DNA-analyser af odderekskrementer fra Sjælland

Størrelse: px
Starte visningen fra side:

Download "DNA-analyser af odderekskrementer fra Sjælland"

Transkript

1 DNA-analyser af odderekskrementer fra Sjælland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. juli 2016 Liselotte Wesley Andersen, Bjarne Søgaard & Aksel Bo Madsen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 13 Faglig kommentering: Morten Elmeros Kvalitetssikring, centret: Jesper R. Fredshavn AARHUS AU UNIVERSITET DCE NATIONALT CENTER FOR MILJØ OG ENERGI Tel.:

2 Indhold Baggrund 3 2. Svar på spørgsmål 3 Bilag 1. 5 Bilag 2. 8 Bilag

3 Baggrund Naturstyrelsen (NST) har i af 17. juni og 22. juni 2016 anmodet Nationalt Center for Miljø og Energi (DCE) om svar på følgende: I 2006 analyserede DCE 25 formodede odderekskrementer indsamlet på Sjælland af observatører fra Danmarks Naturfredningsforening (DN). DCE fandt odder-dna i 8 af disse prøver. I forbindelse med DCE s gennemgang og validering af DNA-analyser for ulv, har Naturstyrelsen fået behov for at rejse spørgsmål til DCE s DNAanalyser for odder. DCE har overfor styrelsen oplyst, at DCE til artsbestemmelse af ulv har benyttet en analysemetode hvor DNA opformeres (omtalt som metode 3 i tidligere korrespondancer mellem Naturstyrelsen og DCE). NST anfører desuden, at DCE efterfølgende har trukket resultaterne af denne metode tilbage, således at art- og individbestemmelsen til ulv udelukkende bygger på andre metoder. På den baggrund har NST stillet følgende spørgsmål: 1. Anvendte DCE i 2006 metode 3 (samme metode som nu er trukket tilbage ifm. artsbestemmelse for ulv) til at artsbestemme odder ved fundet af odder-dna i 2006? 2. Anvendte det hollandske analyseinstitut som senere bekræftede DCE s fund af odder i de 8 prøver også metode 3 (samme metode som nu er trukket tilbage ifm. artsbestemmelse for ulv)? 3. Findes de fysiske odderekskrementer indsamlet på Sjælland i 2006 stadig (i givet fald hvor?), og vil det være muligt at få dem analyseret igen (med anden metode)? 4. Hvilken videnskabelig værdi tillægger DCE i dag resultaterne af de analyserede odderekskrementer, indsamlet på Sjælland i 2006? 5. Findes der stadig DNA-sekvenser fra DCE s 8 positive odder prøver fra 2006 samt DNA-sekvenser fra det hollandske analyseinstitut som senere bekræftede DCE s fund? 2. Svar på spørgsmål Ad 1. DCE benyttede ikke metode 3 til at artsbestemme odder. Til analyse af mulige odderekskrementer, der blev udført i april 2007, blev det ønskede DNAstykke opformeret ved hjælp af den samme PCR-analyse som benyttes af bl.a. Senckenberg til analyse af ulve-dna. Ad. 2 Det hollandske analyseinstitut, Alterra, benyttede metode 3. For at verificere resultaterne af fund af odder på Sjælland blev det resterende materiale fra 10 ekskrementer sendt til Alterra i Holland. Af disse ekstraherede Alterra DNA fra 8 prøver. I løbet af efteråret 2007 og foråret 2008 blev den semi-nestede PCR-metode (metode 3) til artsbestemmelse af odder udviklet i det danske laboratorium. En protokol for denne PCR-metode blev sendt med prøverne til Alterra, der benyttede denne metode til at fastslå, om der var odder-dna i prøverne. Resultatet af den hollandske analyse viste 6 odder-sekvenser, men det var kun muligt at identificere fem af prøvenumrene. Derfor er den sidste odder-sekvens fra det hollandske laboratorium udeladt. 3

4 I det tekniske notat (Bilag 1) er angivet hvilke prøver, der blev bestemt til odder og med hvilken sikkerhed. Baserækkefølgen i sekvenserne fra det hollandske laboratorium er i overensstemmelse med de danske DNA-fund af odder på Sjælland. Ad. 3 Ekskrementerne forefindes ikke længere i fysisk form. Ad. 4 DCE betragter DNA resultaterne fra de oprindelige analyser i 2007 som bevis for at der har været odder på Sjælland i Ad. 5. DNA sekvenserne fra de 8 ekskrementer, som DCE identificerede som odder, samt sekvenserne som det hollandske laboratorium identificerede som odder, er vedhæftet (Bilag 2 & 3). 4

5 Bilag 1. Danmarks Miljøundersøgelser Aarhus Universitet Afd. for Vildtbiologi og Biodiversitet Teknisk Notat, d. 21/05//08 Analyse af formodede odderekskrementer indsamlet på Vestsjælland Liselotte Wesley Andersen, seniorforsker, Ph.D, populationsgenetiker Afdeling for Vildtbiologi og Biodiversitet, Danmarks Miljøundersøgelser, Århus Universitet, Grenåvej 12, 8410 Rønde Formål Projektets formål er at undersøge hvorvidt odderen Lutra lutra stadig forekommer i Vestsjælland. Projektet blev udført i samarbejde med Danmarks Naturfredningsforening (DN), der iværksatte Projekt Odder i 2006 (http://www.dn.dk/sw46976.asp). Som et led i Projekt Odder blev der indsamlet formodede odderekskrementer langs udvalgte indsamlingsruter langs vandløb i Vestsjælland. Materialer og metoder Danmarks Miljøundersøgelser (DMU) har modtaget 25 ekskrementer indsamlet af DN til analyse. Analyserne blev udført som blindtest sammen med ca. 200 andre ekskrementer, der var indsamlet på forskellige lokaliteter i Jylland som en del af en evaluering af kvaliteten af standardmetoden til overvågning af odder. Prøvenumrene på ekskrementerne var randomiseret af DN, så det var ukendt for DMU, hvorfra i landet det enkelte ekskrement stammede. DNA-analyse af det samlede materiale Ekskrementerne blev analyseret på Institut for Genetik og Bioteknologi, Århus Universitet og DMU s, Århus Universitets DNA-laboratorium i Silkeborg. DNA blev ekstraheret fra ekskrementerne ved hjælp af DNA-stoolkit fra OMEGA i et laboratorium, hvor der ikke tidligere er arbejdet med odderprøver. Ligeledes blev DNA-ekstraktion og den efterfølgende opformering af den genetiske markør udført i to forskellige laboratorier, hvorfor kontaminering kan udelukkes. Efterfølgende blev prøverne artsbestemt ved hjælp af en genetisk markør (Cytochrom B) på mitochondriel DNA, der kan benyttes til at artsbestemme ilder, mink og odder, og som samtidig har en basepar længde på ca. 180bp. DNA ekstraheret fra ekskrementer er meget nedbrudt. Derfor er det vigtigt at DNA-fragmentet, der benyttes til identifikationen, ikke er for langt, så der er en højere sandsynlighed for at fragmentet findes i det ekstraherede DNA. Selve metoden er baseret på en opformering af DNA-fragmentet på 180bp, hvilket foregår ved hjælp af PCR (polymerase chain reaction), der er en metode som efterligner cellens eget reparationssystem ved at benytte enzymer, nuklotider og DNA-stykker. Det er derfor vigtigt, at det kan verificeres hvilken art DNA et kommer fra, det vil sige at man kan påvise at opformeringen af DNA-fragmentet har virket. Et negativt resultat, dvs. en manglende opformering af DNA-fragmentet, kan forekomme enten fordi metoden ikke har virket, eller fordi prøven ikke er en odder. Når opformeringen var positiv blev DNA-fragmentet sekventeret på et sekventeringsmaskine. 5

6 Den fundne sekvens blev analyseret ved at søge efter den samme sekvens i GenBank (http://www.ncbi.nlm.nih.gov/genbank/index.html). GenBank er en international database, som indeholder sekvenser fra både dyre- og plantearter. Et match mellem den fundne DNA-sekvens i prøven og referencen i databasen blev accepteret, når den pågældende sekvens fra prøven havde fra % overensstemmelse med den mest sandsynlige art, der blev fundet i databasen. Da sekvenserne var korte, blev sekvenserne editerede. Det betyder at den længste, læsbare sekvens, blev udvalgt efter kriterierne: sekvensen ikke var dobbelt og baserne var tydelige at læse. Dernæst blev sekvensen sammenlignet med sekvenserne i den internationale database, GenBank. Resultater Tabel 1 angiver, hvor mange Lutra lutra-dna-sekvenser der blev observeret blandt de 10 første sekvenser med det bedste match, som GenBank foreslog. Da den fundne sekvens ligger på Cytochrom B genet i mitochondriet, som er et gen der er bevaret gennem millioner af år på tværs af taxa på grund af dets funktion i det respiratoriske system, er det ikke uventet, at arter, der ikke er medlemmer af Carnivor-ordenen, kan have sekvenser, der ligner den fundne sekvens. De fundne positive odder-ekskrementer blev sendt til et hollandsk laboratorium for at verificere resultaterne. Der blev sendt 10 prøver i alt, hvoriblandt der var to prøver som ikke var oddere. Det hollandske laboratorium blev ikke oplyst om identiteten af de tilsendte prøver. Det hollandske laboratorium kunne ekstrahere DNA fra 8 af de 10 tilsendte prøver. Syv blev sekventeret, hvoraf 5 prøver blev identificeret som oddere, og de sidste to som mink og ræv, selv samme prøver som DMU laboratoriet fandt henholdsvis mink og en dårlig sekvens, der ikke var odder i. Resultaterne af de 5 odder-prøver er givet i tabel 1. Konklusion I DMU s DNA-laboratorium blev der med sikkerhed fundet DNA fra odder, Lutra lutra, i otte af de 25 indsamlede ekskrementer, som DMU har modtaget fra DN fra undersøgelsen i Vestsjælland. Prøve 1131 blev betragtet som usikker p.g.a. dårlig kvalitet, men det hollandske laboratorium identificerede prøven som odder, hvilket betyder at der er identificeret 8 odderekskrementer. Prøverne er efterfølgende blevet identificeret til at være indsamlet ved Nedre Halleby Å, Øvre Halelby Å, Bregninge Å og flere steder i Åmosen. 6

7 Tabel 1 Prøve 1129DK 1129NL 1131DK 1131NL 1132DK 1135DK 1135NL A M/N % Art M/N % Art M/N % Art M/N % Art M/N % Art M/N % Art % Art 1 75/78 96 LL 130/ LL 36/40 90 LP 131/ LL 38/40 95 LP 41/42 97 LL 81/84 96 LL 2 75/78 96 LL 130/ LL 35/40 87 LL 131/ LL 38/41 92 LL 41/42 97 LL 81/84 96 LL 3 75/78 96 LL 130/ LL 33/34 91 IS 131/ LL 38/41 92 LL 41/42 97 LL 81/84 96 LL 4 75/78 96 LL 130/ LL 35/40 87 LL 131/ LL 38/41 92 LL 41/42 97 LL 81/84 96 LL 5 75/78 96 LL 130/ LL 35/40 87 LL 131/ LL 38/41 92 LL 41/42 97 LL 81/84 96 LL 6 75/78 96 LL 130/ LL 35/40 87 LL 130/ LL 38/41 92 LL 41/42 97 LL 81/84 96 LL 7 75/79 94 LL 129/ LL 35/40 87 LL 130/ LL 38/41 92 LL 41/42 97 RHSP 80/84 95 LL 8 75/79 94 LL 129/ LL 35/40 87 LF 130/ LL 38/41 92 LL 41/42 97 LL 80/84 95 LL 9 69/75 92 LP 125/ LS 35/40 87 LL 126/ LS 37/40 92 IS 41/42 97 LL 78/84 92 LP 10 70/78 89 MF 124/ LP 35/40 87 LL 129/ LP 37/40 92 LLO 37/ VP 75/80 93 LPE Prøve 1138DK 1140DK 1140NL 1147DK 1148DK 1148NL A M/N % Art M/N % Art M/N % Art M/N % Art M/N % Art M/N % Art 1 121/ LL 78/ LL 102/ LL 38/41 92 LL 37/39 94 LL 134/ LL 2 121/ LL 78/ LL 102/ LL 38/41 92 LL 37/39 94 LL 134/ LL 3 121/ LL 78/ LL 102/ LL 38/41 92 LL 37/39 94 LL 134/ LL 4 121/ LL 78/ LL 102/ LL 38/41 92 LL 37/39 94 LL 134/ LL 5 121/ LL 78/ LL 102/ LL 38/41 92 LL 37/39 94 LL 134/ LL 6 121/ LL 78/ LL 102/ LL 38/41 92 LL 37/39 94 LL 134/ LL 7 120/ LL 78/ LL 102/ LL 38/41 92 LL 37/39 94 LL 133/ LL 8 120/ LL 77/78 99 LL 101/ LL 37/40 92 LP 37/39 94 LL 133/ LL 9 111/ MZ 74/77 96 PM 98/ LS 37/40 92 LP 27/28 96 MC 129/ LS / MZ 74/77 96 PM 98/ LP 36/40 90 IS 27/28 96 AC 128/ LP DK= resultat opnået i DMU's DNA-laboratorium NL= resultat opnået for den samme prøve i et hollandsk laboratorium A= Arts-rækkefølge, der angiver hvilken arts-sekvens der ligner mest den ukendte sekvens, baseret dels på sekvensens længde og antal base-match. M= Antal base-match i den fundne sekvens N= Antal baser i den ukendte sekvens, der er sammenlignet med de kendte sekvenser i GenBank udført af søge-algoritmen i databasen. AC= Akodon cursor LS = Lutra sumatra IS= Ictonyx striatus MC= Megadontomys cryophilus LF= Lontra felina MF= Martes Fiona LL= Lutra lutra MZ=Martes zibellina LLO=Lontra longicaudis PM= Peromyscus maniculatus LP = Lontra provocax RHSP= Rhipidomys sp LPE = Lutrogale perspicillata VP= Vormela peregusna 7

8 Bilag CCATATTCTTCATCTGCCTGTTCCTACATGAAGGGCGCGGCCTGTACTACGGATCTTATATATTCCCCGAAACATGAA > gb EF Lutra lutra isolate Ll28m0304 cytb gene, complete sequence; and cytochrome b gene, complete cds; mitochondrial Length=1140 Score = 127 bits (140), Expect = 4e-27 Identities = 75/78 (96%), Gaps = 0/78 (0%) Strand=Plus/Minus 1131 GGYCTGTACTACGGATCYTATATATTCCCCRAAACATRAA > >gb DQ Lontra provocax cytochrome b gene, partial cds; mitochondrial Length=671 Score = 68.4 bits (32), Expect = 1e-09 Identities = 36/40 (90%), Gaps = 0/40 (0%) Strand=Plus/Plus 8

9 1132 CGGCCTGTACTACGGATCYTATATATTCCCCRAAACATGAA gb DQ Lontra provocax cytochrome b gene, partial cds; mitochondrial Length=671 Score = 74.2 bits (36), Expect = 2e-11 Identities = 38/40 (95%), Gaps = 0/40 (0%) Strand=Plus/Plus 1135 GAGAAGGCTGTGGTTGTGTCTGATGTATAGTGTATGGCTAAA >emb AJ LLU Lutra lutra mitochondrial partial cytb gene for cytochrome b, isolate m355 Length=402 Score = 75.8 bits (38), Expect = 7e-12 Identities = 41/42 (97%), Gaps = 0/42 (0%) Strand=Plus/Minus 9

10 1138 ACGCACACATCTGCCGAGACGTCAACTACGGCTGGATTATCCGATATATACAC- CATATTCTTCATCTGCCTGTTCCTACATCGCGGCCTGTACTACGGATCTTATATATTCCCCGAAACATGAA >emb AJ LLU Lutra lutra mitochondrial partial cytb gene for cytochrome b, isolate m217 Length=402 Score = 169 bits (186), Expect = 3e-39 Identities = 121/143 (84%), Gaps = 20/143 (13%) Strand=Plus/Plus 1140 CCAGCCGTAGTTGACGTCTCGGCAGATGTGTGCGACTGATGAGAAGGCTGTGGTTGTGTCTGATGTGTAGTGTATGGCA >emb AJ LLU Lutra lutra mitochondrial partial cytb gene for cytochrome b, isolate m355 Length=402 Score = 141 bits (156), Expect = 2e-31 Identities = 78/78 (100%), Gaps = 0/78 (0%) Strand=Plus/Minus 10

11 1147 CGGCCTGTACTACGGATCYTATATATTCCCMRAAACATGAA >gb DQ Lontra provocax cytochrome b gene, partial cds; mitochondrial Length=671 Score = 71.3 bits (34), Expect = 2e-10 Identities = 37/40 (92%), Gaps = 0/40 (0%) Strand=Plus/Plus 1148 AKGAGAAGGCTGTTGGTTGTGTCTGATGTRTAGTGTATGGCA >emb AJ LLU Lutra lutra mitochondrial partial cytb gene for cytochrome b, isolate m355 Length=402 Score = 59.8 bits (29), Expect = 5e-07 Identities = 37/39 (94%), Gaps = 1/39 (2%) Strand=Plus/Minus 11

12 Bilag 3. >1129_T _A19_040.ab ABI trimmed TGCCGAGACGTCACTACGGCTGGATTATCCGATACATACACGCAAACGGA_ GCCTCCATATTCTTCATCTGCCTGTTCCTACATGTAGGACGCGGCCTGTA CTACGGATCTTATATATTCCCCGAAACATGA #Lutra lutra mitochondrial gene for cytochrome b, partial cds, strain: A line >1131_T _C19_039.ab ABI trimmed CCACTCTGCCGAACGTCACTACGGCTGGATTATCCGATACATACACGCAA ACGGAGCCTCCATATTCTTCATCTGCCTGTTCCTACATGTAGGACGCGGC CTGTACTACGGATCTTATATATTCCCCGAAACATGA #Lutra lutra mitochondrial gene for cytochrome b, partial cds, strain: A line >1140_T _E19_038.ab ABI trimmed GACGAGAGTTACTACTACTGGAATATCCGATACATACACGCAAACGGAGA CTCCATATTCTTCATCTGCCTGTTCCTACATGTAGGACGCGGCCTGTACT ACGGATCTTATATATTCCCCGAAACATGAACCGCACCGAGACAGGGGCCC AGGGCAAAGATTTCCCCTAACGAACCGAACATAACCCGTGTTCGGCTGAT AAGACCAGGAGCGCGAATAATGAGAGACAACTACTTCACCCTCTGTGCAG ACATAAAGCGGCGAAAGCACGCGTCACGCATGCAGACACACAAAAACGAA CAGGTCAAAGAAGATAAGAATCAGTAGATAACAACAAACGACCAAATAAG CCTTATACTGTACAGCAGAAGCACCGACTTCACAGCCAGCCGCCCGCTTA CTATATAATAGAATTACGCCACAGAATGGAACACACACACAACAAGTGCG GAGCATCAGACCGCAGCATGTAACACCACACAGAAACTCAAACCGAGACA ACAGAACAAGCAATCCATTATATGTAGTCAACGATGACGCCACACGCACT AGAGAGATAAACAAGCGTAGCACAATGGAGCATGGTCATACAGCACAAGA CCACAAGACAAGACAAGGACGTATCACAAGTCACAAACACCAAACACGCA CAAGACAAGATTCTATCAATAGTAGTAAAGGAGACAAAATAGGACGACAG ATGACCGACACAGTATCAGACACACTTCAAGACTACACAGTTGTGACGTA CGAAACATAATTTCATAGAGACAGACGAAAATAAGAGCGGACAGACAAAA TACTACACTGAGAACAGAGCGTTCAAGAAAGAAAACATAAAGGCGCAAGA CGGTGGACGCCCAAAAAGAAGACCCCATAGGAGGTCGACCACGCGAGCAC TTTCATAATAATGGATCAACATCAGTAAAGATACAGGCTGACAGACTAAT CGAGT #Lutra lutra mitochondrial partial cytb gene for cytochrome b, isolate m258 >1148_T _I19_036.ab ABI trimmed CTCTTCGTCGCCCATCTGCCGAGACGTCACTACGGCTGGATTATCCGATA CATACACGCAAACGGAGCCTCCATATTCTTCATCTGCCTGTTCCTACATG TAGGACGCGGCCTGTACTACGGATCTTATATATTCCCCGAAACATGA #Lutra lutra mitochondrial gene for cytochrome b, partial cds, strain: A line >1135_T _M19_034.ab ABI trimmed TCGGTTATCCGATACTTACACGGCCACCGGAGGCTCCGTATTCTTCATCT GCCTGTTCCTACATGTAGGACGCGGCCTGTACTACGGATCTTATATATTC CCCGAAACATGAAGACACTGGCCGCTGCCGGCCGTGCCGATTTCCTAGCC CGAGCCCCCATTTCCCTTAGGCCCGATTTGAGTGAAGGGGGCAACGTGGA AAGAGAGCTTGCCACCGTCAGCCGCCTTACTCACACCTTAAGGCCGTCTA CCCCTCACATCATCAGGGGCCGATCCAGCCGCCCGGGAGTCTCCCGTCTA CCCGCAGTGCCTCCCTCTCCTCGCCCCCGCTGTAAATTGATCACGTGCAC CGTCCACTCTGGCCCCGTGCGCCCCGATACAATTGATCCCTAAATAACCC CCTGTGCGGTTCCAGTGTAACCACACGCGGGCTGCTAACTCAAGTCTGTC GGGCCCCACAAAAAACAAACGCTCGGCTGTTTCGTGCACCGGCCAATGAA TGGGAGTTAGTAAGCGGCCTCGCGTCCACCCAATAACGCGACCCAAGCGG 12

13 CTGAGACGACGGCCATCCGACACCCATCGCTGTACTACTGGGAACACATA CTTCATCTCCGTCGCCCTATACGCGCCCCCACGAGTGCCACCGAAGACGT CTGCTCGTTTACTGCTCATGCAGCCTCCTGCATCCCTGTACTATAACCGT ATAAAGTGGAGCTGAGAGGCGGCAGTCAACGTTAGTCCCCGCAGGAGGCT TCTTCGCACTTCGGTCATGAAGATCCGCTCCAACCTTGCCAGTCCGCTCC CTTGCCGTGTCTGCGATCGCTGGCACACTCACTATCCAGCCCGCCACTAC TCCCCGAGGTCTCGCCCAGTCGATCACTCGTCCTGCAAACAAGATGAGCG ACCTACTGGCTCCGACCCGAAA # Lutra lutra mitochondrial gene for cytochrome b, partial cds, strain: A line 13

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 19.oktober 2015 Liselotte Wesley Andersen

Læs mere

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får DNA analyse til artsidentifikation af spytprøver fra to dødfundne får Notat fra DCE -Nationalt Center for Miljø og Energi Dato: 22. oktober 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam

DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam Notat fra DCE Nationalt Center for Miljø og Energi Dato: 5. september 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. oktober 2014 Liselotte Wesley Andersen Institut

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2014 Liselotte Wesley

Læs mere

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Liselotte Wesley Andersen Institut for Bioscience

Læs mere

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12 juni 2014 Liselotte Wesley Andersen Institut

Læs mere

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm.

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Liselotte Wesley Andersen

Læs mere

DNA-analyser af ulv Ulve i Danmark

DNA-analyser af ulv Ulve i Danmark DNA-analyser af ulv Ulve i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. februar 2016 Liselotte Wesley Andersen Institut for Bioscience Antal sider: 6 Faglig kvalitetssikring: Flemming

Læs mere

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen 2013 Retningslinjer af 10. december 2013 Notat fra DCE - Nationalt Center for

Læs mere

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. august 2014 Liselotte Wesley Andersen & Aksel Bo Madsen Institut for Bioscience

Læs mere

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. juni 2014 Tommy Asferg Institut for

Læs mere

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Artikel 17 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 28. juni 2013 Hanne Bach & Jesper Fredshavn

Læs mere

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. maj 2016 Tommy Asferg Institut for

Læs mere

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Notat fra DCE Nationalt Center for Miljø og Energi Dato: 31. oktober 2014 Tommy

Læs mere

Ynglende ringduer i september, oktober og november

Ynglende ringduer i september, oktober og november Ynglende ringduer i september, oktober og november Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. juni 2015 Kevin Kuhlmann Clausen & Thomas Kjær Christensen Institut for Bioscience Rekvirent:

Læs mere

Indberetning af vildsvin til Vildtudbyttestatistikken

Indberetning af vildsvin til Vildtudbyttestatistikken Indberetning af vildsvin til Vildtudbyttestatistikken for sæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2010/11

Vildtudbyttestatistik for jagtsæsonen 2010/11 Vildtudbyttestatistik for jagtsæsonen 2010/11 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. november 2011 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. juni 2012 Poul Nordemann Jensen Rekvirent: Naturstyrelsen Antal sider: 5

Læs mere

Rastende trækfugle på Tipperne 2012

Rastende trækfugle på Tipperne 2012 Rastende trækfugle på Tipperne 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2013 Ole Amstrup 1 Mogens Bak 1 Karsten Laursen 2 1 Amphi Consults 2 Institut for Bioscience Rekvirent:

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. april 2015 Ib Krag Petersen

Læs mere

Odder og stopriste/spærreanordninger i fiskeredskaber i visse salte vande

Odder og stopriste/spærreanordninger i fiskeredskaber i visse salte vande Odder og stopriste/spærreanordninger i fiskeredskaber i visse salte vande Supplement til notat af 10. november 2011 vedr. anvendelse af stopriste/spærreanordninger i fiskeredskaber for at undgå drukning

Læs mere

Anskydning af vildt. Status for undersøgelser 2014

Anskydning af vildt. Status for undersøgelser 2014 Anskydning af vildt. Status for undersøgelser 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. december 2014 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. januar 2015 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience

Læs mere

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. september 2013 Ib Krag Petersen Jakob

Læs mere

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 16. april 2013 Thomas Eske Holm Karsten Dahl Jonas Teilmann

Læs mere

Anskydning af vildt. Status for undersøgelser

Anskydning af vildt. Status for undersøgelser Anskydning af vildt. Status for undersøgelser 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. november 2013 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Internt notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. april 2016 Forfattere: Peter Wiberg-Larsen Institut

Læs mere

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 5. juli 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

Reduktioner i overvågningsprogrammet

Reduktioner i overvågningsprogrammet Reduktioner i overvågningsprogrammet NOVANA Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. april 2015 Poul Nordemann Jensen DCE Nationalt Center for Miljø og Energi Antal sider: 5 Faglig

Læs mere

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. september 2015 Bettina Nygaard & Jesper Bladt Institut for Bioscience

Læs mere

Optællinger af ynglefugle i det danske Vadehav 2012

Optællinger af ynglefugle i det danske Vadehav 2012 Optællinger af ynglefugle i det danske Vadehav 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 24. april 2013 Ole Thorup Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Rastefugle på Tipperne 2013

Rastefugle på Tipperne 2013 Rastefugle på Tipperne 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. marts 2014 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

Overvågning af bæver i Danmark 2011

Overvågning af bæver i Danmark 2011 Overvågning af bæver i Danmark 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 3. juli 2012 Jørn Pagh Berthelsen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 7 Redaktion:

Læs mere

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande Foto Finn Sivebæk 1 Historien Anvendelse af genetisk viden i forvaltning i DK 1994 Hansen et al. 1993 -? Nielsen et

Læs mere

Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl

Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA.

Læs mere

Kriterier for ringduers yngletid og forårstræktid

Kriterier for ringduers yngletid og forårstræktid Kriterier for ringduers yngletid og forårstræktid Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Kevin Kuhlmann Clausen & Thomas Eske Holm Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Interkalibrering Sedimentprøvetagning i søer

Interkalibrering Sedimentprøvetagning i søer Interkalibrering Sedimentprøvetagning i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato:. december 2012 Liselotte Sander Johansson Martin Søndergaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. oktober 2013 Thomas Eske Holm Ib

Læs mere

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 01. december 2013 Rettet: 21. februar 2014 og 8. marts 2014 Lars M. Svendsen

Læs mere

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden 2005-2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. april 2014 30. april 2014 Søren

Læs mere

MiSeq i den daglige rutine. MRSA og VRE Isolater.

MiSeq i den daglige rutine. MRSA og VRE Isolater. MiSeq i den daglige rutine. MRSA og VRE Isolater. 4. juni 2014 DTU Peder Worning, KMA Hvidovre Hvorfor Genomsekventere i Rutinen? Hvad bruger vi DNA-sekvenser til? Typning og bestemmelse af MRSA PCR baserede

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2011/12

Vildtudbyttestatistik for jagtsæsonen 2011/12 Vildtudbyttestatistik for jagtsæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 15. oktober 2012 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen

Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen Revurdering af pesticider i grundvand ved at medtage prøver under detektionsgrænsen i analysen Jens Carl Streibig, KU Claus Tonni Hansen, Christian Ritz, KU,. Daniel Gerhard NZ Jens Erik Jensen, Seges

Læs mere

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D.

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D. 11-11-2013 Testet i udlandet Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 Forfatter: Janus Vang, Ph.D. ANSVARLIG: REGIN W. DALSGAARD, BESTYRELSESFORMAND FOR VINNUFRAMI INTRODUKTION Færøernes

Læs mere

det måtte koges før det kunne bruges som drikkevand eller i madlavning, og dette stod på i 3 uger før situationen var normal

det måtte koges før det kunne bruges som drikkevand eller i madlavning, og dette stod på i 3 uger før situationen var normal 8 DNA afslører synderne bag forurenet vand Foto: Lars Aarø, Århus Kommunale Værker Vandtårn med 2000 m 3 drikkevand. Bakterier fra afføring i drikkevand er noget skidt! Hvert år berører drikkevandsforureninger

Læs mere

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

Cisgen byg med bedre fosfatudnyttelse

Cisgen byg med bedre fosfatudnyttelse Cisgen byg med bedre fosfatudnyttelse Seniorforsker Inger Bæksted Holme Aarhus Universitet, Science and Technology, Institut for Molekylærbiologi og Genetik, Afgrødegenetik og Bioteknologi Hypotese Det

Læs mere

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11-06-2014 Forfatter: Steen Solvang Jensen

Læs mere

Titel: Overvågning af sangsvane Cygnus cygnus som ynglefugl

Titel: Overvågning af sangsvane Cygnus cygnus som ynglefugl Titel: Overvågning af sangsvane Cygnus cygnus som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA. nr.: A107 Version:

Læs mere

Notat vedr. interkalibrering af ålegræs

Notat vedr. interkalibrering af ålegræs Notat vedr. interkalibrering af ålegræs Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. januar 2012 Michael Bo Rasmussen Thorsten Balsby Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016 Tillæg til Notat om omfordeling af arealdelen af husdyrgodkendelser i den nuværende regulering og ved forslag til ny husdyrregulering og effekter på kvælstofudledningen Notat fra DCE - Nationalt Center

Læs mere

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14. oktober 2013 Forfatter Liselotte Sander Johansson Institut for

Læs mere

Ynglefuglene på Tipperne 2014

Ynglefuglene på Tipperne 2014 Ynglefuglene på Tipperne 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. august 2014 Ole Thorup og Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 7 Redaktør:

Læs mere

Biodiversitetseffekter af proteinafgrøder i danske dyrkningssystemer

Biodiversitetseffekter af proteinafgrøder i danske dyrkningssystemer Biodiversitetseffekter af proteinafgrøder i danske dyrkningssystemer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2014 Morten T. Strandberg Beate Strandberg Institut for Bioscience

Læs mere

Forslag vedr. jagt på gæs på landjorden i januar

Forslag vedr. jagt på gæs på landjorden i januar Forslag vedr. jagt på gæs på landjorden i januar Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. april 2013 Thomas Kjær Christensen Jesper Madsen Tommy Asferg Institut for Bioscience Rekvirent:

Læs mere

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus ved Flakfortet Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. maj 2013 Jonas Teilmann Ib Krag Petersen

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2012/13

Vildtudbyttestatistik for jagtsæsonen 2012/13 Vildtudbyttestatistik for jagtsæsonen 2012/13 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 8. november 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 9 Faglig

Læs mere

Dødelighed hos ringdueunger som konsekvens af jagtlig regulering af forældrefugle

Dødelighed hos ringdueunger som konsekvens af jagtlig regulering af forældrefugle Dødelighed hos ringdueunger som konsekvens af jagtlig regulering af forældrefugle Notat fra DCE Nationalt Center for Miljø og Energi Dato: 31. oktober 2014 Thomas Eske Holm & Rasmus Due Nielsen Institut

Læs mere

Titel: Overvågning af havørn Haliaetus albicilla som ynglefugl

Titel: Overvågning af havørn Haliaetus albicilla som ynglefugl Titel: Overvågning af havørn Haliaetus albicilla som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA. nr.: A113

Læs mere

Notat om særlige danske udfordringer i forbindelse med de danske vandplaner

Notat om særlige danske udfordringer i forbindelse med de danske vandplaner Notat om særlige danske udfordringer i forbindelse med de danske vandplaner Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14. november 2012 Poul Nordemann Jensen DCE Nationalt Center for Miljø

Læs mere

PCR (Polymerase Chain Reaction): Opkopiering af DNA

PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR til at opkopiere bestemte DNA-sekvenser i en prøve er nu en af genteknologiens absolut vigtigste værktøjer. Peter Rugbjerg, Biotech Academy PCR (Polymerase

Læs mere

Ulves naturlige skyhed i områder med høj befolkningstæthed

Ulves naturlige skyhed i områder med høj befolkningstæthed Ulves naturlige skyhed i områder med høj befolkningstæthed Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 22. juni 2015 Peter Sunde Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

Spørgsmål Hvad kan ministeren oplyse om den kommende forvaltningsplan for ulve i Danmark

Spørgsmål Hvad kan ministeren oplyse om den kommende forvaltningsplan for ulve i Danmark Udvalget for Landdistrikter og Øer 2012-13 ULØ Alm.del Bilag 164 Offentligt J.nr. NST-4101-00479 25. juni 2013 Miljøministerens besvarelse af spørgsmål nr. R stillet af Folketingets Udvalg for landdistrikter

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

Statistisk analyse af næringsstoffers stabilitet

Statistisk analyse af næringsstoffers stabilitet Statistisk analyse af næringsstoffers stabilitet Notat fra DCE Nationalt Center for Miljø og Energi Dato: 4. august 216 Jacob Carstensen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 21

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

0 Indhold. Titel: Overvågning af bramgås Branta leucopsis som ynglefugl. Dokumenttype: Teknisk anvisning

0 Indhold. Titel: Overvågning af bramgås Branta leucopsis som ynglefugl. Dokumenttype: Teknisk anvisning Titel: Overvågning af bramgås Branta leucopsis som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Thomas Eske Holm, Thomas Kjær Christensen, Stefan Pihl, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet

Læs mere

Referat af tredje møde i Rådgivningspanelet for DCE Nationalt Center for

Referat af tredje møde i Rådgivningspanelet for DCE Nationalt Center for Møde den 26. juni 2014 kl. 10.00 14.00 Sted: Høgh-Guldbergs Gade 4, Bygning 1653, 8000 Aarhus C Til stede: Prodekan Kurt Nielsen; Direktør Hanne Bach; Direktør Carl-Emil Larsen; Chefkonsulent Carl Åge

Læs mere

Forekomst af diarré hos danske rådyr i 2010-11 analyseret på baggrund af oplysninger fra jægere og andre borgere.

Forekomst af diarré hos danske rådyr i 2010-11 analyseret på baggrund af oplysninger fra jægere og andre borgere. Videnblad nr. 1 11. maj 2011 Forekomst af diarré hos danske rådyr i 2010-11 analyseret på baggrund af oplysninger fra jægere og andre borgere. Peter Sunde 1, Ole Roland Therkildsen 1, Anne Sofie Hammer

Læs mere

Forventet synlighed og adfærd af ynglende ulve i Danmark

Forventet synlighed og adfærd af ynglende ulve i Danmark Forventet synlighed og adfærd af ynglende ulve i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. september 2015 Peter Sunde Institut for Bioscience Rekvirent: Naturstyrelsen Antal

Læs mere

0 Indhold. Titel: Overvågning af skestork Platalea leucorodia som ynglefugl. Dokumenttype: Teknisk anvisning. Version: 1

0 Indhold. Titel: Overvågning af skestork Platalea leucorodia som ynglefugl. Dokumenttype: Teknisk anvisning. Version: 1 Titel: Overvågning af skestork Platalea leucorodia som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA. nr.: A106

Læs mere

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹ Titel: Overvågning af engryle som ynglefugl Dokumenttype: Teknisk anvisning TA. nr.: A134 Version: 1 Oprettet: 17.04.2012 Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Læs mere

DCE S KVALITETSSIKRINGS- PROCEDURER

DCE S KVALITETSSIKRINGS- PROCEDURER DCE S KVALITETSSIKRINGS- PROCEDURER Susanne Boutrup Chefkonsulent 6. FEBRUAR 2017 KRAV TIL DEN FAGLIGE RÅDGIVNING Høj faglig kvalitet Rettidighed Intern koordinering Synlighed af resultater Dialog med

Læs mere

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen Arealer, urbanisering og naturindhold i, strandbeskyttelseslinjen og klitfredningslinjen Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. september 2015 Gregor Levin Institut for Miljøvidenskab,

Læs mere

Langtved Data A/S Nyhedsbrev

Langtved Data A/S Nyhedsbrev Langtved Data A/S Nyhedsbrev Nr. 2 Indledning I denne udgave af nyhedsbrevet har vi valgt at sætte fokus på interessante faciliteter som allerede benyttes af nogle af vores kunder og som kunne være interessante

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

Årsrapport 2013, kæbeindsamling Djursland

Årsrapport 2013, kæbeindsamling Djursland Årsrapport 2013, kæbeindsamling Djursland Lars Haugaard Institut for Bioscience Aarhus Universitet Grenåvej 14, 8410 Rønde. E. post.: laha@dmu.dk Faglig kommentering: Aksel Bo Madsen 1 1. Baggrund for

Læs mere

Betydningen af vildtreservatet Gamborg Inddæmning for fuglearter på udpegningsgrundlaget for Natura område nr.

Betydningen af vildtreservatet Gamborg Inddæmning for fuglearter på udpegningsgrundlaget for Natura område nr. Betydningen af vildtreservatet Gamborg Inddæmning for fuglearter på udpegningsgrundlaget for Natura 2000- område nr. 112, Lillebælt Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 8. januar

Læs mere

Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16

Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16 Vildtudbyttestatistik for jagtsæsonerne 2014/15 og 2015/16 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 28. juni 2016 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen Antal

Læs mere

Kromosomforandringer. Information til patienter og familier

Kromosomforandringer. Information til patienter og familier Kromosomforandringer Information til patienter og familier 2 Kromosomforandringer Den følgende information er en beskrivelse af kromosomforandringer, hvorledes de nedarves og hvornår dette kan medføre

Læs mere

Anskydning af kortnæbbet gås - opdatering 2016

Anskydning af kortnæbbet gås - opdatering 2016 Anskydning af kortnæbbet gås - opdatering 2016 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. maj 2016 Jesper Madsen og Lars Haugaard Institut for Bioscience Antal sider: 5 Faglig kommentering:

Læs mere

Vurdering af to vandindtag, der bruges til udsanding af muslinger

Vurdering af to vandindtag, der bruges til udsanding af muslinger Vurdering af to vandindtag, der bruges til udsanding af muslinger Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14-06-2016 Hans H Jakobsen Christian Mohn Institut for Bioscience Rekvirent:

Læs mere

Odder Lutra lutra teknisk anvisning til ekstensiv overvågning

Odder Lutra lutra teknisk anvisning til ekstensiv overvågning Fagdatacenter for Biodiversitet og Terrestriske Naturdata, Danmarks Miljøundersøgelser Dokumenttype: Teknisk anvisning Dok. nr: A1 Version: 1.1 Oprettet: 04-02-2003 Titel: Overvågning af odder Gyldig fra:

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Σ = i begyndelsen af 1960 erne

Σ = i begyndelsen af 1960 erne TEMADAG OM KONFLIKTARTER 27. JANUAR 2016 BRAMGÆS Tony Fox, Preben Clausen, Thomas Kjær Christensen og Jesper Madsen Institut for Bioscience, Aarhus Universitet, Kalø, Grenåvej 14, 8410 Rønde Hugh Boyd

Læs mere

BESKRIVER DANSK VANDLØBS FAUNA INDEKS ET VANDLØBS SANDE TILSTAND?

BESKRIVER DANSK VANDLØBS FAUNA INDEKS ET VANDLØBS SANDE TILSTAND? 30. JANUAR 2013 BESKRIVER ET VANDLØBS SANDE TILSTAND? - OG SIKRER DET REELT GOD ØKOLOGISK TILSTAND?, ESBEN A. KRISTENSEN & ANNETTE BAATTRUP-PEDERSEN DET KORTE SVAR ER: NEJ IKKE NØDVENDIGVIS Vandrammedirektivet

Læs mere

Databasesøgning med BLAST

Databasesøgning med BLAST Databasesøgning med BLAST Denne vejledning giver en introduktion til databasesøgning med forskellige programmer i BLAST-familien. Vejledningen indeholder først en grundig introduktion og gennemgang af

Læs mere

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹ Titel: Overvågning af brushane som ynglefugl Dokumenttype: Teknisk anvisning TA. nr.: A135 Version: 1 Oprettet: 17.04.2012 Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Læs mere

Vurdering af sandsynligheden for at højproduktive og lavproduktive landbrugsarealer

Vurdering af sandsynligheden for at højproduktive og lavproduktive landbrugsarealer Vurdering af sandsynligheden for at højproduktive og lavproduktive landbrugsarealer vil gro til ved ophør af landbrugsmæssig aktivitet Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. februar

Læs mere

Notat vedrørende Forskning og udviklingsarbejde i sundhedssektoren, Forskningsstatistik 1997 med særligt henblik på beregningerne vedr.

Notat vedrørende Forskning og udviklingsarbejde i sundhedssektoren, Forskningsstatistik 1997 med særligt henblik på beregningerne vedr. Notat vedrørende Forskning og udviklingsarbejde i sundhedssektoren, Forskningsstatistik 1997 med særligt henblik på beregningerne vedr. sygehusene Analyseinstitut for Forskning, 1999/2 1 Forskning og udviklingsarbejde

Læs mere

Recessiv (vigende) arvegang

Recessiv (vigende) arvegang 10 Recessiv (vigende) arvegang Anja Lisbeth Frederiksen, reservelæge, ph.d., Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet af Guy s and St Thomas Hospital, London, Storbritanien;

Læs mere

STATUS FOR DCE - NATIONALT CENTER FOR MILJØ OG ENERGI

STATUS FOR DCE - NATIONALT CENTER FOR MILJØ OG ENERGI 1. MAJ 2013 STATUS FOR DCE - NATIONALT CENTER FOR MILJØ OG ENERGI DIREKTØR DCE Nationalt Center for Miljø og Energi DCE er Aarhus Universitets centrale indgang for rådgivning og viden om natur og miljø

Læs mere

Danmarks Naturdata. Jesper Fredshavn, Danmarks Miljøundersøgelser, Aarhus Universitet, Kalø

Danmarks Naturdata. Jesper Fredshavn, Danmarks Miljøundersøgelser, Aarhus Universitet, Kalø Danmarks Naturdata Jesper Fredshavn, Danmarks Miljøundersøgelser, Aarhus Universitet, Kalø Danmarks Naturdata Danmarks Naturdata er en del af det fællesoffentlige partnerskab om Miljøportalen mellem Miljøministeriet,

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Vurdering af algeområder tilhørende nye produktionsområder 2016

Vurdering af algeområder tilhørende nye produktionsområder 2016 Vurdering af algeområder tilhørende nye produktionsområder 2016 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 17. oktober 2016 Forfatter Christian Mohn og Hans H Jakobsen Institut for Bioscience

Læs mere

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve Vejledende opgavesæt 1 Bioteknologi A Gymnasiale uddannelser 5 timers skriftlig prøve Vejledende opgavesæt 1 Mandag den 31. maj 2010 kl. 9.40-14.40 Side 1 af 8 sider pgave 1. Genmodificeret ris Vitamin

Læs mere