Herunder er vist en afstandsmatrice for fem pattedyr: Ulv (U), moskusokse (M), kænguru (K), isbjørn (I) og vildsvin (V).

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Herunder er vist en afstandsmatrice for fem pattedyr: Ulv (U), moskusokse (M), kænguru (K), isbjørn (I) og vildsvin (V)."

Transkript

1 Fylogenetiske træer Dette dokument indeholder først et eksempel på hvordan man kan bruge UPGMA-metoden til at danne fylogenetiske træer ud fra en afstandsmatrice, og derefter en række øvelser der illustrerer både hvordan man kan lave fylogenetiske træer i hånden og tilsvarende træer i programmet MEGA. Håndlavede træer med UPGMA-metoden I dette afsnit bliver UPGMA-metoden i hånden gennemgået. For en grundigere gennemgang af metoden til at lave UPGMA-træer i hånden se Bioteknologi 6, side 31-34, hvor et alternativt eksempel er gennemgået. Herunder er vist en afstandsmatrice for fem pattedyr: Ulv (U), moskusokse (M), kænguru (K), isbjørn (I) og vildsvin (V). Ulv Moskusokse Kænguru Isbjørn Vildsvin Ulv Moskusokse Kænguru Isbjørn 0 8 Vildsvin 0 1. Det første vi gør i en UPGMA-metode, er at finde de to grupper der har færrest forskelle, i dette tilfælde er det ulven og isbjørnen da der kun er fire forskelle mellem dem. Derfor dannes nu den første gruppering så de fire forskelle er fordelt lige på de to udviklingslinjer. Den nye afstandsmatrice hvor U og I er slået sammen, dannes nu ved at udregne UIgruppens gennemsnitlige afstand til de andre dyr. Eksempelvis udregnes UI-gruppens afstand til M ved at sige: UI-M = (U-M + I-M) / 2 = (8 + 8) / 2 = 8 På den måde dannes den nye afstandsmatrice samt den første forgrening på træet som vist herunder. U-I M K V U-I M K 0 14 V 0 Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

2 2. Nu er det moskusoksen (M) og vildsvinet (V) der skal grupperes, og da afstanden mellem dem er 6, skal der være tre forskelle på hver gren. Nu udregnes en ny afstandsmatrice og træet udvides. Afstanden mellem UI og MV udregnes på følgende måde: UI-MV = (U-M + U-V + I-M + I-V) / 4 = ( ) / 4 = 8 UI MV K UI MV 0 14 K 0 3. Nu ses det at næste forgrening skal være kombinationen af de to grupper UI og MV, så den samlede afstand mellem et af rovdyrene (U og I) og et af hovdyrene (V og M) bliver otte forskelle. Derudover udregnes denne gruppes gennemsnitlige afstand til kænguruen, og der opstilles en ny afstandsmatrice. Dette er vist herunder. UIMV K UIMV 0 14 K 0 4. Der er nu kun tilbage at sætte sidste forgrening på træet så den samlede afstand mellem kænguruen, som jo er et pungdyr, og alle de placentale pattedyr (M, V, U og I) hver især er 14 forskelle. Dette gøres ved at grenen ud til kænguruen skal være syv forskelle lang og grenen hen til de placentale pattedyr tre forskelle lang (fra fire ud til syv). Herunder er vist det færdige træ samt den oprindelige afstandsmatrice. U M K I V U M K I 0 8 V 0 Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

3 Yderligere bemærkninger til håndlavede stamtræer Grunden til at træet var forholdsvis ukompliceret at lave, er at datasættet (afstandsmatricen) der blev benyttet, er særligt udvalgt, så det opfyldte en række krav. Det primære krav var at evolutionsraten er den samme i alle grene i træet, hvilket gør at alle afstande passer sammen. Hvis du ser grundigt efter, ser du at alle de indbyrdes afstande passer perfekt sammen, så der optrådte aldrig nye tal i afstandsmatricen. Så simpel er virkeligheden meget sjældent når man arbejder med rigtige data, men metoden er den samme. Så længe man altid husker at udregne de nye gennemsnitlige afstande som vist herover og i Bioteknologi 6, så får man lavet et UPGMA-træ som man derefter kan analysere og fortolke. Fylogenetiske træer ved hjælp af MEGA Det er meget let og hurtigt at lave en afstandsmatrice og et fylogenetisk træ i MEGA. Desværre kan MEGA på nuværende tidspunkt ikke bruge en afstandsmatrice som input, den skal have de bagvedliggende sekvenser, men da man ofte også har dem til rådighed er dette et mindre problem. Lad os tage udgangspunkt i en gammel eksamensopgave fra Biologi A. Til august eksamen 2008 handlede opgave 3 om slægtskabsanalyser og forskellige dyrs tilpasning til at leve i vand. I opgaven blev der angivet en multipel alignment som er vist herunder. Kænguru Blåhval Flodhest Zebra Næsehorn Ringsæl CACCACCACCAATACA ACCGATTCCCCACCCA ACCGGCATCCCGCCCA ACTCACACCTCATTCA ACTCACCCCTTTCTCA ACCAACCATTTATACA 1. Åben MEGA og opret en ny alignment ved at vælge Align og Edit/Build Alignment. Vælg nu Create a new alignment efterfulgt af DNA. 2. Opret de seks nye sekvenser i MEGA og indtast ovenstående sekvenser. Vejledning til hvordan dette gøres, findes i link tre, tema 12 til Bioteknologi 6. Der gives en grundig gennemgang af, hvordan man opretter og arbejder med alignments i MEGA. Efter indtastning af sekvenserne bør skærmbilledet ligne det der er vist herunder: 3. Klik på Data og vælg Phylogenetic Analysis og sig nej til at det er proteinkodende sekvenser. Nu er det indtastede datasæt klar til nærmere analyse i MEGA. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

4 4. Gå til hovedvinduet i MEGA og vælg Distance og Compute Pairwise Distances. Sørg for at modellen der beregnes ud fra, er No. of differences. For nærmere vejledning til at danne afstandsmatricer i MEGA se link 5 på Bioteknologi 6 s hjemmeside hvor det er gennemgået mere detaljeret. Tjek at den fundne afstandsmatrice stemmer overens med den der er vist herunder. Kænguru - Kænguru Blåhval Flodhest Zebra Næsehorn Ringsæl Blåhval 9 - Flodhest Zebra Næsehorn Ringsæl Der skal nu laves et UPGMA-træ baseret på denne afstandsmatrice. Vælg knappen Phylogeny og herefter Construct/Test UPGMA tree. Følgende vindue dukker nu op. Det er vigtigt at beregningsmodellen er valgt rigtigt, sørg for at der under Substitution Model i feltet Model/Method står No. of differences og i feltet nedenunder med titlen Substitutions to Include står d: Transititions + Transversions. Tjek også at de andre valgmuligheder er lig det viste. 6. Tjek at opsætninger er som vist herover og klik på Compute -knappen. Efter et kort øjeblik vises et fylogenetisk træ som gerne skulle se ud som vist herunder til venstre. Til højre er vist et fylogenetisk træ med samme forgreningsmønster som det der var angivet i opgaven. Kaenguru Ringsael Zebra Naesehorn Blaahval Flodhest Sammenlign de to stamtræer, er de ens? Hvilket af de to træer tror du er mest rigtigt biologisk set? 8. Hvis ikke hvad kan forklaringen være på dette? Indeholder datasættet nok information til at lave et korrekt stamtræ eller kan tilfældig variation påvirke træet? Er nogle af antagelserne i den simple UPGMA-model ikke i orden? Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

5 9. Luk UPGMA stamtræet ned og lav i stedet et såkaldt NJ-stamtræ ved at vælge Construct/Test Neighbor-Joining Tree. Dette træ antager ikke at evolutionen går lige hurtigt i alle arter, og er baseret på en helt anden type algoritme til at beregne stamtræet. Nu finder man et stamtræ i stil med det vist herunder. Urodet NJ-træ der viser resultatet af at bruge en anden stamtræs metode på det meget lille datasæt. Det er tydeligt at denne metode tyder på at arterne ikke har gennemgået lige hurtig udvikling, hvilket er en af antagelserne i UPGMA-metoden. Træet er urodet, men vi kan tilføje en rod ved at trykke på den med rødt markerede knap Place Root on Branch og derefter vælge den art vi mener, er fjernest beslægtet med de andre. 10. Hvordan passer dette NJ-stamtræ med det der blev angivet i opgaven? 11. Placer roden af træet på grenen ud til kænguruen, da denne er det eneste ikke placentale pattedyr i opgaven. Hvordan passer træet nu med det der blev angivet i opgaven? Metoderne til at bygge stamtræer kan give upræcise resultater hvis datasættet er lille Hvis datasættet ikke indeholder meget information kan alle typer stamtræsmetoder give biologisk forkerte stamtræer. Hvis de forskellige metoders antagelser ikke passer med data kan de give forkerte stamtræer Det er ofte en god ide at dobbelttjekke sit stamtræ hvis det er muligt, og undersøge hvorvidt en alternativ metode giver samme stamtræ. Hvis ikke forskellige metoder giver samme stamtræ skyldes det ofte en kombination af mangel på data og at metodens antagelser ikke passer med data. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

6 Opgaver til fylogenetiske træer Herunder er der to opgaver der begge omhandler fylogenetiske træer. Opgave 1. Truede tigre Et af de vejledende eksamensopgavesæt der udkom i 2006 indeholdt en opgave om truede tigre. I opgaven fik man en multipel nucleotidalignment af seks tigre som vist herunder samt en delvist udfyldt afstandsmatrice. Sekvenserne er ifølge opgaven et udsnit af det mitokondrielle DNA. Spørgsmålene herunder er stærkt inspireret af den vejledende eksamensopgave. Sibirisk Sydkinesisk Indokinesisk I Indokinesisk II Sumatra Bengalsk GCACCGTACCCCCCTCACTTTGTGGCACCTCTATATAATGCTACTAGGCTGCCG ACGCCGCACTCCCTCCGCTTTGTGGCATCTCTACATGATGCCATCAAGCCACTG GTACCGCACCCCCCTCGCTTTATAGCACTTCTATATAATGCTACTAGGCTGCTG GCGCCGCACCCCCCTCGCTTTGTGATATCTTTACGTAATGCTACTAGGCTGCCG ACGCCGCACCCCCTTCGCTTTGCGGCGTCTCTACATAACGCCATTAGGTTGCTG GCGCCGGACCCCCCTTGCTCTGTGGCATCTCTACATAACGTCATTAGACTGCTG Her er vist en færdig udfyldt afstandsmatrice baseret på ovenstående sekvenser. Sibirisk Sydkinesisk Indokinesisk I Indokinesisk II Sumatra Bengalsk Sibirisk Sydkinesisk Indokinesisk Indokinesisk Sumatra Bengalsk I II Angiv fordele og eventuelle ulemper ved at anvende mitokondrie-dna i stedet for kerne- DNA til slægtskabsundersøgelser af tætbeslægtede arter. 2. Lav et fylogenetisk træ baseret på de angivne sekvenser. Du kan enten lave træet i hånden eller ved hjælp af MEGA. 3. Diskuter med udgangspunkt i den konstruerede fylogeni, hvorvidt indokinesisk I og indokinesisk II bør betragtes som en eller to separate arter. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

7 Opgave 2. Isbjørnen og dens familie På videnskab.dk kunne man d. 19. oktober 2011 i artiklen Den brune bjørns arvemasse kortlagt, læse følgende: En bjørn fra nationalparken Pasvik i Norge har fået sit genom kortlagt. Det kan blive nøglen til banebrydende klima- og evolutionsforskning. Forskerne håber at lære mere om artens tilpasning til et nyt klima. Brunbjørnens genom har specielt stor betydning på grund af det nære slægtskab med isbjørnen selve symbolet på klimaændring. Nyere studier ved BiK-F viser, at den brune bjørn og isbjørnen først udviklede sig til forskellige arter for år siden, og at arterne er langt ældre end først antaget. At sammenligne deres genomer vil derfor fortælle meget om, hvordan de har formået at tilpasse sig forskellige klimaer. Det samlede mitokondriegenom er kendt for en række forskellige bjørnearter. Herunder er vist en afstandsmatrice baseret på antal parvise forskelle. Panda Kravebjørn Am. sortbjørn Isbjørn Brun bjørn Panda Kravebjørn Am. sortbjørn Isbjørn 0 5 Brun bjørn 0 1. Tegn et UPGMA-træ for de fem bjørnearter baseret på ovenstående afstandsmatrice. På den grønlandske nyhedstjeneste knr.gl kunne man d. 3. maj 2010 i artiklen Hybridbjørn fanget i Canada, læse følgende: En yderst sjælden blanding mellem en grizzlybjørn og en isbjørn er blevet skudt i Nordvest Territoriet i Canada. Hybrid-bjørnen blev skudt for en måned siden nær Ulukhaktok, og det var dens usædvanlige udseende, som efterfølgende fik biologer til at foretage en nærmere undersøgelse, oplyser canadisk CBC. Og nu står det klart, at det drejer sig om en hybrid-bjørn, som på canadisk er blevet til en pizzly eller en grolarbjørn. Hybriden har hvid pels og et hvidt hoved som en isbjørn men brune ben og brune poter som en grizzly 1. Biologer vurderer, at vi fremover vil komme til at se flere og flere hybridbjørne. Blandt andet på grund af klimaændringer. Når havisen forsvinder om sommeren, strander isbjørnene på land, og på den måde kommer de i kontakt med grizzly-bjørnene, siger marinebiolog Brendan Kelly. 1 Grizzlybjørne er et populært navn for Nordamerikanske bjørne af arten brun bjørn. 2. Diskutér på baggrund af artiklen hvorvidt isbjørnen og den brune bjørn bør betragtes som to forskellige arter eller to underarter af den samme art, inddrag dit UPGMA stamtræ. 3. Download nedenstående fil med en alignment af 12sRNA-genet fra otte bjørne og konstruer et UPGMA-stamtræ i MEGA baseret på denne alignment. Hvilke to bjørnearter er tættest beslægtet ifølge dette stamtræ? Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

Genetiske afstande og afstandsmatricer

Genetiske afstande og afstandsmatricer Genetiske afstande og afstandsmatricer Denne vejledning indeholder en række små øvelser og opgaver der illustrerer, hvordan man ud fra genetiske sekvenser kan udregne en gennemsnitlig evolutionær afstand

Læs mere

Brugermanual til Assignment Hand In

Brugermanual til Assignment Hand In Brugermanual til Assignment Hand In Indhold: Undervisere:... 2 Hvor finder jeg Assignment hand in?... 2 Opret en opgave... 3 Slet en opgave... 4 Rediger en opgave... 4 Hvor finder jeg de afleverede filer?...

Læs mere

Opret en bruger, der kan hente gratis programmer fra Autodesk

Opret en bruger, der kan hente gratis programmer fra Autodesk Autodesk produkter til studerende VIGTIG! VIGTIG! VIGTIG! Senere i denne vejledning skal du oprette dig som bruger hos Autodesk. Når du gør dette, SKAL DU IKKE (!) BENYTTE EN ELLER ANDEN PRIVAT E-MAIL

Læs mere

Foreningsmanual til ansøgning om sæsontider i offentlige lokaler.

Foreningsmanual til ansøgning om sæsontider i offentlige lokaler. Foreningsmanual til ansøgning om sæsontider i offentlige lokaler. Foreninger, der er godkendt som folkeoplysende foreninger og er hjemmehørende i Greve Kommune samt offentlige institutioner, kan ansøge

Læs mere

Installation af ETF s cloudløsning for Privatpraktiserende ergoterapeuter

Installation af ETF s cloudløsning for Privatpraktiserende ergoterapeuter Installation af ETF s cloudløsning for Privatpraktiserende ergoterapeuter For at starte opsætningen af produktet, downloades programmet ved at gå til nedstående link, og vælge under Privat praktiserende

Læs mere

FSFI s guide til DFR s elektronisk bevissystem

FSFI s guide til DFR s elektronisk bevissystem FSFI s guide til DFR s elektronisk bevissystem Dette er en kort guide i anvendelsen af Dansk Førstehjælpsråd elektroniske bevissystem. Guiden viser og forklarer, hvordan du som instruktør og medlem af

Læs mere

Allan C. Malmberg. Terningkast

Allan C. Malmberg. Terningkast Allan C. Malmberg Terningkast INFA 2008 Programmet Terning Terning er et INFA-program tilrettelagt med henblik på elever i 8. - 10. klasse som har særlig interesse i at arbejde med situationer af chancemæssig

Læs mere

BRUGERMANUAL. Ruteplanlægning i RUT. Røde Korsindsamlingen 8. MARTS 2012. RødeKors.dk

BRUGERMANUAL. Ruteplanlægning i RUT. Røde Korsindsamlingen 8. MARTS 2012. RødeKors.dk BRUGERMANUAL 8. MARTS 2012 Ruteplanlægning i RUT Røde Korsindsamlingen RødeKors.dk INDHOLD 1 Introduktion til RUT... 3 2 Sådan finder du og logger på RUT... 4 3 Et par tips... 4 4 Planlægning af ruter...

Læs mere

Diagrammer visualiser dine tal

Diagrammer visualiser dine tal Diagrammer visualiser dine tal Indledning På de efterfølgende sider vil du blive præsenteret for effektive måder til at indtaste data på i Excel. Vejledningen herunder er vist i Excel 2007 versionen, og

Læs mere

RUTruteplanlægningsvejledning. Folkekirkens Nødhjælp Sogneindsamling 2015

RUTruteplanlægningsvejledning. Folkekirkens Nødhjælp Sogneindsamling 2015 RUTruteplanlægningsvejledning Folkekirkens Nødhjælp Sogneindsamling 2015 Indhold 1. Introduktion til RUT... 2 1.1 Om vejledningen... 2 2. Log på RUT... 4 3. Sådan planlægger du ruter... 6 4. Sådan finder

Læs mere

Bevægelses analyse med SkillSpector. Version 1.0 Sidste opdatering: 14/05-2008

Bevægelses analyse med SkillSpector. Version 1.0 Sidste opdatering: 14/05-2008 Bevægelses analyse med SkillSpector Version 1.0 Sidste opdatering: 14/05-2008 Hvad er SkillSpector SkillSpector er software program til video baseret bevægelses analyse. Der er følgende muligheder med

Læs mere

Installér din Officepakke 2013

Installér din Officepakke 2013 Vær opmærksom på der godt kan forekomme andre billeder end dem som er illustreret. Dette er grundet ændringer fra microsoft. Blandt andet bliver SkyDrive ændret til OneDrive. Er du i tvivl om noget kan

Læs mere

Talrækker. Aktivitet Emne Klassetrin Side

Talrækker. Aktivitet Emne Klassetrin Side VisiRegn ideer 3 Talrækker Inge B. Larsen ibl@dpu.dk INFA juli 2001 Indhold: Aktivitet Emne Klassetrin Side Vejledning til Talrækker 2-4 Elevaktiviteter til Talrækker 3.1 Talrækker (1) M-Æ 5-9 3.2 Hanoi-spillet

Læs mere

Indholdsfortegnelse resultat- & kritikprogrammet.

Indholdsfortegnelse resultat- & kritikprogrammet. Indholdsfortegnelse resultat- & kritikprogrammet. Ringsekretærers indtastning af resultater og kritikker... 2 Kom i gang Opstart af programmet... 2 En anden bruger er i gang med ringen... 3 Dommer ændringer

Læs mere

Kvikmanual til FacilityNet

Kvikmanual til FacilityNet Kvikmanual til FacilityNet Om FacilityNet?... 2 Trin 1 - Aktiver din brugerprofil... 3 Trin 2: Opret ny bestilling... 4 Trin 3: Vælg varer... 5 Trin 4: Indtast ordreinformationer... 6 Trin 5: Indtast mødedeltagere...

Læs mere

IT Support Guide. Installation af netværksprinter (direkte IP print)

IT Support Guide. Installation af netværksprinter (direkte IP print) IT Support Guide Denne guide er hentet på www.spelling.dk Program: Microsoft Windows Vista Program sprog version: ENG (US) Guide emne: Installation af netværksprinter (direkte IP print) Publikationsnr.:

Læs mere

Brugervejledning til udfyldelse og udstedelse af Europass Mobilitetsbevis i Europass Mobilitetsdatabasen

Brugervejledning til udfyldelse og udstedelse af Europass Mobilitetsbevis i Europass Mobilitetsdatabasen Brugervejledning til udfyldelse og udstedelse af Europass Mobilitetsbevis i Europass Mobilitetsdatabasen Europass Mobilitetsbevis skal udfyldes og udstedes i mobilitetsdatabasen: http://mobilitet.europass.dk/.

Læs mere

www.kjellerupskole.dk

www.kjellerupskole.dk ForældreIntra er et lukket univers, hvor forældre skal angive brugernavn og adgangskode for at blive lukket ind. I denne lille folder beskrives nogle af de vigtigste funktioner i ForældreIntra. Man finder

Læs mere

Hvordan logger jeg på 1. gang Gå ind på skolens hjemmeside på adressen: www.stenpriv.dk. Klik på Forældreintra i menuen til venstre

Hvordan logger jeg på 1. gang Gå ind på skolens hjemmeside på adressen: www.stenpriv.dk. Klik på Forældreintra i menuen til venstre ForældreIntra er en udvidelse af hjemmesiden. I modsætning til de øvrige dele af hjemmesiden, som er åbne for alle internetbrugere, så er ForældreIntra et beskyttet område, hvor kun forældre til elever

Læs mere

KEMIguiden Vejledning. Rev. udgave april 2010

KEMIguiden Vejledning. Rev. udgave april 2010 KEMIguiden Vejledning Rev udgave april 2010 KEMIguiden Vejledning april 2010 2 Indholdsfortegnelse 1 Indledning 3 2 Arbejdsgange i KemiGuiden 4 21 Oprettelse af en leverandør 4 22 Oprettelse af kategorier

Læs mere

[jobsøgende] sådan gør du... [opret dit CV & jobønsker]

[jobsøgende] sådan gør du... [opret dit CV & jobønsker] [jobsøgende] sådan gør du... [opret dit CV & jobønsker] Opret CV og Jobønsker på jobnet På Jobnets forside Jobnet.dk kan du oprette et CV. Det kan du gøre ved at oprette dig som bruger via linket Mit CV

Læs mere

Udsend boligtilbud til boligsøgende på ventelisten

Udsend boligtilbud til boligsøgende på ventelisten Udsend boligtilbud til boligsøgende på ventelisten 1 Denne vejledning Sådan opretter og udsender du et boligtilbud til boligsøgende på en venteliste. Sidst i dokumentet finder du en vejledning til at svare

Læs mere

KFUM-Spejderne i Danmark Ulveledertræf 25.-27. januar 2008 www.spejdernet.dk/ulveledertræf

KFUM-Spejderne i Danmark Ulveledertræf 25.-27. januar 2008 www.spejdernet.dk/ulveledertræf Ulv (Canis lupus) Ulven er tamhundens stamfader og Europas næststørste rovdyr kun overgået af den brune bjørn. Den bliver 1-1,5 meter lang og dertil kommer halen på 30-50 cm. Den bliver normalt 75-80 cm

Læs mere

Vejledning til jobloggen

Vejledning til jobloggen Vejledning til jobloggen Aktiviteter, opgaver og andre fif Vejledning til frivillig registrering i jobloggen på FOAs A-kasses hjemmeside (www.foa.dk/a-kasse) Brug jobloggen som et aktivt redskab i din

Læs mere

www.munkebjergskolen.odense.dk

www.munkebjergskolen.odense.dk ForældreIntra er del af Munkebjergskolens hjemmeside. Her åbnes op for en større, direkte kontakt mellem skole og hjem. ForældreIntra er et lukket univers, som forældrene skal angive brugernavn og adgangskode

Læs mere

Linket viser jer frem til billedet nedenfor, her skal du blot skrive jeres brugernavn og adgangskode. Indtast din adgangskode her:

Linket viser jer frem til billedet nedenfor, her skal du blot skrive jeres brugernavn og adgangskode. Indtast din adgangskode her: Brugervejledning til håndtering af respondenter til MUS i SurveyXact Indledning Denne manual beskriver, hvordan SurveyXact kan anvendes til forberedelse af MUS. Der tages udgangspunkt i handlinger, den

Læs mere

Vejledning til upload af e-bog via web-formular på www.pubhub.dk

Vejledning til upload af e-bog via web-formular på www.pubhub.dk Vejledning til upload af e-bog via web-formular på www.pubhub.dk For at kunne foretage en dataleverance/upload, skal du have den pågældende e-bog klar i formatet PDF eller epub. Ligeledes skal du have

Læs mere

Hjælp under login på Mit DLR Oktober 2015

Hjælp under login på Mit DLR Oktober 2015 Hjælp under login på Mit DLR Oktober 2015 Jeg logger ind med bruger-id og nøglekort og får at vide, at der ikke er nogen sager i DLR Der er logget ind med forkert NemID. Vi oplever mange henvendelser,

Læs mere

Velkommen til ABC Analyzer! Grundkursusmanual 2 vil introducere dig til ABC Analyzers mere avancerede funktioner, bl.a.:

Velkommen til ABC Analyzer! Grundkursusmanual 2 vil introducere dig til ABC Analyzers mere avancerede funktioner, bl.a.: Velkommen til ABC Analyzer! Grundkursusmanual 2 vil introducere dig til ABC Analyzers mere avancerede funktioner, bl.a.: Kategoriseringer uden ABC-kategorier Krydstabel (trebenede) Beregnede og avancerede

Læs mere

Trine Bjerre & Kirsten Ruth. Oskar i Legeland. Forlaget Den lille Delfin

Trine Bjerre & Kirsten Ruth. Oskar i Legeland. Forlaget Den lille Delfin Trine Bjerre & Kirsten Ruth Oskar i Legeland Forlaget Den lille Delfin Oskar i Legeland af Trine Bjerre & Kirsten Ruth 2014 1. udgave, 1. oplag isbn-13: 978-87-996221-3-9 Tekst & Lay-out: Trine Bjerre

Læs mere

DPSD undervisning. Vejledning til rapport og plan opsætning

DPSD undervisning. Vejledning til rapport og plan opsætning DPSD undervisning Vejledning til rapport og plan opsætning Side 1 Vejledning Oversigt over vejledningerne Opret en simpel listerapport... 2 Opret en krydstabuleringsrapport... 14 Opret en visualiseringsrapport...

Læs mere

Adgang til det digitale ansøgningssystem (DANS)

Adgang til det digitale ansøgningssystem (DANS) Adgang til det digitale ansøgningssystem (DANS) Du finder ansøgningssystemet via linket på siden: http://kandidat.au.dk/optagelse/ansoegning/. Her skal du vælge punktet Sådan søger du og klikke på: Login

Læs mere

Opgavestyring i Elevplan Vejledning. Pædagogisk IT kørekort Mentorforløb

Opgavestyring i Elevplan Vejledning. Pædagogisk IT kørekort Mentorforløb Opgavestyring i Elevplan Vejledning Pædagogisk IT kørekort Mentorforløb 1 Flow Pædagogisk IT kørekort Mentorforløb 2 Opgaver oprettes på et læringselement, eller et udbudt læringselement Opgaver oprettes

Læs mere

Der findes mange ting på nettet, som du kan hente ned på din computer bl.a. billeder, tekstdokumenter og installationsfiler til programmer.

Der findes mange ting på nettet, som du kan hente ned på din computer bl.a. billeder, tekstdokumenter og installationsfiler til programmer. Microsoft browser Edge Når du skal på internettet i Windows 10, bruger du som udgangspunkt programmet Microsoft Edge. Det er en helt ny, simpel internetbrowser med en række spændende funktioner. Du kan

Læs mere

Brug af Archive-funktion i SportIdent (baseret på version 10.3 af SI-programmerne)

Brug af Archive-funktion i SportIdent (baseret på version 10.3 af SI-programmerne) Brug af Archive-funktion i SportIdent (baseret på version 10.3 af SI-programmerne) Formål: Ved at anvende arkiv-funktionen kan arrangørerne ved et træningsløb uden tilmeldinger eller ved åbne baner hurtigt

Læs mere

Vejledning til Jobcenter Planner

Vejledning til Jobcenter Planner Vejledning til Jobcenter Planner Online tilbud og selvbooking Version 1.2 Oprettet den 11. januar 2016 Vejledningen tager udgangspunkt i 2015-4 Spørgsmål eller ønsker til Jobcenter Planner kan rettes til

Læs mere

i x-aksens retning, så fås ). Forskriften for g fås altså ved i forskriften for f at udskifte alle forekomster af x med x x 0

i x-aksens retning, så fås ). Forskriften for g fås altså ved i forskriften for f at udskifte alle forekomster af x med x x 0 BAndengradspolynomier Et polynomium er en funktion på formen f ( ) = an + an + a+ a, hvor ai R kaldes polynomiets koefficienter. Graden af et polynomium er lig med den højeste potens af, for hvilket den

Læs mere

REBECCA HANSSON BABYTEGN. Forlaget BabySigning 3

REBECCA HANSSON BABYTEGN. Forlaget BabySigning 3 REBECCA HANSSON BABYTEGN Forlaget BabySigning 3 FORORD Da jeg i 2009 blev mor for første gang, blev jeg introduceret til babytegn. Vi brugte det flittigt med vores datter, og da hun var et 1 år, brugte

Læs mere

Leif Smidt E-MAIL GODT IGANG MED IPAD - IOS 9

Leif Smidt E-MAIL GODT IGANG MED IPAD - IOS 9 Leif Smidt E-MAIL GODT IGANG MED IPAD - IOS 9 KAPITEL E-MAIL På din hjemmeskærm finder du en app ved navn Mail. Appen er et mailprogram, som kan vise og håndtere dine e-mails på en enkel og overskuelig

Læs mere

Indhold. Vejledning til import af regneark til Outlook 2010

Indhold. Vejledning til import af regneark til Outlook 2010 Indhold Moderniseringsstyrelsens regneark med lønkørslerne hentes... 2 Trinvis indlæsning af regneark i Outlook 2010... 2 Aktiver importfunktion... 2 Udpeg Excel-ark... 4 Importér aftaler... 6 Afslutning...

Læs mere

Ansøgningsportalen. Loginvejledning, tips og hjælp

Ansøgningsportalen. Loginvejledning, tips og hjælp Ansøgningsportalen. Loginvejledning, tips og hjælp Denne vejledning er en hjælp til dig, der skal søge ind på IT-Universitetets kandidatuddannelser. Ansøgning om optagelse foregår digitalt via Ansøgningsportalen.

Læs mere

Modul 1 Skolens netværk, skema og kommunikation i Lectio Efter gennemgangen af dette modul skal du:

Modul 1 Skolens netværk, skema og kommunikation i Lectio Efter gennemgangen af dette modul skal du: Modul 1 Skolens netværk, skema og kommunikation i Lectio Efter gennemgangen af dette modul skal du: 1. Kende til skolens netværk og drev. Specielt dit personlige H-drev 2. Kunne se dit skema og dine lektier

Læs mere

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik Danmarks Tekniske Universitet Løsningsforslag til Øvelse i Immonologisk Bioinformatik Indledning De følgende sider giver en gennemgang af de øverlser i har lavet under jeres besøg på DTU, som en del af

Læs mere

STAMOPLYSNINGER FOR EKSTERNE

STAMOPLYSNINGER FOR EKSTERNE STAMOPLYSNINGER FOR EKSTERNE Denne side udfyldes af en økonomimedarbejder eller en sekretær og distribueres via en kontaktperson på KU. Kontaktperson på KU Sted Institut eller enhed på et fakultet Skriv

Læs mere

Helios er en fællesbetegnelse for en lang række objektiver, der blev produceret på forskellige fabrikker både i Rusland og Japan.

Helios er en fællesbetegnelse for en lang række objektiver, der blev produceret på forskellige fabrikker både i Rusland og Japan. Generelt indtryk Helios er en fællesbetegnelse for en lang række objektiver, der blev produceret på forskellige fabrikker både i Rusland og Japan. 135mm f/2,8 er ikke et stort objektiv. Det vejer og fylder

Læs mere

Guide til din private side på Netstambogen www.lgancce.com

Guide til din private side på Netstambogen www.lgancce.com Guide til din private side på Netstambogen www.lgancce.com Når du slår Netstambogen op på Internettet, får du dette billede: For dem, der ikke er velbevandret i spansk, så kan man vælge den engelske udgave.

Læs mere

Ledningsanlæg på Banedanmarks arealer

Ledningsanlæg på Banedanmarks arealer Ledningsanlæg på Banedanmarks arealer Vejledning til ansøgningsskema Indledning Ansøgningsskemaet er en selvtjekkende formular. Det fungerer på den måde, at du udfylder skemaet, klikker på knappen Tjek

Læs mere

PLANLÆG, SAMMENSÆT OG DEL UNDERVISNINGSMATERIALE. Fremtidens løsning til distribution af digitalt undervisningsmateriale

PLANLÆG, SAMMENSÆT OG DEL UNDERVISNINGSMATERIALE. Fremtidens løsning til distribution af digitalt undervisningsmateriale PLANLÆG, SAMMENSÆT OG DEL UNDERVISNINGSMATERIALE Fremtidens løsning til distribution af digitalt undervisningsmateriale DE VIGTIGSTE SPØRGSMÅL INDEN VI STARTER HVAD ER ET FORLØB I MEEBOOK? Et forløb er

Læs mere

Computerens anatomi. Flashklip for børn

Computerens anatomi. Flashklip for børn Computerens anatomi Flashklip for børn Rapport der beskriver vores arbejde med at fremstille produkter, der kan formidle information om computerens opbygning til børn. Anders og Asger 11-05-2011 Indhold

Læs mere

At lave dit eget spørgeskema

At lave dit eget spørgeskema At lave dit eget spørgeskema 1 Lectio... 2 2. Spørgeskemaer i Google Docs... 2 3. Anvendelighed af din undersøgelse - målbare variable... 4 Repræsentativitet... 4 Fejlkilder: Målefejl - Systematiske fejl-

Læs mere

Kom godt i gang med OneDrive

Kom godt i gang med OneDrive Kom godt i gang med OneDrive Office365 er en mulighed for lærere og elever at bruge en office-pakke på egne enheder - man kan downloade det til brug på pc - mac - tablets og smartphones, i alt op til 5

Læs mere

Find det foto du leder efter

Find det foto du leder efter Find det foto du leder efter - En guide til søgning i POLFOTO POLFOTO Indholdsfortegnelse Om POLFOTO... 3 POLFOTO er til brug i undervisningen... 3 Områder i POLFOTO... 4 Begivenhedskalender... 5 Søgning

Læs mere

1-1 Usability evaluering af den simple udgave

1-1 Usability evaluering af den simple udgave BILAG 1 s. 2 af 19 Bilag 1 1-1 Usability evaluering af den simple udgave...5 1-2 Heuristisk inspektion af den simple udgave...6 1-3 Usability evaluering af den avancerede udgave...8 1-4 Heuristisk inspektion

Læs mere

ØKONOMIOVERBLIK - kom godt i gang

ØKONOMIOVERBLIK - kom godt i gang ØKONOMIOVERBLIK - kom godt i gang ØKONOMIOVERBLIK - KOM GODT I GANG Du skal nu i gang med at udfylde dit økonomioverblik. Det er heldigvis nemt. For at komme godt i gang, anbefaler vi, at du har forberedt

Læs mere

Introduktion. Unifaun Online 29-04-2014

Introduktion. Unifaun Online 29-04-2014 Introduktion Unifaun Online 29-04-2014 2 Indhold 1 Introduktion til Unifaun Online... 3 1.1 Grundlæggende navigering... 3 1.2 Søgning af information... 3 1.3 Indtastning af faste oplysninger... 4 1.4 Din

Læs mere

Kultur og Samfund. Familie og Hverdag. TRIN 1 Opgaver til Hverdagen i billeder

Kultur og Samfund. Familie og Hverdag. TRIN 1 Opgaver til Hverdagen i billeder Familie og Hverdag TRIN 1 Opgaver til Hverdagen i billeder Lad eleverne skrive sætninger om deres familie ved hjælp af ordene herunder. De kan også skrive lidt om deres hverdag. Under temaet Liberias børn

Læs mere

10 trin til en succesfuld Facebook side

10 trin til en succesfuld Facebook side 10 trin til en succesfuld Facebook side Allerførst vil jeg gerne fortælle dig, hvor fedt jeg synes, det er, at du har downloadet denne E-bog. Det lyder måske lidt selvhøjtideligt, men jeg elsker at dele

Læs mere

Vejledning til Blackboards portfolio værktøj

Vejledning til Blackboards portfolio værktøj Vejledning til Blackboards portfolio værktøj Brug denne vejledning, når du skal udarbejde din undervisningsportfolio i Blackboards portfolio værktøj. Ved at følge alle trinene nedenfor får du udarbejdet

Læs mere

Adobe Elements Lektion 2

Adobe Elements Lektion 2 Adobe Elements Lektion 2 Så er det igen tid til at lege lidt med billeder. Jeg går ud fra, at du nu har fået opsat Elements efter de anvisninger du fik i sidste lektion. Start Elements op Gå ind i Edit

Læs mere

GUIDE TIL OPRETTELSE AF ARTIKLER I JOOMLA - FRONTEND

GUIDE TIL OPRETTELSE AF ARTIKLER I JOOMLA - FRONTEND GUIDE TIL OPRETTELSE AF ARTIKLER I JOOMLA - FRONTEND INDHOLDSFORTEGNELSE Login og ændring af adgangskode 2 Oprettelse/redigering af artikler 3 Indsæt billede i en artikel 7 Sæt et link i en artikel 13

Læs mere

Vejledning til CVRselvbetjeningsløsning

Vejledning til CVRselvbetjeningsløsning Vejledning til CVRselvbetjeningsløsning 1. Indledning 2. Abonnement og enkeltudtræk 2.1 Valg af udtrækstype 2.2 Indhold af dit udtræk 2.3 Filtre - Filtrering af dit udtræk 2.3.1 Anvend filtrene på 2.3.2

Læs mere

Vejledning til Jobcenter Planner

Vejledning til Jobcenter Planner Vejledning til Jobcenter Planner Online tilbud og selvbooking Version 2.0 Oprettet den 23. marts 2015 Vejledningen tager udgangspunkt i Jobcenter Planner 2015-1 Indholdsfortegnelse Indhold Indledning...

Læs mere

Hukommelsesleg Flex Online

Hukommelsesleg Flex Online Hukommelsesleg Flex Online Klik og gå direkte til: Systemkrav Brugerlogin Trænermenu Profilmenu Opret ny elevprofil Indstillingsmenu Spilmenu Prøv øvelserne Resultat Dagens resultat 1 2 3 4 5 6 7 8 9 11

Læs mere

Appendiks 1: Om baggrund og teori bag valg af skala

Appendiks 1: Om baggrund og teori bag valg af skala Appendiks 1: Om baggrund og teori bag valg af skala De nationale test gav i 2010 for første gang danske lærere mulighed for at foretage en egentlig måling på en skala af deres elevers præstationer på grundlag

Læs mere

Vejledning: Anvendelse af kuber på SLS-data fra LDV i Excel 2007. Målgruppe: Slutbruger

Vejledning: Anvendelse af kuber på SLS-data fra LDV i Excel 2007. Målgruppe: Slutbruger Vejledning: Anvendelse af kuber på SLS-data fra LDV i Excel 2007. Målgruppe: Slutbruger April 2015 Indholdsfortegnelse Indholdsfortegnelse... 2 1 Indledning... 3 1.1 Metode til anvendelse af kuber med

Læs mere

Beregn gennemsnitlig BMI

Beregn gennemsnitlig BMI Beregn gennemsnitlig BMI I denne vejledning kigges på hvordan man beregner den gennemsnitlige BMI ved operation. Data til dette findes i dataudtræk fra Skema 1A eller dataudtræk med data fra alle skemaer.

Læs mere

Bilag 3: Elevinterview 2 Informant: Elev 2 (E2) Interviewer: Louise (LO) Interviewer 2: Line (LI) Tid: 10:45

Bilag 3: Elevinterview 2 Informant: Elev 2 (E2) Interviewer: Louise (LO) Interviewer 2: Line (LI) Tid: 10:45 Bilag 3: Elevinterview 2 Informant: Elev 2 (E2) Interviewer: Louise (LO) Interviewer 2: Line (LI) Tid: 10:45 LO: Det er egentlig bare en udbygning af de spørgsmål, der var på spørgeskemaet. Det er bare

Læs mere

Analyse af PISA data fra 2006.

Analyse af PISA data fra 2006. Analyse af PISA data fra 2006. Svend Kreiner Indledning PISA undersøgelsernes gennemføres for OECD og de har det primære formål er at undersøge, herunder rangordne, en voksende række af lande med hensyn

Læs mere

Indlæs Beretning på www.deberejstesklub.dk

Indlæs Beretning på www.deberejstesklub.dk Indlæs Beretning på www.deberejstesklub.dk www.deberejstesklub.dk Log ind som medlem. Opret indhold Beretning Nedenstående giver en beskrivelse til oprettelse af en rejseberetning. Visse af felterne er

Læs mere

Manual og Hjælp Skoletasken 2

Manual og Hjælp Skoletasken 2 Manual og Hjælp Skoletasken 2 I Skoletasken 2 - Hjælp Indhold I Introduktion 1 Velkomst 2... 2 2 Systemkrav... 2 3 Installation... 3 4 Skoletasken... 8 II Opsætning 10 1 Systemopsætning... 10 2 Bogopsætning...

Læs mere

3.0 Velkommen til manualen for kanalen Shift 1. 3.1 Introduktion til kanalen 1. 3.2.1 Hvad er et spot? 2. 3.2.2 Opret et nyt spot 2

3.0 Velkommen til manualen for kanalen Shift 1. 3.1 Introduktion til kanalen 1. 3.2.1 Hvad er et spot? 2. 3.2.2 Opret et nyt spot 2 3.0 Velkommen til manualen for kanalen Shift 1 3.1 Introduktion til kanalen 1 3.2 Shift kanalside 1 3.2.1 Hvad er et spot? 2 3.2.2 Opret et nyt spot 2 3.2.3 Aktivt og inaktivt spot 3 3.2.4 Rediger et spot

Læs mere

Instruktion. Total genstart af HTC TC II

Instruktion. Total genstart af HTC TC II Instruktion Total genstart af HTC TC II Total genstart indebærer, at Handi startes fra bunden på samme måde, som første gang den blev startet. Det er aktuelt, hvis Handi skal overtages af en ny bruger,

Læs mere

Dokumentation til Computerspil

Dokumentation til Computerspil Dokumentation til Computerspil Medias Lab Systemudviklingsmodel Problemstilling Vores problemstilling er at vi skal producere et simpelt computerspil, vi skal igennem hele processen dokumentere vores arbejde.

Læs mere

PRINCE2 Foundation Eksamensvejledning til kursister. 1 Din profil på eksamensportalen. 2 Eksamensformål. 3 Eksamensopbygning

PRINCE2 Foundation Eksamensvejledning til kursister. 1 Din profil på eksamensportalen. 2 Eksamensformål. 3 Eksamensopbygning PRINCE2 Foundation Eksamensvejledning til kursister 1 Din profil på eksamensportalen... 1 2 Eksamensformål... 1 3 Eksamensopbygning... 1 4 Spørgsmålstyper... 2 5 Redaktionelle bemærkninger... 2 6 Tidsstyring...

Læs mere

BRUGERMANUAL FOR KLUBKOORDINATORER. Version 2.0

BRUGERMANUAL FOR KLUBKOORDINATORER. Version 2.0 BRUGERMANUAL FOR KLUBKOORDINATORER Version 2.0 Login Du skal vælge den klub som du tilhøre og dernæst indtaste din kode i feltet: Password. Regionsgolf-Danmark Administration Når du er logget ind i system

Læs mere

Genetisk drift og naturlig selektion

Genetisk drift og naturlig selektion Genetisk drift og naturlig selektion Denne vejledning indeholder en gennemgang af simulationsværktøjer tilgængeligt online. Værktøjerne kan bruges til at undersøge effekten af populationsstørrelse på genetisk

Læs mere

Velkommen som DIS-Danmark medlem

Velkommen som DIS-Danmark medlem Velkommen som DIS-Danmark medlem 3. udgave april 2013 DIS-Danmark Indholdsfortegnelse Velkommen som medlem i DIS-Danmark... 4 Hvad er DIS-Danmark?... 4 Generelt... 4 Lokalforeningerne... 4 Medlemsbladet

Læs mere

WebGT 3.0 - Graveansøgning. Brugervejledning. 25. september 2012. Udgave 1.0

WebGT 3.0 - Graveansøgning. Brugervejledning. 25. september 2012. Udgave 1.0 WebGT 3.0 - Graveansøgning Brugervejledning 25. september 2012 Udgave 1.0 Indholdsfortegnelse 1 INDLEDNING... 3 1.1 OPRETTELSE SOM BRUGER... 3 1.2 NOTIFICERINGSMAILS... 4 2 OPBYGNING OG SAGSGANG... 5 2.1

Læs mere

Hjælp til visning af planer i PlansystemDK

Hjælp til visning af planer i PlansystemDK Hjælp til visning af planer i PlansystemDK Spørgsmål og kommentarer rettes til Miljøministeriets hotline: 72544804 eller plansystemdk@blst.dk 1. Indledning - Panorér --hvad gælder for arealet 2. Visning

Læs mere

Kom godt i gang med. Nem Konto. Vejledning til sagsbehandlere. NemKonto hører under Økonomistyrelsen

Kom godt i gang med. Nem Konto. Vejledning til sagsbehandlere. NemKonto hører under Økonomistyrelsen Kom godt i gang med Nem Konto Vejledning til sagsbehandlere NemKonto hører under Økonomistyrelsen Indholdsfortegnelse 1 Introduktion... 2 2 Sådan bruger du NemKonto... 3 2.1 Log på NemKonto... 3 2.2 Signering

Læs mere

Det nye husdyrgodkendelse.dk Sagsbehandlermodulet. 3. Kommunikation med ansøger

Det nye husdyrgodkendelse.dk Sagsbehandlermodulet. 3. Kommunikation med ansøger For at drage nytte af denne manual, skal du have et grundlæggende kendskab til IT systemet husdyrgodkendelse.dk, og kende til Faneblade og Menu med godkendelsesafsnit. Du kan læse om disse ting i manualerne:

Læs mere

SmartAir TS1000. Daglig brug

SmartAir TS1000. Daglig brug SmartAir TS1000 Daglig brug Indhold Brugere... 4 Opret brugere... 4 Brugerliste vinduet... 5 Knapper... 5 Grupper... 6 Søg bruger... 7 Rapport vinduet (brugere)... 7 Døre... 8 Opret døre... 8 Dørliste

Læs mere

Manual til brug af youtube

Manual til brug af youtube Manual til brug af youtube For at kunne bruge din nye video på din hjemmeside, facebook med videre, skal du først uploade den til youtube. Vi gennem gennemgår hele processen her i fire nemme trin. 1. Sådan

Læs mere

Login. www.samsoegades-skole.skoleintra.dk. I denne lille folder beskrives nogle af de vigtigste funktoner i ForældreIntra:

Login. www.samsoegades-skole.skoleintra.dk. I denne lille folder beskrives nogle af de vigtigste funktoner i ForældreIntra: Login I denne lille folder beskrives nogle af de vigtigste funktoner i : Man finder som et link nederst til venstre på skolens offentlige Informationsportal. Adressen er: www.samsoegades-skole.skoleintra.dk

Læs mere

Formler og diagrammer i Excel 2007

Formler og diagrammer i Excel 2007 Formler i Excel Regneudtryk Sådan skal det skrives i Excel Facit 34 23 =34*23 782 47 23 =47/23 2,043478261 27³ =27^3 19683 456 =KVROD(456) 21,3541565 7 145558 =145558^(1/7) 5,464829073 2 3 =2*PI()*3 18,84955592

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Aktivitetsindtastning. Sådan skriver du fx arbejde, sygdom og ferie på dagpengekortet, efterlønskortet etc.

Aktivitetsindtastning. Sådan skriver du fx arbejde, sygdom og ferie på dagpengekortet, efterlønskortet etc. Aktivitetsindtastning Sådan skriver du fx arbejde, sygdom og ferie på dagpengekortet, efterlønskortet etc. Hvad er aktiviteter? Her kan du læse, hvordan du skriver fx arbejdstimer, sygdom og ferie på dit

Læs mere

Novotek Planning Systems A/S 2013 Version 1.0 Jan 2013 ROB-EX 4.2

Novotek Planning Systems A/S 2013 Version 1.0 Jan 2013 ROB-EX 4.2 Version 1.0 Jan 2013 ROB-EX 4.2 Indhold Hovedskærmens opbygning... 2 Tastaturgenveje... 3 Hovedskærmbilleder... 4 Stamdata generelt... 5 Kalender... 6 Opret/rediger kalender... 7 Specifik kalender pr.

Læs mere

Mamut Anlægsregister Introduktion

Mamut Anlægsregister Introduktion Mamut Anlægsregister Introduktion This program includes software developed by Skybound Software (http://www.skybound.ca) Mamut Anlægsregister INDHOLD 1 OM MAMUT ANLÆGSREGISTER... 1 2 INSTALLATION... 2

Læs mere

Kort brugervejledning til Vindsiden

Kort brugervejledning til Vindsiden Kort brugervejledning til Vindsiden Vejledningen beskriver kun de mest anvendte funktioner, og er meget kortfattet. Vejledningen udvides efterhånden, som der sker ændringer i sidens opbygning og/eller

Læs mere

JAR nyhedsbrev fra Region Nordjylland

JAR nyhedsbrev fra Region Nordjylland JAR nyhedsbrev fra Region Nordjylland Juni 2015 I dette nyhedsbrev kan du læse lidt om regionernes undervisningsportal, hvor du bl.a. kan finde information om JAR kurser og øvelsesvejledninger. Du kan

Læs mere

REBECCA HANSSON BABYTEGN. Forlaget BabySigning 3

REBECCA HANSSON BABYTEGN. Forlaget BabySigning 3 REBECCA HANSSON BABYTEGN Forlaget BabySigning 3 FORORD Da jeg i 2009 blev mor for første gang, blev jeg introduceret til babytegn. Vi brugte det flittigt med vores datter, og da hun var et 1 år, brugte

Læs mere

AgiPro brugervejledning.

AgiPro brugervejledning. AgiPro brugervejledning på dansk side 1 AgiPro brugervejledning. Det allerførste du skal gøre er at oprette dig som bruger. KLIK på Register new AgiPro user! AgiPro brugervejledning på dansk side 2 Side

Læs mere

Vejledning til TEA befordring

Vejledning til TEA befordring Vejledning til TEA befordring 1 Tabulex Hotline 4676 1892 eller support@tabulex.dk Indholdsfortegnelse Generelt... 3 Registrering af befordringskriterier... 3 Afstand... 3 Befordringskode... 4 Rute...

Læs mere

Du får personlig hjælp og svar på spørgsmål ved at kontakte podio@dn.dk

Du får personlig hjælp og svar på spørgsmål ved at kontakte podio@dn.dk Dato: 22. maj 2013 Til: DN s lokale afdelinger Sagsbehandler: Kathrine Hegelund, khe@dn.dk, 61 68 80 72. Vejledning til Podio Alle DN s lokale afdelinger har hver sit arbejdsrum i Podio. Her kan man finde

Læs mere

I ØSTEN STIGER SOLEN OP

I ØSTEN STIGER SOLEN OP I ØSTEN STIGER SOLEN OP VL DØGN 2012 -NU MED SOCIALE MEDIER ARRANGERES AF VL23 30. & 31. JANUAR 2012 TIVOLI CONGRESS CENTER Indledning nu med sociale medier VI STÅR MIDT I EN KOMMUNIKATIONSREVOLUTION.

Læs mere

Brugervejledning til InfoLand.dk skabelonen

Brugervejledning til InfoLand.dk skabelonen Indhold Indledning... 4 Første gang... 4 Log ind som Administrator og ændre kodeord... 4 Opret Redaktør (dig selv)... 4 Log ind... 4 Log ind med dit eget brugernavn ( Redaktør )... 4 Log ind som Administrator...

Læs mere

Jeg synes, at eftermiddagen går langsomt. Jeg er så spændt på at det bliver aften og vi skal i biografen. Jeg går op på mit værelse og prøver, om jeg

Jeg synes, at eftermiddagen går langsomt. Jeg er så spændt på at det bliver aften og vi skal i biografen. Jeg går op på mit værelse og prøver, om jeg Jeg synes, at eftermiddagen går langsomt. Jeg er så spændt på at det bliver aften og vi skal i biografen. Jeg går op på mit værelse og prøver, om jeg kan finde Robin Hood-bladet. Mor siger, at jeg roder,

Læs mere

Målere menuen 7.1 7. MÅLERE MENUEN. 7.1 Beregn aflæsninger

Målere menuen 7.1 7. MÅLERE MENUEN. 7.1 Beregn aflæsninger Målere menuen 7.1 7. MÅLERE MENUEN Generelt I denne menu fortages alle de funktioner, som i løbet af året er nødvendige vedr. måleren. Dvs. målerudskiftninger, fremskrivning af målere, udskrivning af aflæsningskort,

Læs mere