efter bestemte udvælgelseskriterier.

Email menuen 15.1. Email kan sende e-mails ud til forbrugerne både til alle eller til nogle efter bestemte udvælgelseskriterier. Email menuen 15.1 15. EMAIL Email kan sende e-mails ud til forbrugerne både til alle eller til nogle efter bestemte udvælgelseskriterier. Email kan sende ud med forskellige skrifttyper, fed, underlineret,

Læs mere

Den europæiske økonomiske genopretningsplan i regioner og byer: Ét år efter Papirversion af en online-undersøgelse http://www.cor.europa.

Den europæiske økonomiske genopretningsplan i regioner og byer: Ét år efter Papirversion af en online-undersøgelse http://www.cor.europa. Direktoratet for Rådgivende Funktioner Enhed 3 Netværk & Subsidiaritet DEN EUROPÆISKE UNION Regionsudvalget Den europæiske økonomiske genopretningsplan i regioner og byer: Et år efter Spørgeskema Frist

Læs mere

Prøveudtagning i forbindelse med bestemmelse af fugt i materialer

Prøveudtagning i forbindelse med bestemmelse af fugt i materialer Prøveudtagning i forbindelse med bestemmelse af fugt i materialer Når du skal indsende prøver af materiale til analyse i Teknologisk Instituts fugtlaboratorium, er det vigtigt, at du har udtaget prøverne

Læs mere

Brugermanual til Ventelistelukning. www.ventelistelukning.dk

Brugermanual til Ventelistelukning. www.ventelistelukning.dk Brugermanual til Ventelistelukning www.ventelistelukning.dk Publikationen er udgivet af Socialstyrelsen Edisonsvej 18, 1. 5000 Odense C Tlf: 72 42 37 00 E-mail: socialstyrelsen@socialstyrelsen.dk www.socialstyrelsen.dk

Læs mere

Udnyttelse og tab af kvælstof efter separering af gylle

Udnyttelse og tab af kvælstof efter separering af gylle Markbrug nr. 283 September 2003 Udnyttelse og tab af kvælstof efter separering af gylle Peter Sørensen, Afdeling for Jordbrugsproduktion og Miljø, Danmarks JordbrugsForskning Ministeriet for Fødevarer,

Læs mere

Nyt fra NAV. Gert Pedersen Aamand. Nordisk Avlsværdi Vurdering Nordic Cattle Genetic Evaluation

Nyt fra NAV. Gert Pedersen Aamand. Nordisk Avlsværdi Vurdering Nordic Cattle Genetic Evaluation Nyt fra NAV Gert Pedersen Aamand Implementeret i 2014 Egenskab/indeks Dato Kommentar GEBV Februar 2014 Justering Holstein holdbarhed GEBV Marts 2014 US Jersey tyre inkluderet i ref population Yversundhed

Læs mere

OPSÆTNING AF PBS I EPOS LØN

OPSÆTNING AF PBS I EPOS LØN OPSÆTNING AF PBS I EPOS LØN JUNI 2009 Indholdsfortegnelse 1 Indledning... 1 1.1 Formål... 1 1.2 Bemærkninger... 1 1.3 Forudsætninger... 2 2 Kalender... 3 2.1 Opret kalender... 3 2.2 Opdater helligdage...

Læs mere

Forelæsning 6: Kapitel 7: Hypotesetest for gennemsnit (one-sample setup). 7.4-7.6

Forelæsning 6: Kapitel 7: Hypotesetest for gennemsnit (one-sample setup). 7.4-7.6 Kursus 02402 Introduktion til Statistik Forelæsning 6: Kapitel 7: Hypotesetest for gennemsnit (one-sample setup). 7.4-7.6 Per Bruun Brockhoff DTU Compute, Statistik og Dataanalyse Bygning 324, Rum 220

Læs mere

JAR Øvelse nr. 2. JAR-Manual, Version 1.0. Avanceret søgning. Regionsvejledning

JAR Øvelse nr. 2. JAR-Manual, Version 1.0. Avanceret søgning. Regionsvejledning JAR Øvelse nr. 2 Avanceret søgning Regionsvejledning JAR-Manual, Version 1.0 Øvelse ID: 2 Øvelsesemne: Avanceret søgning Øvelsesbeskrivelse: Gør dig i stand til at bygge avancerede søgninger op. Formål:

Læs mere

DGKs manual til brug af hundeweb til udstillinger

DGKs manual til brug af hundeweb til udstillinger 2015 DGKs manual til brug af hundeweb til udstillinger DGK Dansk Gravhundeklub 05-04-2015 Dette er DGK s manual til Klubsystemet vedrørende udstillingssystemet for arbejdsudvalgene. Aftale om brug af og

Læs mere

PC - installation af Maple 2016 med GYM-pakken

PC - installation af Maple 2016 med GYM-pakken PC - installation af Maple 2016 med GYM-pakken Download først de relevante installere til både Maple 2016 og til Gym-pakken, og placer dem et sted på din PC, hvor du kan finde dem igen. Hvis du højre-klikker

Læs mere

Genomisk Selektion Fra DNA til genomisk avlsværdi

Genomisk Selektion Fra DNA til genomisk avlsværdi Genomisk Selektion Fra DNA til genomisk avlsværdi præsenteret af Gert Pedersen Aamand Personalemøde 20-8-2010 Genomisk selektion historien kort 2008 50.000 genmarkører kan bestemmes for hvert dyr Første

Læs mere

Kartoflens genetiske puslespil

Kartoflens genetiske puslespil Kartoflens genetiske puslespil klassisk forædling og ny teknologi Kartoffelforædling lyder umiddelbart som en stilfærdig beskæftigelse, men forædleren skal være beredt på våbenkapløb med en svamp, klar

Læs mere

Beskrivelse Tælleværket KEBL9 opdateres ikke når kunden er 'kun mod kontant'.

Beskrivelse Tælleværket KEBL9 opdateres ikke når kunden er 'kun mod kontant'. 6201 Sagsregistrering B 00363805 Ej faktureret opdateres ikke. Ref.: 36126 Tælleværket KEBL9 opdateres ikke når kunden er 'kun mod kontant'. Hvis kunden ved ordrens oprettelse er "Kun mod kontant", altså

Læs mere

Katalog 2013. - sådan opdaterer du dine oplysninger til Danhostel-kataloget. Version 1.0 INDHOLDSFORTEGNELSE

Katalog 2013. - sådan opdaterer du dine oplysninger til Danhostel-kataloget. Version 1.0 INDHOLDSFORTEGNELSE Katalog 2013 - sådan opdaterer du dine oplysninger til Danhostel-kataloget Version 1.0 INDHOLDSFORTEGNELSE 1. ADGANG OG LOGIN... 2 2. STAMDATA... 2 3. TEKSTER... 4 (OBS: DER ER IKKE TEKSTER I 2013 KATALOGET)...

Læs mere

Deoxyribonukleinsyre

Deoxyribonukleinsyre DNAs Forunderlige struktur Ved Rebecca E.-Sørensen stud.scient i medicinalkemi ved Aarhus Universitet Deoxyribonukleinsyre Strukturen af DNA findes af James D. Watson og Francis H. Crick i 1953 1 Nuklein

Læs mere

GPS-baseret PDA-enhed til indberetning af sygdomme og skadedyr til Registreringsnettet Dansk Landbrugsrådgivning, Landscentret, 2009

GPS-baseret PDA-enhed til indberetning af sygdomme og skadedyr til Registreringsnettet Dansk Landbrugsrådgivning, Landscentret, 2009 GPS-baseret PDA-enhed til indberetning af sygdomme og skadedyr til Registreringsnettet Dansk Landbrugsrådgivning, Landscentret, 2009 Det Europæiske Fællesskab og Ministeriet for Fødevarer, Landbrug og

Læs mere

SmartAir TS1000. Daglig brug

SmartAir TS1000. Daglig brug SmartAir TS1000 Daglig brug Indhold Brugere... 4 Opret brugere... 4 Brugerliste vinduet... 5 Knapper... 5 Grupper... 6 Søg bruger... 7 Rapport vinduet (brugere)... 7 Døre... 8 Opret døre... 8 Dørliste

Læs mere

På opdagelse i gernerne

På opdagelse i gernerne På opdagelse i gernerne DNA (molekyle): arvemateriale Alle vore celler er genetisk set identiske DNA: genetiske opskrifter - kogebog for cellerne = genregulering Opskrift på forskellige proteiner Vejledninger

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 13 Danmarks Tekniske Universitet Skriftlig prøve, den 22/2-2013 Kursus navn: Introduktion til SystemBiologi Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle opgaver. Kursusansvarlig

Læs mere

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner Generne bestemmer Niveau: 8. klasse Varighed: 12 lektioner Præsentation: Generne bestemmer er et forløb om genernes indflydelse på individet. I forløbet kommer vi omkring den eukaryote celle, celledeling,

Læs mere

1. Hvad er kræft, og hvorfor opstår sygdommen?

1. Hvad er kræft, og hvorfor opstår sygdommen? 1. Hvad er kræft, og hvorfor opstår sygdommen? Dette kapitel fortæller om, cellen, kroppens byggesten hvad der sker i cellen, når kræft opstår? årsager til kræft Alle levende organismer består af celler.

Læs mere

JAR nyhedsbrev fra Region Nordjylland

JAR nyhedsbrev fra Region Nordjylland JAR nyhedsbrev fra Region Nordjylland Juni 2015 I dette nyhedsbrev kan du læse lidt om regionernes undervisningsportal, hvor du bl.a. kan finde information om JAR kurser og øvelsesvejledninger. Du kan

Læs mere

Matematik C Højere forberedelseseksamen

Matematik C Højere forberedelseseksamen Matematik C Højere forberedelseseksamen Hæfte: August 2014 Kl. 9.00-12.00 Copyright Anders og Mark Kommentar til opgaven: Lilla farve - angiver formlen. Rød farve - angiver ophævelsen af en ligning. Matematik

Læs mere

Livet i hjemmet stiller store krav til madrasser og sengebunde hver dag. IKEA madrasser og sengebunde er blevet grundigt testet, så vi er sikre på,

Livet i hjemmet stiller store krav til madrasser og sengebunde hver dag. IKEA madrasser og sengebunde er blevet grundigt testet, så vi er sikre på, Madrasser 11_014 Livet i hjemmet stiller store krav til madrasser og sengebunde hver dag. IKEA madrasser og sengebunde er blevet grundigt testet, så vi er sikre på, at de overholder vores strenge standarder

Læs mere

Farvegenetik hos katte

Farvegenetik hos katte Genetikserie del 3 Farvegenetik hos katte Kattegenetik baseret på farver og mønstre Tekst og foto: Ole Amstrup Artiklen er fortsat fra sidste nummer af Kattemagasinet [ x o ] / [ x ] Den røde farve I de

Læs mere

Analyser uden GPS-positioner

Analyser uden GPS-positioner Generelt Dette afsnit viser hvordan du importerer, behandler og præsenterer jordbundsanalyseresultater, som er taget uden GPSpositioner. Denne vejledning er skrevet som et eksempel, og den forudsætter,

Læs mere

HALLO NORDEN NORDISKE GRÆNSEHINDRINGER

HALLO NORDEN NORDISKE GRÆNSEHINDRINGER Hallo Norden HALLO NORDEN NORDISKE GRÆNSEHINDRINGER Præsentation af Hallo Norden på seminaret Færøerne og Norden - muligheder, rettigheder, hindringer Torsdag 18. november 2010. HALLO NORDEN Hallo Norden

Læs mere

Notat. Introdansk beskrivelse af fastlagte krav til indberetning af statistikoplysninger fra udbydere 27.06.2012 JL

Notat. Introdansk beskrivelse af fastlagte krav til indberetning af statistikoplysninger fra udbydere 27.06.2012 JL Notat Vedrørende: Skrevet af: Introdansk beskrivelse af fastlagte krav til indberetning af statistikoplysninger fra udbydere Jesper Lund Version: 1.4: rev. af Ankestyrelsen, januar 2014 27.06.2012 JL I

Læs mere

Kapitel 9: Grænseoverskridende udbud og optagelse til notering eller handel

Kapitel 9: Grænseoverskridende udbud og optagelse til notering eller handel Vejledning til bekendtgørelse nr. 306 af 28. april 2005 om prospekter for værdipapirer, der optages til notering eller handel på et reguleret marked, og ved første offentlige udbud af værdipapirer over

Læs mere

ELEKTRONISK INDBERETNING BØRNEDATABASEN VIA DGWS 13/1 2010 VERSION 1.02

ELEKTRONISK INDBERETNING BØRNEDATABASEN VIA DGWS 13/1 2010 VERSION 1.02 ELEKTRONISK INDBERETNING BØRNEDATABASEN VIA DGWS 13/1 2010 VERSION 1.02 Indhold Indhold... 2 Introduktion... 3 Den Gode Webservice... 4 ID Kortet... 4 Signering... 4 BDBChildMeasurementReport webservicen...

Læs mere

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm.

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Liselotte Wesley Andersen

Læs mere

Undersøgelse af arvelige faktorer ved autisme

Undersøgelse af arvelige faktorer ved autisme Undersøgelse af arvelige faktorer ved autisme Nyhedsbrev nr. 3, februar 2006 Introduktion Det er med glæde, at vi her kan præsentere vores tredje nyhedsbrev til alle familierne, som deltager i projektet

Læs mere

I systemet er der mulighed for at hente servicelinjer ind på en serviceordre, som er under oprettelse.

I systemet er der mulighed for at hente servicelinjer ind på en serviceordre, som er under oprettelse. Kopiering af servicelinjer Det er i flere situationer fordelagtigt at kunne kopiere servicelinjer fra en serviceordre eller bogført faktura til en ny serviceordre. Fx ved ensartede reparationer eller klargøringer

Læs mere

Mindmap, informationssøgning og skriftlig fremstilling

Mindmap, informationssøgning og skriftlig fremstilling Du planlægger en studietur til Finland, men da du ikke kender særligt meget til Finland, beslutter du dig for at skrive en opslagsbog inden du rejser. Opslagsbogen kan tilføjes dine egne oplevelser i løbet

Læs mere

FSFI s guide til DFR s elektronisk bevissystem

FSFI s guide til DFR s elektronisk bevissystem FSFI s guide til DFR s elektronisk bevissystem Dette er en kort guide i anvendelsen af Dansk Førstehjælpsråd elektroniske bevissystem. Guiden viser og forklarer, hvordan du som instruktør og medlem af

Læs mere

Vejledning om tildeling af handyrtillæg

Vejledning om tildeling af handyrtillæg Vejledning om tildeling af handyrtillæg (HD-tillæg) Juli 2011 Kolofon Denne vejledning er udarbejdet af FødevareErhverv i 2011 Bidragyder(e): FødevareErhverv Fotograf(er): Colourbox Ministeriet for Fødevarer,

Læs mere

SMART TRANSCRIPTION MANUAL

SMART TRANSCRIPTION MANUAL SMART TRANSCRIPTION MANUAL 1 Har du spørgsmål til programmet, så send en email til support@mirsk.com eller ring på 70 25 00 29 Vi ønsker rigtig god fornøjelse med Smart Transcription Healthcare TM Med

Læs mere

Program. 1. Repetition: konfidens-intervaller. 2. Hypotese test, type I og type II fejl, signifikansniveau, styrke, en- og to-sidede test.

Program. 1. Repetition: konfidens-intervaller. 2. Hypotese test, type I og type II fejl, signifikansniveau, styrke, en- og to-sidede test. Program 1. Repetition: konfidens-intervaller. 2. Hypotese test, type I og type II fejl, signifikansniveau, styrke, en- og to-sidede test. 1/19 Konfidensinterval for µ (σ kendt) Estimat ˆµ = X bedste bud

Læs mere

Anvendelse. Version 2.0: 19-12-2011

Anvendelse. Version 2.0: 19-12-2011 1 Anvendelse Angiver hvad dyrene anvendes til. Ikke hvilken besætnings type de er solgt til. En Avls-eller Opformerings-besætning kan godt købe krydsnings dyr. Men de kan ikke anvendes til Avl eller Opformering.

Læs mere

OPC ACCESS HEARTBEAT 1

OPC ACCESS HEARTBEAT 1 OPC Access Heartbeat Dette dokument gennemgår i et kort eksempel, hvordan OPC Access konfigureres til at anvende Heartbeat funktionen til at dokumentere kontinuerlig forbindelse mellem SQL Server og OPC

Læs mere

FARVEGENETIK - med fokus på Eurasieren

FARVEGENETIK - med fokus på Eurasieren FARVEGENETIK - med fokus på Eurasieren Helle Friis Proschowsky, dyrlæge Ph.d. Specialkonsulent hos DKK Farvegenetik En smule grundlæggende genetik Farvegenetik generelt Farvegenetik med særligt fokus på

Læs mere

Indret dit mælkerum efter kravene

Indret dit mælkerum efter kravene Indret dit mælkerum efter kravene Specialkonsulent, Videncentret for Landbrug, Kvæg Helge Kromann Kvalitetsingeniør, Arla Foods Jesper Petersen Det Europæiske Fællesskab ved Den Europæiske Fond for Udvikling

Læs mere

Hundeweb Brugermanual Opret DJU prøver m.m.

Hundeweb Brugermanual Opret DJU prøver m.m. Hundeweb Brugermanual Opret DJU prøver m.m. Indholdsfortegnelse Kapitel 0 - Log på hundeweb...2 Log på Klubsystemet...3 Kapitel 1 Opret prøve...4 Kapitel 2 Aktiver prøven så der kan tilmeldes på hundeweb...7

Læs mere

Stednavne og Googlemaps

Stednavne og Googlemaps Stednavne og Googlemaps Google modulet vedligeholdes kun via admin-modulet. Stednavne redigeres under det enkelte individ og herefter til lægges koordinaterne via google-modulet. Check allerførst om modulet

Læs mere

Brugertilfredshed på aktivitetscentrene daghjem 2012. 1. Indledning... 2. 1.1 Kvalitet inden for givne rammer... 3

Brugertilfredshed på aktivitetscentrene daghjem 2012. 1. Indledning... 2. 1.1 Kvalitet inden for givne rammer... 3 Indholdsfortegnelse 1. Indledning... 2 1.1 Kvalitet inden for givne rammer... 3 1.2 Undersøgelsens fokusområder og opbygning... 3 2. Spørgeskemaundersøgelsen... 5 2.1 Hvad betyder tallene i tabellerne?...

Læs mere

VikingGenetics har kurs mod bedre frugtbarhed. Avlsleder Peter G. Larson, VikingGenetics

VikingGenetics har kurs mod bedre frugtbarhed. Avlsleder Peter G. Larson, VikingGenetics VikingGenetics har kurs mod bedre frugtbarhed Avlsleder Peter G. Larson, VikingGenetics Disposition Sædens befrugtningsevne Sædkvalitet Frugtbarheden med kønssorteret sæd Hunlig frugtbarhed Danske avlsværdital

Læs mere

Den nationale opgørelse af emissioner fra træfyring i husholdninger

Den nationale opgørelse af emissioner fra træfyring i husholdninger Den nationale opgørelse af emissioner fra træfyring i husholdninger Fagligt seminar Teknologisk Institut Marlene Plejdrup & Ole-Kenneth Nielsen Institut for Miljøvidenskab DCE Nationalt Center for Miljø

Læs mere

Indholdsfortegnelse. 1. Installation af LØN... 1. 2. Introduktion til LØN... 2. 3. Indtastning af lønseddel... 7. 4. Udskrifter...

Indholdsfortegnelse. 1. Installation af LØN... 1. 2. Introduktion til LØN... 2. 3. Indtastning af lønseddel... 7. 4. Udskrifter... Løn til Windows Indholdsfortegnelse 1. Installation af LØN... 1 2. Introduktion til LØN... 2 2.1. Første start af LØN...2 2.1.1. Ét eller flere distrikter...2 2.1.2. Lønperioder...3 2.1.3. Kartoteker...4

Læs mere

Farver og genetik hos landracegeder. Andreas Gertz

Farver og genetik hos landracegeder. Andreas Gertz Farver og genetik hos landracegeder Andreas Gertz 01.11.2014 DNA Gener - kromosomer gener kan sammenlignes med opskrifter nedskrevet I DNA-molekyler skrevet i 4 bogstaver (adenin, cytosin, guanin, thymin)

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Manualen beskriver brugen af SecureAware version 4.8.0 og senere versioner Dokument opdateret: June 2015

Manualen beskriver brugen af SecureAware version 4.8.0 og senere versioner Dokument opdateret: June 2015 SecureAware Quiz Manualen beskriver brugen af SecureAware version 4.8.0 og senere versioner Dokument opdateret: June 2015 Om dette dokument Dette dokument beskriver brugen af quizmodulet i SecureAware.

Læs mere

KVIK-GUIDE: Sådan tjekker du din indberetning

KVIK-GUIDE: Sådan tjekker du din indberetning KVIK-GUIDE: Sådan tjekker du din indberetning Indberetning.da.dk samler al information vedrørende indberetning til DA Statistik for virksomheder, der er medlem af en arbejdsgiverorganisation i DA. For

Læs mere

Dansk Petanque Forbund

Dansk Petanque Forbund Protektor Hans Kongelige Højhed Prinsgemalen Medlem af Danmarks Idræts- Forbund og Féderation Internationale de Pétanque et Jeu Provençal Dansk Petanque Forbund Brugervejledning til PetanquePortalen for

Læs mere

Case 1 Atlantisk sild

Case 1 Atlantisk sild Case 1 Atlantisk sild Der fandtes ingen metode til at skelne Nordsø og Nordøstatlantisk sild (Norske vårgydere og Islandske sommergydere) Sporingsværktøjer som kan henføre enkelte fisk til oprindelsesbestand

Læs mere

Versionsbrev. LUDUS Web version 2.18.3. Den 13. januar 2011. J.nr. 4004-V0212-11

Versionsbrev. LUDUS Web version 2.18.3. Den 13. januar 2011. J.nr. 4004-V0212-11 Versionsbrev LUDUS Web version 2.18.3 Den 13. januar 2011 J.nr. 4004-V0212-11 CSC Scandihealth A/S, P.O. Pedersens Vej 2, DK-8200 Århus N Tlf. +45 3614 4000, fax +45 3614 7324, www.scandihealth.dk, scandihealth@csc.com

Læs mere

To samhørende variable

To samhørende variable To samhørende variable Statistik er tal brugt som argumenter. - Leonard Louis Levinsen Antagatviharn observationspar x 1, y 1,, x n,y n. Betragt de to tilsvarende variable x og y. Hvordan måles sammenhængen

Læs mere

Ph.d. Ph.d.-uddannelsen i tal udviklingen frem til og med 2013

Ph.d. Ph.d.-uddannelsen i tal udviklingen frem til og med 2013 Ph.d. Ph.d.-uddannelsen i tal udviklingen frem til og med 2013 I globaliseringsaftalen fra 2006 blev det besluttet at fordoble det årlige ph.d.-optag fra 2003 til 2010 1. Ved globaliseringsaftalens udløb

Læs mere

_2_mulighederAfgive vælgererklæring eller tilbagetrække støtte?

_2_mulighederAfgive vælgererklæring eller tilbagetrække støtte? Support Hvis du ikke kan finde svar på dine spørgsmål længere nede på siden, kan du kontakte partiet. Du kan stille spørgsmål til processen, eller til brugen af systemet ved at kontakte det parti du vil

Læs mere

Brugermanual til NaboLink enhederne: BaseLink V02 KeyLink V02 AlarmLink V02 Revision 16.03.2016. Indholdsfortegnelse:

Brugermanual til NaboLink enhederne: BaseLink V02 KeyLink V02 AlarmLink V02 Revision 16.03.2016. Indholdsfortegnelse: Brugermanual til NaboLink enhederne: Indholdsfortegnelse: BaseLink V02 KeyLink V02 AlarmLink V02 Revision 16.03.2016 1 Side 1. Standard sæt indeholder.... 2 2. AlarmLink indeholder.... 2 3. Udvidet sæt

Læs mere

Revideret d. 15. august 2014. Indholdsfortegnelse

Revideret d. 15. august 2014. Indholdsfortegnelse Revideret d. 15. august 2014 Indholdsfortegnelse 1. Status for Sprogvurderingen... 2 2. Opret en sprogvurdering og indtast besvarelser... 3 3. Opret forælder og send mail... 5 4. Afslut aktuel sprogvurdering...

Læs mere

EL: Kvartalsstatistik amu

EL: Kvartalsstatistik amu EL: Kvartalsstatistik amu Kvartalsstatistikken er trukket fra Ministeriets for Børn og Undervisningsministeriets databank d. 14/5. På dette tidspunkt er data opdateret til og med. Indhold 1 Aktivitet på

Læs mere