Besvarelse til opgave 1 januar 1999 Spm. A: Spm. B:

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Besvarelse til opgave 1 januar 1999 Spm. A: Spm. B:"

Transkript

1 Besvarelse til opgave 1 januar 1999 Spm. A: Vi må lave et genomisk bibliotek i en lambdafag, cosmid, BAC eller YAC plasmid. Til dette vil vi skære det genomiske DNA partielt med Sau3A, så vi får stykker der passer i længden til den valgte vektor. Hvis vi vælger lambda vil vi intro pakke vores lambda med ligeringsblandingen, inficere nogle E. coli celler og få et masse plaque, der udgør vores bibliotek. Dettte bibliotek kan vi screene med vores mærkede cdna, der så vil fungere som probe. De positive kloner vil vi sekventere. Hvis ikke hele genet er med må vi lede i biblioteket igen, evt. med en probe, der ligger i starten af genet. Spm. B: Når vi vil indsætte et DNA fragment et bestemt sted i kromosomet, må vi forlade os på homolog rekombination mellem kromosomet og vores DNA fragment. Det betyder i dette tilfælde, at det fragment, vi vil indsætte i genomet, skal flankeres af DNA sekvenser, som er identisk med noget kromosomalt DNA. Derfor indeholder vores targeting vektor i Figur 2 exon 1 og noget af intron 1 fra musens Hprt lokus på den ene side af det humane haptaglobin gen og noget af musens Intron 2, Exon2 og intron 3 på den anden side. Det HindIII site der normalt ligger i Exon 3 er fjernet (for nemmere at kunne identificere de transgene dyr). Neo kassetten ligger også mellem de flankerende sekvenser. De rigtige rekombinationer vil således erstatte noget af musens Hprt gen med det humane haptaglobin gen. Resultatet af rekombinationen vil se ud som vist nedenfor. 1

2 B E1 R HIII HIII HIII ΔHIII Neo R P HSTK P hhp2 Hprt hhp 2 E1- E7 Hprt I2 E3 I3 E4 I4 E5 I5 E6 I6 o.s.v. Den viste struktur kræver at overskrydsningen er sket efter ΔHIII. M.h.t. integration af plasmidet i figur 3 må resultatet af et dobbelt overkryds se ud som vist nedenfor. E1 E2 E3 E4 E7 E1 E4 E3 P hhp2 P HSTK Neo R Apoa-1 hhp 2 Apoc-3 Spm. C: Det ønskede dobbelte overkryds i Hprt lokus vil inaktivere Hprt genet og derfor gøre cellerne 6-thioguanin resistente. Ved at selektere i medium indeholdende 6-thioguanain kan vi selektere for den ønskede genotype. Spm. D: Fidusen er, at thymidin-kinase-kasetten vil forsvinde, hvis plasmid B integreres ved homolog rekombination. Derved bliver cellerne resistente mod 2

3 gancyklovir. Da neomycin resistens-kasetten samtidig integreres bliver cellerne neomycin resistente. Spm. E: Her har vi to muligheder, PCR eller Southern blot. Vil vi lave PCR må vi lægge en primer i NeoR kasetten som løber ud af Neo kasetten og en primer upstrøms for BamHI sitet. Disse to primere vil kun give et bånd af den rigtige længde hvis integrationen er sket korrekt i den ende. På samme måde kan vi lægge en primer der læser ud af intron 7 i hhp2 genet og en der ligger i exon 4 i Hprt genet og læser ind i starten af genet. (se figurerne for primernes lokalisering). Tilsvarende for integrationen i Apoa1-Apoc-3 locus. En anden mulighed er at lave et Southern blot med de i Figur 1 viste prober. For integrationen i Hprt lokus kan vi skære ES cellernes genom med HindIII. Den anvendte probe vil så give et hybridiseringssignal på 7.1 kb, hvis ES cellen ikke er transgen, men et fragment på = 9.8 hvis ES cellen er transgen og det dobbelte overkryds har fjernet HindIII sitet i exon 3. For integrationen i Apoa1-Apoc-3 locus kan vi skære ES cellens genom med HindIII og anvende den viste probe. Vildtype ES celler vil så give et bånd på 12.0 kb, medens den transgene ES celler vil give et bånd på 3.8 kb + ( )kb = 7.2 kb. Spm. F: 7.1 kb båndet stammer fra vildtype mus, medens 9.8 kb båndet stammer fra transgene mus. Da integrationsstedet er X-kromosomet betyder det at musen i lane 1 er homozygot vildtype, musen i lane 2 er homozygot transgen, musen i lane 3 er homozygot wildtype, medens musen i lane 4 er heterozygot for den transgene allel. 12 kb fragmentet i Figur 5 stammer fra vildtype allellen medens 7.2 kb fragmentet stammer fra den transgene allel. Musen i lane 1 er således homozygot vildtype, musene i lane 2, 3 og 5 er heterozygot transgene medens musene i lane 4 og 6 er homozygot transgene. Spm. G: Det ses at transkiptionen af det humane hhp2 gene er høj i mus hvor integrationen er sket i et DNA område der normalt er transkritionelt aktivt i lever. Det ses også at ekspressione i dette locus er rimelig uafhængig af tilstedeværelse af LPS. Generelt er transkriptionen fra hhp2 promotoren lokaliseret i Hprt lokus lav. Der induceres ikke ret meget transkription af Hp2 og Neo transkriptet er næsten ikke 3

4 tilstede. Mængden af hhp2 transkript fra Hprt lokus er dog nogenlunde den samme som mrna mængden fra musens endogene Hp2 gen. Vi kan også se at Apoc-3 transkriptet er fraværende i den homozygote transgene mus der udtrykker hhp2 fra Apoa-1/Apoc-3 lokus. Dette kunne skyldes interferens fra den stærke transkription af Neo genet. Spm. H: Her kan vi se, at det ikke kun er promotoren, der bestemmer hvor meget transkript, der forefindes i forskellige typer væv. Det er jo det samme reportergen, vi har indkorporeret to forskellige steder i musens genom. Starter vi med Figur B, kan vi se, at transkriptionen fra den leverspecifikke promotor giver den rigtige vævsspecificitet (dog ser ekspressionen lidt for høj ud i tyndtarmen), hvis reporteren er indkorporeret i genomet i et lokus, der normalt er aktivt i leveren. Derimod er der ikke rigtig nogen tydelig vævsafhængig ekspression, når promotoren er integreret i Hprt lokus. Transkriptionen er tilmed meget lav fra Hprt lokus. Vi kan stort set se det sammen for vores neor kasette. Transkriptionen af neo kasetten følger det lokus hvor kasetten er indsat. Så selv om promotoren foran neokassetten er konstitutiv, så udviser den alligevel en vævsspecificitet. Så konklusionen er, at det er DNA strukturen, der bestemmer om en promotor kan transkriberes og promotoren der afgør om den så også bliver det. 4

5 Løsning på opgave 1, november 2004 Spm. A: Her må vi igang med site directed mutagenese. Vi kan anvende overlap extension PCR som angivet i værktøjskassen. Serinen i opgaven kodes af tcg. Opslag i den genetiske kode viser at alanin kan kodes af gcg. Up-primer: 5 atgccggggctaagttgta 3 (Tm = 4 x x 2) = 58 o C Do-primer: 5 ttaatcttcagctttggcttc 3 (Tm = 4 x x 13) = 58 o C Mut-up: 5 tcttagtgaattagcgagacgac 3 (Tm = 4 x x 2 2) = 60 o C Mut-do: 5 gtcgtctcgctaattcactaaga 3 (Tm = 60 o C) Det nukleotid, der skal ændres, er angivet med fed skrift. Vi laver nu PCR på en cdna klone med eif2α med primerne Up-primer + Mut-do og med Do-primer + Mut-up. Lidt af de to PCR produkter blandes samme og der laves PCR med Up-primer + Do-primer. Fragmentet klones og sekventeres. Spm. B: Fordi mus og menneske er tæt på hinanden evolutionært kan vi fremstille et muse-genombibliotek og screene dette med exon 2 fra menneske. En positiv klon vil vi sekventere, og se om vi har fået fat i exon 2 og tilpas meget af de flankerende regioner. Spm. C: Transficere de embryonale stamceller med fragmentet der er vist i Figur 2B. Vi må som altid forlade os på homolog rekombination når vi skal ændre i genomet. Vi kan udnytte at vektoren har en neomycin kasette, hvilket betyder at vi kan selektere for ES-celler der har fået integreret vores DNA fragment fra Figur 2B. For at berige for de homologe rekombinanter, kan vi selektere for gancyklovir resistens, idet homolog rekombination vil fjerne HSV-tk genet. Tilstedeværelse af HSV-tk genet vil nemlig gøre ES-cellerne sensitive overfor gancyklovir. Så i ES-celler med en neomycin resistent og gancyklovir resistent fænotype vil der med stor sansynlighed være foregået homolog rekombination. Spm. D: Ved hjælp af den viste probe, kan vi restriktionsmappe området omkring der hvor den homologe rekombination gerne skulle være sket. Skærer vi DNA fra en vildtype ES-celle, en ES-celle hvor der er sket homolog rekombination og en hvor 5

6 rekombinationen er sket et tilfældigt sted, med HindIII og laver et Southern blot med den i figur 2 viste probe vil vi få følgende fragmenter: Vild type ES: et fragment på = 6.8 kb En korrekt ES-celle: = 6.0 kb En tilfældig integration: vil være magen til vildtype blotte. Hvis vi skar med PstI ville vi få følgende bånd: Vild type ES: = 11.5 kb En korrekt ES-celle: = 10.7 kb En tilfældig integration: som vildtypen. Spm. E: Det kunne være at transkriptionen af neokassetten kunne interferere med ekspressionen af vores eif2α gen (interferere med transkriptionen eller eventuelt med splejsning af RNA). Vi vil jo gerne have at expresssionen af mutant eif2α er den samme som for vildtyp eif2α. Derfor vil man tit krydes den selektive markør ud før ES-cellerne bliver til mus. Spm. F: PCR med de to viste primere vil give et produkt, der ikke kan skæres med MscI, medens produktet med med de viste primere på en korrekt ES-celle vil give 3 bånd, hvis længde vi vil kende, da vi selv har lavet vores vektorer. Spm G: At thapsigargin og leucinsult begge øger mængden af ATF4 protein kraftigt. At koncentrationen af CHOP stiger senere en ATF4 (måske er ATF4 vigtig for ekspressionen af CHOP). At PERK kinasen er essentiel for cellens evne til at respondere på thapsigargin og at GCN2 er essentiel for cellens evne til at respondere på leucinsult. At eif2α proteinmængden er konstant. Spm H: I dette forsøg standses transkriptionen før stresssituationen induceres. Når der således i figuren sker en opregulering af ATF4 proteinkoncentrationen må det betyde at det mrna, der var tilstede før induktion af stress, bliver translateret meget mere end før stress. Det er den eneste mulighed da transkriptionen jo er stoppet. Vi kan også se på northern blottet at ATF4 mrna mængden ikke stiger p.g.a. stress (mrna mængden falder hen i gennem forsøget, da mrna jo henfalder og der ikke 6

7 bliver syntetiseret noget nyt). mrna mængden før stress er høj, men proteinet er helt fraværende. Vi kan se at billedet er nogenlunde det samme, hvad enten vi stresser foldningen i ER eller vi sulter for leucin. Vi kan se at CHOP må være reguleret på transkriptionel niveau, da hverken CHOP RNA eller protein akkumulerer i tilstedeværelse af Actinomycin. Spm. I: Forudsætningen for at cellerne kan blive grønne er, at de har optaget det plasmid, de er transficeret med. Fraktionen af grønne celler i forhold til de blå giver altså transfektionseffektiviteten. Spm. J: For vildtypen kan vi se røde celler når vi har tilsat thapsigargin, som tegn på at CHOP bliver produceret, når vi stresser cellen med thapsigargin. Celler transficeret med ATF4:CD2 giver også røde celler når vi stresser med thapsigargig selv om cellerne mangler den PERK kinase, vi i Figur 3 så var essentiel for dannelse af CHOP. Grunden hertil er, at der ingen regulation er på expressionen af det plasmid der er brugt til transfektion (ATF4:CD2). Når de ubehandlede celler så ikke er røde må det betyde, at ATF4 alene ikke er nok til at inducere CHOP ekspression. Vi kan i de sidste to forsøg se, at ATF4 er essentiel for at kunne opregulere CHOP4, hvilket sammen med data i figur 3 tyder på, at ATF4 er en transkriptionsfaktor. 7

Opgave 1 november 2004

Opgave 1 november 2004 Opgave 1 november 2004 Nedenfor er vist nukleotidsekvensen af cdna kodende for eif2α genet fra mus. Serin nummer 51 (S51) kan fosfoyleres af en eller flere eif2α kinaser. For at undersøge den biologiske

Læs mere

Løsninger til opgaverne den Spm. A: Spm. B Spm. C:

Løsninger til opgaverne den Spm. A: Spm. B Spm. C: Løsninger til opgaverne den 12-9-07 Spm. A: Her er vi i en situation at det eneste der kendes til vores receptor er, at den kan binde en ligand, som vi har til rådighed i en radioaktiv mærket version.

Læs mere

Figur 1: Strukturelt kort over plasmiderne pyeast og pmamal anvendt til undersøgelse af

Figur 1: Strukturelt kort over plasmiderne pyeast og pmamal anvendt til undersøgelse af Opgave 2 juni 1999 DNA rekombination er vigtig for eukaryote celler i forbindelse med meiosen. Samtidig er rekombination mellem fremmed DNA og endogen DNA essentiel i fremstillingen af transgene organismer

Læs mere

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et:

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: F2011-Opgave 1. En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: Forward primer: 5 CC ATG GGT ATG AAG CTT TGC AGC CTT

Læs mere

Besvarelse af opgaverne til den Spm.A: efter TGA TCA Spm. B:

Besvarelse af opgaverne til den Spm.A: efter TGA TCA Spm. B: Besvarelse af opgaverne til den 20-9-06 Spm.A: Her vil vi gerne sætte et relativt lille stykke DNA (FLAG) sammen med et relativt stort stykke (PRB1). Det lille stykke er for lille til at vi kan PCR amplificere

Læs mere

Løsninger til opgaverne den Opgave 2 januar 2003 Spm. 1:

Løsninger til opgaverne den Opgave 2 januar 2003 Spm. 1: Løsninger til opgaverne den 6-9-06 Opgave 2 januar 2003 Spm. 1: Fidusen er her at vi kender den primære struktur af glukoamylasen fra tre forskellige svampe, en ascomycet, en basidiomycet og en zygomycet.

Læs mere

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm)

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm) Opgave 1 Leveren spiller en central rolle i lipid metabolismen og i opretholdelse af lipid homeostasen i hele kroppen. Lipidmetabolismen er fejlreguleret hos blandt andet svært overvægtige personer samt

Læs mere

Spm. B: Hvad viser data i Figur 2?

Spm. B: Hvad viser data i Figur 2? Opgave 1 Kernereceptorer (nuclear receptors) udgør en familie af ligandaktiverede transkriptionsfaktorer, der regulerer transkription af en række gener, som respons på tilstedeværelse af f.eks.lipofile

Læs mere

datp, dctp, dgtp, dttp, [α 32 P]-dCTP urinstofholdig polyacrylamid gel røntgen film

datp, dctp, dgtp, dttp, [α 32 P]-dCTP urinstofholdig polyacrylamid gel røntgen film Opgave 1 Denne opgave omhandler osteoblast differentiering. Osteoblast celler er involveret i opbygning af knoglevæv. Osteoblast celler dannes ud fra såkaldte calvarial celler. For at forstå det molekylære

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

Opgave 1 Spm. A: Spm. B:

Opgave 1 Spm. A: Spm. B: Opgave 1 Familien af TM7 receptorer (receptorer med 7 transmembrane segmenter) udgør ud fra genomsekvensen den største proteinfamile i C. elegans. Det samme må forventes at gælde i pattedyr. Imidlertid

Læs mere

Forsvar mod meldug i byg 8/1-07

Forsvar mod meldug i byg 8/1-07 Forsvar mod meldug i byg 8/1-07 Meldugsvampens angreb på bygplanten aktiverer en række interessante gener der fungerer i reguleringen af plantens forsvar. Modtagelig David B. Collinge, Michael K. Jensen

Læs mere

GAPDH PCR modul Manual

GAPDH PCR modul Manual GAPDH PCR modul Manual Katalog nr. 166-5010EDU explorer.bio-rad.com Kopiering kun tilladt til undervisningsbrug Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

Biologi opgave Opsamling: Cellebiologi (Bioanalytiker modul3)

Biologi opgave Opsamling: Cellebiologi (Bioanalytiker modul3) 1 Delphine Bonneau Biologi opgave Opsamling: Cellebiologi 1-6 Pelle har spist en kæmpe stor kage, og efterfølgende stiger hans blodsukker. Derfor sender kroppen besked til de endokrine kirtler i bugspytkirtlen

Læs mere

August Krogh Building Copenhagen University. Universitetsparken 13 2100 Copenhagen OE PAPedersen@aki.ku.dk

August Krogh Building Copenhagen University. Universitetsparken 13 2100 Copenhagen OE PAPedersen@aki.ku.dk Per Amstrup Pedersen Institute of Molecular Biology August Krogh Building Copenhagen University Universitetsparken 13 2100 Copenhagen OE PAPedersen@aki.ku.dk En genteknologisk værktøjskasse. Version 2007

Læs mere

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 20. maj 2008. Kl. 09.00 14.00 STX081-BIA STUDENTEREKSAMEN MAJ 2008

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 20. maj 2008. Kl. 09.00 14.00 STX081-BIA STUDENTEREKSAMEN MAJ 2008 STUDENTEREKSAMEN MAJ 2008 BIOLOGI A-NIVEAU Tirsdag den 20. maj 2008 NY ORDNING Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX081-BIA Undervisningsministeriet Side

Læs mere

Studieplan Molekylærbiologi Semester 3

Studieplan Molekylærbiologi Semester 3 OMRÅDET FOR SUNDHEDSUDDANNELSER Studieplan Molekylærbiologi Semester 3 Bioanalytikeruddannelsen i Odense Efterår 2017 Semester 3 Indhold 1. Fagets fokus og emner... 3 2. Lektionsplan... 4 3. Litteraturliste...

Læs mere

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner Generne bestemmer Niveau: 8. klasse Varighed: 12 lektioner Præsentation: Generne bestemmer er et forløb om genernes indflydelse på individet. I forløbet kommer vi omkring den eukaryote celle, celledeling,

Læs mere

Differentieret genekspression

Differentieret genekspression Differentieret genekspression Hvordan fås differentieret genekspression udfra samme genrepertoire? Differentieret gentranskription (DNA-methylering, dosage compensation) Selektiv RNA processering i kernen

Læs mere

Genmanipulation i sport Gendoping

Genmanipulation i sport Gendoping Genmanipulation i sport Gendoping Peter Schjerling Copenhagen Muscle Research Centre Gendoping Doping baseret på genmanipulation Misbrug af resultater fra genterapi En fremtidig trussel for sporten? Gendoping

Læs mere

Faktor V Leiden mutation

Faktor V Leiden mutation Faktor V Leiden mutation Formål: finde ud af om individ har mutation i faktor V Leiden gen (missense: arginin glutamin) Materiale: oprens DNA fra leukocytter Metode: PCR med specifikke primere, oprens,

Læs mere

Designer-mus designer-menneske. Ernst-Martin Füchtbauer Institut for Molekylærbiologi og Genetik, Aarhus Universitet

Designer-mus designer-menneske. Ernst-Martin Füchtbauer Institut for Molekylærbiologi og Genetik, Aarhus Universitet Designer-mus designer-menneske Ændring i det menneskelige genom er der et formål? Ernst-Martin Füchtbauer Institut for Molekylærbiologi og Genetik, Aarhus Universitet Tidslinie 1958 Kloning af dyr (frø)

Læs mere

Kromosomer med genet: Genotype (= arveformel): RR Rr rr Fænotype (= fremtoning): Rød Rød Hvid

Kromosomer med genet: Genotype (= arveformel): RR Rr rr Fænotype (= fremtoning): Rød Rød Hvid Kromosomer med genet: R R R r r r Genotype (= arveformel): RR Rr rr Fænotype (= fremtoning): Rød Rød Hvid P-generation: Kønsceller: RR rr Meiose R R r r Befrugtning F 1-generation: Meiose Rr Rr Kønsceller:

Læs mere

Specifik mutation med nålestiksoperation

Specifik mutation med nålestiksoperation Specifik mutation med nålestiksoperation Mutanter af byg er vigtige i forskningen og benyttes også, når der forædles nye sorter til dyrkning. Hidtil har det kun været muligt at inducere mutationer tilfældige

Læs mere

Menneskets væskefaser

Menneskets væskefaser Menneskets væskefaser Mennesket består af ca. 60% væske (vand) Overordnet opdelt i to: Ekstracellulærvæske og intracellulærvæske Ekstracellulærvæske udgør ca. 1/3 Interstitielvæske: Væske der ligger mellem

Læs mere

Struktur og funktion af gener

Struktur og funktion af gener Molekylærbiologi og genetik S4, F2008 f Malene Munk Jørgensen Emne: Struktur og funktion af gener Link: undervisningsplanen for S4-molekylærbiologi og genetik MMJ, VI niversity ollege Bioanalytikeruddannelsen

Læs mere

Bananfluer og nedarvning

Bananfluer og nedarvning Bananfluer og nedarvning Teori: Bananflue-genetik Bananfluens livscyklus Bananfluen, Drosophila melanogaster, har været brugt til at studere genetik i mere end 100 år. Denne diploide organisme har fuldstændig

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

Cisgen byg med bedre fosfatudnyttelse

Cisgen byg med bedre fosfatudnyttelse Cisgen byg med bedre fosfatudnyttelse Seniorforsker Inger Bæksted Holme Aarhus Universitet, Science and Technology, Institut for Molekylærbiologi og Genetik, Afgrødegenetik og Bioteknologi Hypotese Det

Læs mere

TEST 1. Almen Cellebiologi 2004/2005

TEST 1. Almen Cellebiologi 2004/2005 TEST 1 Almen Cellebiologi 2004/2005 Hvilken af følgende udsagn er forkerte? a) kun planteceller har en cellevæg b) planteceller har microtubuli c) planteceller har chloroplaster d) planteceller har actin

Læs mere

Kartoflens genetiske puslespil

Kartoflens genetiske puslespil Kartoflens genetiske puslespil klassisk forædling og ny teknologi Kartoffelforædling lyder umiddelbart som en stilfærdig beskæftigelse, men forædleren skal være beredt på våbenkapløb med en svamp, klar

Læs mere

Caseuge 1.1: Anatomi og fysiologi

Caseuge 1.1: Anatomi og fysiologi Modulplan for modul 1.1, Introduktion til basalfagene, 2017 Vigtigt: Modulplanens læringsmål angiver pensum. I tillæg til læringsmålene for forelæsninger, studiesal, kliniske øvelser og kliniske ophold,

Læs mere

Svarafgivelse af komplicerede genetiske analyser

Svarafgivelse af komplicerede genetiske analyser SOP_24 Svarafgivelse af komplicerede genetiske analyser Initialer Navn Dato Udarbejdet af: TvOH Thomas v. O. Hansen 29. august 2013 Sidst revideret af: BB Birgitte Bertelsen 22. marts 2017 Gennemlæst af:

Læs mere

Fremskridt i forskningen i symbiose mellem bælgplanter og Rhizobium-bakterier

Fremskridt i forskningen i symbiose mellem bælgplanter og Rhizobium-bakterier Fremskridt i forskningen i symbiose mellem bælgplanter og Rhizobium-bakterier Verdens fødevareproduktion ville revolutioneres, hvis man kunne overføre bælgplanters evne til symbiose med kvælstoffikserende

Læs mere

FARVEGENETIK - med fokus på Eurasieren

FARVEGENETIK - med fokus på Eurasieren FARVEGENETIK - med fokus på Eurasieren Helle Friis Proschowsky, dyrlæge Ph.d. Specialkonsulent hos DKK Farvegenetik En smule grundlæggende genetik Farvegenetik generelt Farvegenetik med særligt fokus på

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Navn: Forsøgsvejledning Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA sekvens,

Læs mere

Restriktionsenzymer findes Genkendelsessekvens

Restriktionsenzymer findes Genkendelsessekvens Restriktionsenzymer Skanning Restriktionsenzymer findes i bakterier (forsvarsmekanisme) IKKE i eukaryote celler 3-5 - 5-3 - Restriktionsenzyme Genkendelsessekvens Palindromisk Otto, Anna, radar Madam I

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Forsøgsvejledning Navn: Side 1 af 7 Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA

Læs mere

Anmeldelse af genteknologiske forskningsprojekter samt genteknologisk storskalaforsøg eller produktion

Anmeldelse af genteknologiske forskningsprojekter samt genteknologisk storskalaforsøg eller produktion Anmeldelse af genteknologiske forskningsprojekter samt genteknologisk storskalaforsøg eller produktion Anmeldelse til Arbejdstilsynet efter Arbejdsministeriets bekendtgørelse om genteknolog og arbejdsmiljø

Læs mere

PCR (Polymerase Chain Reaction): Opkopiering af DNA

PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR til at opkopiere bestemte DNA-sekvenser i en prøve er nu en af genteknologiens absolut vigtigste værktøjer. Peter Rugbjerg, Biotech Academy PCR (Polymerase

Læs mere

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer)

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer) Elevvejledning til det Virtuelle Kræftlaboratorium Det Virtuelle Kræftlaboratorium stiller krav til en grundig forståelse af det centrale dogme inden for molekylærbiologien, hvordan DNA oversættes til

Læs mere

MOLEKYLÆR GENETIK - MCAD DEFICIENS - NEONATAL SCREENING

MOLEKYLÆR GENETIK - MCAD DEFICIENS - NEONATAL SCREENING MOLEKYLÆR GENETIK - MCAD DEFICIENS - NEONATAL SCREENING Brage Storstein Andresen Molekylær Medicinsk Forskningsenhed, Skejby Sygehus og Institut for Biokemi og Molekylær Biologi, Syddansk Universitet Nyfødt

Læs mere

Nye og traditionelle metoder i planteforædling. Søren K. Rasmussen Institut for Plante- og Jordbrugsvidenskab, 27. september 2016

Nye og traditionelle metoder i planteforædling. Søren K. Rasmussen Institut for Plante- og Jordbrugsvidenskab, 27. september 2016 Nye og traditionelle metoder i planteforædling Søren K. Rasmussen Institut for Plante- og Jordbrugsvidenskab, 27. september 2016 12-10-2016 2 Traditionel forædling Vælge forældrene Krydse forældrene Selektere

Læs mere

Genekspression. GENEKSPRESSION side 1

Genekspression. GENEKSPRESSION side 1 Genekspression 2006 GENEKSPRESSION side 1 Indholdsfortegnelse Kapitel 1... 3 Proteinsyntese... 3 Regulering af gener i E. coli.... 8 Transskription hos eukaryoter... 14 Eukaryot genregulering... 16 Efterbehandlig

Læs mere

Figur 1: A, nukleotidsekvensen af starten og slutningen af RPB1 genet. Initierings- og terminerings

Figur 1: A, nukleotidsekvensen af starten og slutningen af RPB1 genet. Initierings- og terminerings Opgave 2 juni 2004 Eukaryote celler indeholder 3 forskellige RNA polymeraser. Hver RNA polymerase er ansvarlig for transkription af bestemte klasser af gener. Ud fra mutationsanalyse i bagegær (Saccharomyces

Læs mere

Cellekernen (Nucleus) Sebastian Frische Anatomisk Institut

Cellekernen (Nucleus) Sebastian Frische Anatomisk Institut Cellekernen (Nucleus) Sebastian Frische Anatomisk Institut Cellekernen Cellekernens overordnede struktur kernemembranen/nucleolemma kromatin nucleolus Cellecyklus faser i cellecyklus faser i mitosen Størrelse:

Læs mere

mrna-status Verifikation Ved Promoter Varianter

mrna-status Verifikation Ved Promoter Varianter En bachelorafhandling ved Molekylærgenetisk Diagnostisk Afsnit, Rigshospitalet, København. mrna-status Verifikation Ved Promoter Varianter Afprøvning af en ny metode indenfor functional promotor assays

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Biomarkører ved neurologiske sygdomme. Thomas Christensen

Biomarkører ved neurologiske sygdomme. Thomas Christensen Biomarkører ved neurologiske sygdomme Thomas Christensen Biomarkører ved neurologiske sygdomme Identificere diagnostiske og prognostiske biomarkører for neurologiske sygdomme Biobank oprettet Samarbejde

Læs mere

Gensplejsning af byg uden brug af selektionsgener

Gensplejsning af byg uden brug af selektionsgener Gensplejsning af byg uden brug af selektionsgener Genetisk modificerede planter indeholder som regel gener, som gør planten modstandsdygtig overfor enten et ukrudtsmiddel eller et antibiotikum. Disse gener,

Læs mere

Et eksempel: Blomsterpopulation med to co-dominante gener for kronbladenes farve

Et eksempel: Blomsterpopulation med to co-dominante gener for kronbladenes farve Populationsgenetik I populationsgenetik beskæftiger man sig med at undersøge hyppigheden af forskellige gener samt fordeligen af fænotyper og genotyper i forskellige populationer. For en ordens skyld:

Læs mere

På opdagelse i gernerne

På opdagelse i gernerne På opdagelse i gernerne DNA (molekyle): arvemateriale Alle vore celler er genetisk set identiske DNA: genetiske opskrifter - kogebog for cellerne = genregulering Opskrift på forskellige proteiner Vejledninger

Læs mere

ODONTOLOGISK EMBEDSEKSAMEN

ODONTOLOGISK EMBEDSEKSAMEN ODONTOLOGISK EMBEDSEKSAMEN MEDICINSK GENETIK Mandag den 19. oktober 2009 kl. 9.00-12.00 Indhold: Opgaverne 1-3 side 2-8 Vægtningsliste side 9 Vejledning: Besvarelserne af opgaverne skrives med kuglepen

Læs mere

Dansk resumé for begyndere

Dansk resumé for begyndere Dansk resumé for begyndere Dansk resumé for begyndere Dette afsnit introducerer bakteriel genregulation for enhver uden forudgående kendskab til dette emne. Alle nødvendige, videnskabelige betegnelser

Læs mere

MEDICINSK EMBEDSEKSAMEN

MEDICINSK EMBEDSEKSAMEN MEDICINSK EMBEDSEKSAMEN MEDICINSK GENETIK Mandag den. juni 00 kl. 9.00.00 Indhold: Opgaverne - Side - 7 Vægtningsliste Side 8 Vejledning: Besvarelserne af opgaverne skrives med kuglepen på de udleverede

Læs mere

Nr 1. Fra gen til protein

Nr 1. Fra gen til protein Nr 1 Fra gen til protein Med udgangspunkt i vedlagte illustrationer bedes du besvare følgende: Hvordan er sammenhængen mellem DNA ets nukleotider og proteinets aminosyrer? Beskriv hvad der sker ved henholdsvis

Læs mere

Begreb Forklaring Additiv effekt ADI Alignment Allele gener Anammox Antagonistisk effekt Anti-antistof Antigen Antistof B-celler Bioakkumulering

Begreb Forklaring Additiv effekt ADI Alignment Allele gener Anammox Antagonistisk effekt Anti-antistof Antigen Antistof B-celler Bioakkumulering Biologi fagbegreber Begreb Forklaring Additiv effekt Blandingseffekt når der indgår flere stoffer med hver sin effekt. 1+2=3 ADI Højeste acceptable daglige indtagelse/dosis, som ikke giver helbredsproblemer

Læs mere

Proteiner. Proteiner er molekyler der er opbygget af "aminosyrer",nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde

Proteiner. Proteiner er molekyler der er opbygget af aminosyrer,nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde Proteiner Proteiner er molekyler der er opbygget af "aminosyrer",nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde Der findes ca. 20 aminosyrer i menneskets organisme. Nogle

Læs mere

Almindelig gåsemad. - modelplante nr. 1. planteforskning.dk Modelplanter

Almindelig gåsemad. - modelplante nr. 1. planteforskning.dk Modelplanter Almindelig gåsemad - modelplante nr. 1 En lille enårig plante er blevet yndlingsobjekt for tusindvis af planteforskere verden over. Dens arvemasse er sekventeret, og de fleste af dens gener er identificeret.

Læs mere

Protokol for genetisk bestemmelse af ABO blodtyper

Protokol for genetisk bestemmelse af ABO blodtyper Page1 Udarbejdet i samarbejde mellem: Kåre Lehmann, Annabeth Høgh Petersen, Anne Rusborg Nygaard og Jørn M. Clausen Page2 VIGTIGT: SKIFT PIPETTE SPIDSER/TIPS EFTER HVER GANG!! Så undgår du at forurene

Læs mere

Ansøgning om tilskud i 2017

Ansøgning om tilskud i 2017 Ansøgning om tilskud i 2017 1. Markør-assisteret indkrydsning af brokresistens 2. Ansøger og projektansvarlig a. Navn og adresse: Danespo A/S, Ryttervangen 1, 7323 Give b. CVR-nummer: 10440831 c. web-adresse:

Læs mere

NOD2 ekspression i tarmepitelceller

NOD2 ekspression i tarmepitelceller Roskilde Universitet, Den Naturvidenskabelige Bacheloruddannelse, Hus nr. 14 NOD2 ekspression i tarmepitelceller 2. semesterprojekt - forår 2015 Gruppe 6: Joachim Wittrup Højris Jensen Nicholas Philip

Læs mere

Anvendelse af DNA markører i planteforædlingen

Anvendelse af DNA markører i planteforædlingen Anvendelse af DNA markører i planteforædlingen Forsker Gunter Backes, Afdeling for Planteforskning, Forskningscentret Risø DNA-markører på kontaktfladen mellem molekylær genetik og klassisk planteforædling

Læs mere

Elevvejledning pglo transformation

Elevvejledning pglo transformation Introduktion til transformation Elevvejledning pglo transformation I denne øvelse skal du lære fremgangsmåden ved genetisk transformation. Husk på, at et gen er et stykke DNA, der indeholder informationer

Læs mere

Epigenetik Arv er andet end gener

Epigenetik Arv er andet end gener Epigenetik Arv er andet end gener Indhold Indledning Afsnit1: Epigenetik og DNA Afsnit 2: DNA, nukleosomer og kromatin Afsnit 3: Epigenetik og celledifferentiering Afsnit 4: Genetisk ens individer kan

Læs mere

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008 STUDENTEREKSAMEN AUGUST 2008 BIOLOGI A-NIVEAU Tirsdag den 19. august 2008 NY ORDNING Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX082-BIA Undervisningsministeriet

Læs mere

DAMOUN s GENETIK-Kompendium

DAMOUN s GENETIK-Kompendium DAMOUN s GENETIK-Kompendium DAMOUN S GENETIK-KOMPENDIUM 1 Indledning 5 Monogene egenskabers arvegange 5 Redegøre for Mendels 1. og 2. lov 5 Definere gen, locus, allel, multiple alleler, homozygoti, heterozygoti

Læs mere

Forbedring af næringsværdien af kassava

Forbedring af næringsværdien af kassava Forbedring af næringsværdien af kassava Kirsten Jørgensen, Susanne Jensen, Evy Olsen, Charlotte Sørensen, Rubini i Kannangara and Birger Lindberg Møller. Slide 1 Kassava er den tredie vigtigste afgrøde

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 16 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Patterns of Single-Gene Inheritance

Patterns of Single-Gene Inheritance Patterns of Single-Gene Inheritance Mendels 1. lov: hvis en mand er heterozygot, Aa, vil halvdelen af sædcellerne indeholde A, halvdelen a. hvis en kvinde er heterozygot, vil halvdelen af ægcellerne ligeledes

Læs mere

Erik Brandt & Michael Brun Andersen Noter til Genetik - 2003 Indholdsfortegnelse 1. Monogene egenskabers arvegange 2 2. Mutationer

Erik Brandt & Michael Brun Andersen Noter til Genetik - 2003 Indholdsfortegnelse 1. Monogene egenskabers arvegange 2 2. Mutationer Indholdsfortegnelse 1. Monogene egenskabers arvegange 2 2. Mutationer 12 3. Molekylær genetik, normale gener, sygdomsgener 16 4. Geners funktion 21 5. Genetisk kobling og genkortlægning 23 6. Cytogenetik

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

OPGAVESAMLING i Medicinsk Genetik Juni 2004

OPGAVESAMLING i Medicinsk Genetik Juni 2004 OPGAVESAMLNG i Medicinsk Genetik Juni 004. En pose indeholder hvide og sorte kugler. En anden pose indeholder hvide og 4 sorte. A. Hvis én kugle udtages af hver pose, hvad er da sandsynligheden for at

Læs mere

Gentest. Genetisk testning

Gentest. Genetisk testning enetisk testning entest Af Thomas J. orydon og Thomas. Jensen Der bliver flere og flere tilbud om gentestning både kommercielt og til klinisk brug. Patienterne efterspørger allerede nu vores råd, når det

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 8. august 2005 kl. 9.00-14.00

BIOLOGI HØJT NIVEAU. Mandag den 8. august 2005 kl. 9.00-14.00 STUDETEREKSAME AUGUST 2005 2005-6-2 BIOLOGI ØJT IVEAU Mandag den 8. august 2005 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares. STORE

Læs mere

Udarbejdet af Anna-Alexandra Grube Hoppe

Udarbejdet af Anna-Alexandra Grube Hoppe METODER - BIOKEMI For medicinstuderende - Panuminstituttet UDARBEJDET AF ANNA-ALEXANDRA GRUBE HOPPE RESTRIKTIONSENZYM ANALYSE (E: 329-330) Restriktionsenzym analyse er en metode, der bruges til at kortlægge

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Biomarkører. Lars P. Nielsen Professor, overlæge Speciallæge i klinisk mikrobiologi, Statens Serum Ins>tut, Biomarkørlaboratoriet. LPN@ssi.

Biomarkører. Lars P. Nielsen Professor, overlæge Speciallæge i klinisk mikrobiologi, Statens Serum Ins>tut, Biomarkørlaboratoriet. LPN@ssi. Biomarkører Lars P. Nielsen Professor, overlæge Speciallæge i klinisk mikrobiologi, Statens Serum Ins>tut, Biomarkørlaboratoriet. LPN@ssi.dk Biomarkører Molekyler, som afspejler forekomst og udvikling

Læs mere

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares 2stx111-BIO/A-27052011 Fredag den 27. maj 2011 kl. 9.00-14.00 Side 1 af 8 sider Opgave 1. Pig City På figur

Læs mere

Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport

Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport Projektperiode april december 2012 Deltagere Andreas Blennow (projektleder), Susanne L. Jensen (PhD studerende), Lisbeth

Læs mere

Genhæmning: et overblik

Genhæmning: et overblik Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Genhæmning tager et målrettet skridt fremad Målrettet hæmning af det mutante Huntington's chorea-gen,

Læs mere

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande Foto Finn Sivebæk 1 Historien Anvendelse af genetisk viden i forvaltning i DK 1994 Hansen et al. 1993 -? Nielsen et

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 13 Danmarks Tekniske Universitet Skriftlig prøve, den 22/2-2013 Kursus navn: Introduktion til SystemBiologi Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle opgaver. Kursusansvarlig

Læs mere

Hvor kommer du fra? Hvordan kan vi bruge data fra projektet i undervisningssammenhæng?

Hvor kommer du fra? Hvordan kan vi bruge data fra projektet i undervisningssammenhæng? Hvor kommer du fra Hvordan kan vi bruge data fra projektet i undervisningssammenhæng Slutkonference ulaen på arhus Universitet, d. 31 marts 2014 Frank Grønlund Jørgensen Ph.d. i biologi fra U med fokus

Læs mere

Definitioner på vigtige genetiske begreber

Definitioner på vigtige genetiske begreber Definitioner på vigtige genetiske begreber Emne Acrocentrisk Allel heterogenitet Allel Allel-hyppighed Alternativ splejsning Aneuploidi Anticipation Definition/forklaring Kromosom, hvor centromeret er

Læs mere

ESTUDIO GENETICO COLOR DE CAPA

ESTUDIO GENETICO COLOR DE CAPA ESTUDIO GENETICO COLOR DE CAPA Forklaring af resultatet på en farvegentest Dette er et skriv på dansk med det formål at gøre det nemmere for den danske modtager af ESTUDIO GENETICO COLOR DE CAPA at forstå

Læs mere

Hvad kan knurhår og haler fortælle os om HS?

Hvad kan knurhår og haler fortælle os om HS? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Mus eller mand: brug af dyremodeller til at studere Huntingtons Sygdom Dyremodeller for HS: hvad

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

FARVEGENETIK - med fokus på coton de tulear

FARVEGENETIK - med fokus på coton de tulear FARVEGENETIK - med fokus på coton de tulear Helle Friis Proschowsky, dyrlæge Ph.d. Specialkonsulent hos Dansk Kennel Klub 1 Farvegenetik Grundlæggende farvegenetik delvist fra DKK s modulkursus Særligt

Læs mere

BIOLOGI OLYMPIADE 2006

BIOLOGI OLYMPIADE 2006 BIOLOGI OLYMPIADE 2006 Onsdag 11. januar 2006 Indledende runde Varighed: 90 minutter. Hjælpemidler: Kun lommeregner Husk at svare på alle 30 opgaver. Skriv dine svar på det vedlagte svarark 1. Forskellige

Læs mere

MODERNE METAGENOMANALYSER MIKROBIEL NEDBRYDNING AF MILJØFREMMEDE STOFFER I JORD OG GRUNDVAND

MODERNE METAGENOMANALYSER MIKROBIEL NEDBRYDNING AF MILJØFREMMEDE STOFFER I JORD OG GRUNDVAND AARHUS UNIVERSITY DEPARTMENT OF ENVIRONMENTAL SCIENCE ENVIRONMENTAL MICROBIAL GENOMICS GROUP MODERNE METAGENOMANALYSER MIKROBIEL NEDBRYDNING AF MILJØFREMMEDE STOFFER I JORD OG GRUNDVAND Aarhus Universitet,

Læs mere

ANATOMI for tandlægestuderende. Henrik Løvschall Anatomisk afsnit Afd. for Tandsygdomslære Odontologisk Institut Århus Universitet

ANATOMI for tandlægestuderende. Henrik Løvschall Anatomisk afsnit Afd. for Tandsygdomslære Odontologisk Institut Århus Universitet ANATOMI for tandlægestuderende Henrik Løvschall Anatomisk afsnit Afd. for Tandsygdomslære Odontologisk Institut Århus Universitet CELLEBIOLOGI celleform kubisk celle pladeformet celle prismatisk celle

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2015 Institution Voksenuddannelsescenter Frederiksberg Uddannelse Fag og niveau Lærer(e) Hold STX

Læs mere

11. nationale biologiolympiade 2015. Tirsdag den 11. november 2014 Varighed: 90 minutter

11. nationale biologiolympiade 2015. Tirsdag den 11. november 2014 Varighed: 90 minutter 11. nationale biologiolympiade 2015 Tirsdag den 11. november 2014 Varighed: 90 minutter Opgaverne besvares direkte på svararket! Uden hjælpemidler! Husk at overføre alle svar til svararket! Kun svararket

Læs mere

HOXA9 og CDX2 i relation til leukæmi

HOXA9 og CDX2 i relation til leukæmi HOXA9 og CDX2 i relation til leukæmi Gruppe 5 Kristina Berg, Mathilde Schmidt, Ninette Jensen, Sabrina Wielsøe & Sophie Tolstrup 2. Semesterprojekt, Forår 2013 Roskilde Universitet, Nat. Bach, 2. semester,

Læs mere