Slutrapport. Titel DNA-markører til forældreudvalg

Størrelse: px
Starte visningen fra side:

Download "Slutrapport. Titel DNA-markører til forældreudvalg"

Transkript

1 Slutrapport Titel DNA-markører til forældreudvalg Projektansvarlig og deltagere Projektansvarlig: Hanne Grethe Kirk, Landbrugets Kartoffelfond (LKF), Grindstedvej 55, DK-7184 Vandel, tlf , fax , Projektdeltager: Kirsten Kørup Sørensen, Aarhus Universitet, Det Jordbrugsvidenskabelige Fakultet, DJF, Jordbrugsproduktion og Miljø (JPM), Postboks 50, DK-8830 Tjele, tlf , Resumé Formålet med projektet var at etablere et redskab til at bedømme, hvor nært beslægtede potentielle krydsningsforældre er indenfor de enkelte sortstyper, og dermed undgå indavl. En vigtig del af projektet var en kompetenceopbygning hos LKF i form af indlæring af teknikkerne omkring DNAoprensning samt håndtering og kørsel af mikrosatellit markører, der gør det muligt fremover at anvende disse i forædlingsarbejdet. Allerede ved projektets start i 2002 var det klart, at den type DNA-markører, der egnede sig bedst til fremtidigt rutinearbejde, var mikrosatellitterne, også kaldet SSR (simple sequence repeats). På det tidspunkt var der imidlertid ikke fundet tilstrækkeligt af denne type markører i kartofler, så det var nødvendigt at starte med en anden type kaldet AFLP (amplified fragment length polymorphism) for hurtigt at få de første data til slægtskabsberegningerne. AFLP kræver faciliteter til arbejde med radioaktive stoffer og kunne kun udføres ved DJF, Foulum. AFLP-arbejdet strakte sig over perioden og 116 sorter blev målt. I 2003 bevilgede KAF et beløb til indkøb af en brugt DNA-sekvenator, der muliggjorde automatisering af mikrosatellit-analyser. Mikrosatellitter består af et antal korte, gentagne sekvenser af DNA. Når cellerne deler sig, kopieres DNA, så der kommer et helt sæt kromosomer i hver celle. Under kopieringen, der foregår ved hjælp af enzymer, sker der i meget sjældne tilfælde en fejl, så originalen og den ufærdige kopi skilles ad for tidligt. DNA er imidlertid klæbrigt, og da de to strenge passer sammen som nøgle og lås, samles de næsten altid korrekt igen. Hvis kopieringen er kommet til en mikrosatellit, hvor der er flere identiske låse, kan samlingen gå skævt, så der kommer en eller flere gentagelser for meget eller for lidt i kopien. Alle efterfølgende kopier af denne mikrosatellit vil have den nye længde, så afkommet af den sort, hvor denne fejl er sket, vil skille sig ud fra andre sorter. Det er langt fra alle mikrosatellitter, der findes i forskellige længder (er polymorfe), men fejlen sker tit nok til at man med et tilstrækkeligt stort antal mikrosatellitter kan skille alle sorter fra hinanden. Kartofler har fire sæt kromosomer, så den enkelte sort kan have op til fire størrelser i hver mikrosatellit stammende fra fire fejlkopieringer tilbage i sortens stamtræ. At mikrosatellitter har forskellig længde udnyttes i DNA-sekvenatoren, der ved hjælp af elektrisk spænding kan få DNA-stykkerne til at vandre i en gel - de korteste vandrer hurtigst. Inden kørselen på sekvenatoren bliver stykkerne opformeret i en PCR-maskine, der efterligner den kopiering, der sker i cellen, og forsynet med en fluorescerende farve. Når de passerer en laserstråle, lyser de op, og

2 passagen registreres af maskinen. Maskinen kan skelne mellem fem farver, hvoraf den ene bruges som standard, så fire forskellige mikrosatellitter kan køres på en gang (Figur 1). DNA-sekvenatoren blev i første omgang anbragt på DJF, Foulum. Der blev i perioden afprøvet og optimeret på et stort antal mikrosatellitter, som dels var designet på Ålborg Universitet, men ikke afprøvet i praksis, dels var angivet i litteraturen. Når der er fundet nogle mikrosatellitter, der virker og er polymorfe, skal de samles i sæt, hvor størrelserne ikke overlapper for meget, og som helst skal kunne opformeres og farvemærkes sammen, da det sparer både tid og dyre kemikalier. Ved overflytningen til LKF i foråret 2006 var der udvalgt og optimeret 52 mikrosatellitter, der kunne køres som 13 sæt á 4 på DNA-sekvenatoren. Figur 1. Eksempel på toppe i fire farver målt på DNA-sekvenator. De grønne toppe tilhører to forskellige mikrosatellitter. Efter overførsel til LKF er der sket en yderligere tilpasning af mikrosatellit-sættene, da nogle viste sig at være mindre velegnede til rutinekørsel. Tre mikrosatellitter er udgået og seks nye kommet til. De sidste tre er sat ind i allerede eksisterende sæt, hvor forskellen i størrelse er stor nok til at der kan skelnes mellem f. eks to grønne mikrosatellitter som i Figur 1, hvilket er en meget billig måde at øge antallet af markører på. I projektets løb er der oprenset DNA fra 1700 sorter, hvoraf 330 sorter i 2006/2007 er karakteriseret med mikrosatellitter. Der er beregnet slægtskab mellem sorterne, der supplerer de afstamningsdata, vi i øvrigt har (Figur 2). I Figur 2 ses det beregnede slægtskab i en potentiel krydsning mellem Royal og sorten LRC V0416-7, der er af canadisk oprindelse, og som det ikke er lykkedes at finde afstamningen på. Den beregnede indavlskoefficient er 0, da ingen forældre går igen på begge sider. Fingerprintingen, der er beregnet ud fra mikrosatellit-data, giver et tal mellem 0 og 1, hvor en selvbestøvning giver 1. En fingerprintingværdi på 0,382 er ret lav og viser, at denne krydsning kan laves uden risiko for indavl. En yderligere detalje, der er et direkte resultat af et andet projekt om glycoalkaloider i kartofler, er den nederste rubrik. Heri angives, om de mikrosatellitter, der flankerer et gen, der bestemmer glycoalkaloidindholdet i knoldene, indicerer et højt eller lavt indhold. For LRC-sortens vedkommende får vi indikation på et lavt indhold. Royal har ikke den specifikke markørkombination, så der kan ikke siges noget om den.

3 Figur 2. Beregning af slægtskab i en potentiel krydsning. Markøren for glycoalkaloidindhold er det første eksempel på, at de markører, der benyttes til slægtskabsberegning, samtidig kan sige noget om specifikke egenskaber. Det forventes, at der i fremtiden vil identificeres mange flere af disse markører.

4 Projektets faglige forløb Projektet er foregået i tæt samarbejde mellem DJF og LKF. En oversigt over projektforløbet fremgår af Tabel 1. Tabel 1. Oversigt over projektforløbet År DJF LKF 2002 AFLP-kørsel og manuel scoring af geler. DNA-oprensning. Udvælgelse af metode samt oprensning af 150 sorter. Opbygning af databasesystem AFLP-kørsel og manuel scoring af geler. Start på indkøring af DNA-sekvenator. Marianne Madsen erstattet af Kirsten Kørup som projektleder hos DJF. AFLP-kørsel med både traditionelle metoder og på DNA-sekvenator. Start på kørsel af SSR på sekvenator. Test af SSR fra Ålborg Universitet. Test af SSR fundet gennem litteraturen samt fra Ålborg Universitet. Optimering af kørsel af SSR på sekvenator. Kursus i brug af sekvenator for LKFpersonale ved DJF, Foulum. DNA-oprensning med ny og bedre metode. Afprøvning af programmet NTSYS til slægtskabsanalyse. DNA-oprensning og manuel scoring af AFLP-geler. DNA- oprensning. Beregning af slægtskab ud fra AFLP data på 116 sorter. Kursus på Foulum. Optimering af SSR kørsel på sekvenator før flytning til Vandel. Assistance i forbindelse med flytningen og DNA-oprensning. Indkøring af sekvenator på Vandel opstarten i Vandel. Kromosomlokalisering af nye og måling af SSR. Slægtskabsanalyser. SSR fra Ålborg Universitet og STPRINSPG (en SSR fra litteraturen).. Sekventering af seks SSR fra Ålborg Universitet. Præsentation af resultater ved Plant Biotech Denmark møde i København. DNA-oprensning. Måling af SSR på sekvenator. Slægtskabsanalyser. Præsentation af resultater ved Plant Biotech Denmark møde i København. DNA-oprensning. Der er oprenset DNA fra både in vitro planter, drivhusplanter og planter fra marken. Plantematerialet blev til og med 2005 lynfrosset i flydende kvælstof i reagensglas med teflonkugler og knust på rysteapparat (Vortex). Fra 2006 lejedes en svingmølle (Retsch, Mixer mill 301), der knuste plantematerialet meget hurtigere og overflødiggjorde den flydende kvælstof. Der er i projektet afprøvet flere metoder til oprensning af DNA. I 2002 blev en metode med chloroform/isoamylalkohol og isopropanol tilpasset, dels fra DJF, dels fra Sejet forædlingsstation. Metoden gav et højt udbytte af DNA. Indledende afprøvninger på Foulum viste, at kvaliteten var god nok, og alle oprensningerne i 2002 blev derfor foretaget med denne metode. Efterfølgende viste det sig, at alt for mange analyser ikke virkede, så vi besluttede at finde en bedre metode i Der er udviklet mange færdige kits til oprensning af forskellige typer DNA. Et af dem, Nucleospin, blev testet i februar/marts Det gav DNA af høj kvalitet, men i så små mængder, at metoden blev opgivet. Dernæst prøvedes kittet Genelute, der gav høj-kvalitetsdna i rimelige mængder. Dette kit er vi fortsat med siden. AFLP Markører af typen AFLP blev brugt i begyndelsen af projektet. Ved AFLP skæres kartoflernes DNA i mange små stykker vha. såkaldte restriktionsenzymer. Disse stykker mærkes med et

5 radioaktivt stof, mangfoldiggøres og køres på en gel. De forskellige bånd kan ses på et billede af gelen. En enkelt kombination kan give mere end 40 forskellige bånd og AFLP har derfor en høj informations værdi. Til dette projekt blev restriktionsenzymerne EcoRI (E), MseI (M) og HindIII (H) afprøvet med i alt 19 kombinationer (Tabel 2), og EB, EC samt EH blev brugt til markøranalyser. I Tabel 2 er primerne angivet med enzymforkortelsen samt yderligere tre bogstaver, der står for DNA-baser. Restriktionsenzymerne laver så mange stykker, at hvis de alle opformeres vil man på gelen ikke se en række bånd, men en udtværet skygge. For at reducere antallet af bånd opformeres kun de stykker, der starter med de tre angivne baser. Tabel 2. Afprøvede primerkombinationer til AFLP. Forkortelser: EcoRI (E), MseI (M) og HindIII (H) Markør Pri1navn Pri2navn EA E-AAC M-CAC EB E-AAC M-CAG EC E-ACA M-CAC ED E-ACA M-CAG EF E-ACT M-CAC EG E-ACT M-CAG EH E-AGA M-CAG EI E-ATG M-CAG EJ E-ATG M-CTA EK E-ATG M-CAC HA H-AAC M-CAC HB H-AAC M-CTA HC H-ACT M-CAC HD H-ACT M-CAG HE H-ACT M-CTA HF H-ATG M-CAC HH H-ATG M-CAG HJ H-ACA M-CAG HK H-ATC M-CAC Mikrosatellitter (SSR) Der benyttes 55 SSR fordelt på alle 12 kromosomer (Tabel 3) Tabel 3. Fordeling af de anvendte SSR mellem kartoflens 12 kromosomer. De, der er markeret med rødt, flankerer et gen for glycoalkaloidindhold på kromosom 1. SSR Kromosom SSR Kromosom STM0019b? StI015 VI STM2020 I StI016 VI LeatpacA I StI004 VI STM2030 I STM0019a VI STM5136(pt) I STM0028 VII STM5127 I STM0052 VII STM1049 I STM3009 VII STM1102 I, IX STM0031 VII STM2022 II TC84379 VII STM3001 II STM1005/STMFWAX VIII STM0038 II STM1024 VIII StI013 III STM1016 VIII

6 STM1054 III STWAX-2 VIII STM1058 III STM1104 VIII TC85064 III TC77529 VIII STM3016 IV STM1106 X STM5140 IV STM0051 X STM3023 IV +? TC74728 X STM1051 IX STSNRNA10 X? STM3012 IX STM2005 XI STM1052 IX TC84781 XI STM1017/STGLGPB IX STM5130 XI STM1031 V STM0025 XI TC75529 V STM0037 XI STPoAc58 V STM2028 XII STPRINPSG V STM0030 XII STM5148(pt) V STM0003 XII StI051 XII Principielt er forskellene i længderne af en bestemt SSR lig med minimum en repetition, men i praksis kan der være andre variationskilder som f.eks. tab af enkeltbaser. I Figur 3 ses en SSR med dels store spring i længde svarende til hele repetitioner, dels med et dobbeltbånd, der svarer til en forskel på en base (indrammet). Disse variationer er lige så gode markører som de hele spring og registreres så vidt det er muligt at skelne dem. STM1052 sæt 7 grøn SSR længde, antal baser Hold Figur 3. Eksempel på SSR med to meget tætliggende bånd (indrammet), der er svære at skille Før måling sker en opformering ved hjælp af PCR, hvor en fluorescensfarve sættes på. De enkelte SSR samles i sæt, der så vidt muligt kan opformeres sammen i PCR, og som ikke overlapper for

7 meget (Figur 4). Hvorfor henvises der til Figur 5 før Figur 4? De fluorescerende farver overlapper i bølgelængde, så f.eks. en meget kraftig rød farve også vil ses som en gul top. Man kan delvis, men ikke helt, undgå problemet ved at definere den relative intensitet af de forskellige farver i de fire målepunkter. De gennemblødningstoppe, der ikke fjernes af maskinen, må derefter vurderes manuelt (Figur 5). Sæt nr STM1049 TC85064 TC77529 TC74728 STM1017/ST 13 STM0019b STM0019a STM5148(pt STM STM5140 STM1058 STM5136(pt STSNRNA10 11 STM0007 STM3023 STM0003 STM TC84379 STM5130 STM STM0025 TC84781 StI013 STM0031 STM STM3012 STPRINPSG STM1052 STM STM3001 STM1102 STPoAc58 STM STM1104 STWAX-2 STM2030 StI016 StI004 5 STM0030 STM1016 STM0051 StI015 4 LeatpacA STM3016 STM2005 STM STM2022 TC77529 STM2028 STM1005/ST 2 STM1106 STM1031 STM1051 STM STM SSR længde, antal baser

8 Figur 4. Størrelser af de anvendte SSR. I hvert sæt er der minimum en SSR af hver af de fire farver. Figur 5. SSR toppe. Den gule top (tegnet med sort for at kunne ses) er meget kraftig og bløder igennem i både den grønne og den røde farve. Slægtskabsberegning Til at beregne, hvor tæt beslægtede sorterne er, benyttes programmet NTSYS. Det er et specielt statistikprogram, der sammenligner hver sort med hver af de andre og beregner, hvor ens, de er. Disse beregninger placeres i en tabel, hvorfra fingerprintoplysninger hentes til krydsningsplanlægning (Figur 2). Ud fra tabellen kan programmet tegne et familietræ, der grupperer sorterne efter, hvor ens deres DNA er (Figur 6). Træet læses fra venstre mod højre. Jo mere forskellige to sorter er, jo længere mod venstre ligger forgreningspunktet. Familietræet anvendes til at få overblik over de mulige krydsningspartnere og udpege interessante sorter med en anderledes genetisk baggrund. Kromosomlokalisering En af fordelene ved SSR frem for AFLP er, at de er anvendelige som ankermarkører til identifikation af koblingsgrupper, dvs. at SSR, der i andre studier er kortlagt på bestemte kromosomer, også med meget stor sandsynlighed er placeret på samme kromosom i de aktuelle kloner. Nye designede SSR-markører vil kunne lokaliseres ud fra disse ankermarkører vha. koblingsstudier. En sådan kortlægning af markører til kromosomer kræver at markørerne bliver testet i en familie, dvs. forældre og et passende antal ( ) afkom. Til dette formål var HCDHDN familien, som blev anvendt i et projekt vedr. glycoalkaloider, til rådighed. Først blev der gennemført laboratorieanalyser af alle markører og kloner. Derefter blev klonerne vurderet mht. om de havde båndet/båndene fra markørerne eller ej. Kun markører, der er polymorfe er informative.

9 Disse data blev brugt til kortlægningen som blev udført med computerprogrammet JoinMap. Programmet er baseret på statistiske analyser, som beregner rækkefølgen af og afstanden imellem markørerne. Først udvælger programmet de to markører, som med størst sandsynlighed er tættest koblede, og derefter tilføjes mindre tæt koblede markører. Alle markører som er koblet direkte eller indirekte danner en koblingsgruppe. I kartofler findes 12 forskellige koblingsgrupper svarende til de 12 forskellige kromosomer. Hvilket kromosomnummer nye markører er lokaliseret på, kan defineres ud fra ankermarkørerne. I dette projekt blev de seks markører, der starter med TC samt STPRINPSG kortlagt (Tabel 3). Sekventering For at udvide antallet af anvendelige SSR-markører i kartofler blev der udviklet seks markører specifikt til dette projekt, og disse markører blev sekventeret. Ved en sekventering fastlægges rækkefølgen af baser, for at efterprøve om markøren er identisk med den kartoffel sekvens, hvorfra den oprindeligt blev designet. Dette er også nødvendigt for at kende den nøjagtige opbygning af DNA-stykket og størrelsen af markøren. Sekventeringen foregår ved at hver enkelt SSR-markør splejses ind i en bestemt type Eschericia coli bakterie, hvorefter det inkorporerede stykke mangfoldiggøres ved opformering af bakterierne i et vækstsubstrat. Det interessante DNA-stykke kan skæres ud og analyseres på en sekvenator, hvorved rækkefølgen af baser fastlægges. Sekventeringen af de seks nyudviklede SSR i dette projekt (Figur 7) viste at der var god overensstemmelse mellem den forventede og den aktuelle rækkefølge af baser.

10 Figur 6. Slægtskabstræ for 122 sorter analyseret med SSR

11 TC74728: HDN-45 1 GGACATGAGGAGAGGCAGAGCAACTCCGGCGGTG CCGGTGAAGCC S. tuberosum 1 GGACATGAGGAGAGGCAGAGCAACTCCGGCGGCGGCGGCGGCGGCGGCGCCGGTGAAGCC ******************************** * *********** HDN AGATGGATCTGGTGGATTGAACAAGAT S. tuberosum 61 AGATGGATCTGGTGGATTGAACGAGAT ********************** **** TC75529: 90-HAG-15 1 AGAAGCCGCCAAGCTTGAGCGCCAGCGCCGCCGTCAAGAGGCAGCCGCCGCTGCCGCCGC S. tuberosum 241 AGAAGCCGCCAAGCTTGAGCGCCAGCGCCGCCGTCAAGAGGCAGCCGCCGCCGCCGCCGC *************************************************** ******** 90-HAG C------ACTGCTGTCTCCACCGTCTCCA S. tuberosum 301 CGCCGCCACTGCTGTCTCCACCGTCTCCA * ********************** TC77529: HDN TGGATCTCACGCGCCACCAGAATGGTGGTAATAATTTGGGAGACTACTACGAATCTGAAG S. tuberosum 1 TGGATCTCACGCGCCACCAGAATGGTGGTAATAATTTGGGAGACTACTACGAATCTGAAG ************************************************************ HDN AGGAAGATGATGATGATGATGATGATGATAGTGGTGAGATTCCTATAGCACATCCTGTAA S. tuberosum 61 AGGAAGAAGATGATGATGATGATGATGATAGTGGTGAGATTCCTATAGCACATCCTGTAA ******* **************************************************** HDN CGGATTACGGGATCC S. tuberosum 121 CGGATTACGGGATCC *************** TC84379: HDN-05 1 ACCATCACCACCACCTTCAGCCGCCGCAGCTGCAGCAGCAGCAGCT------TGTGAATC S. tuberosum 149 ACCATCACCACCACCTTCAGCCGCCGCAGCTGCAGCAGCAGCAGCAGCAGCATGTGAATC ********************************************* ******** HDN GTGAACAAGGAGGAGGAGGAGCTGCAGTAAGGAACACCGTC S. tuberosum 209 GTGAACAAGGAGGAGGAGGAGCTGCAGTAAGGAACACCGTC ***************************************** TC84781: HDN-02 1 GGGTACTTCACTTTGTGGTAAGCCACTTGATTCATGTGATGGTAGTAGTAGTAGTAGTA- S. tuberosum 1 GGGTACTTCACTTTGTGGTAAGCCACTTGATTCATGTGATGGTAGTAGTAGTAGTAGTAG *********************************************************** HDN TTGGAGAAGGTAAAAAGAAGAAACTTTCTGGTGGAGCAATTGCTGGTATAGTAATTGG S. tuberosum 61 TATTGGAGAAGGTAAAAAGAAGAAACTTTCAGGTGGAGCAATTGCTGGTATAGTAATTGG **************************** ***************************** HDN TTGTGTTGTTAGTTTGCTTTTGCTTCTTTGTTTGCTGTTTTTCTGTTGTAGAAAAAGGGG S. tuberosum 121 TTGTGTTGTTGGTTTGCTTTTGCTTCTTTGTTTGCTGTTTTTCTGTTGTAGAAAAAGGGG ********** ************************************************* HDN TAAAAAAGAAACAAGATCTGCTGATAGTGGTG S. tuberosum 181 TAAAAAAGAAACAAGATCTGCTGATAGTGGTG ******************************** TC85064: HDN-05 1 GTGCTCAACTTTCCATGTCTGTACCATTAGAACATGATTATATAGGTCTATCAGAACCTT S. tuberosum 1 GTGCTCAACTTTCCATGTCTGTACCATTAGAACATGATTATATAGGTCTATCAGAACCTT ************************************************************ HDN CTTTAATGGAAAAAAGTTCTGATAAGATTTCTTCTTCTTCTTCTTC---CTCTGTTCTCA S. tuberosum 61 CTTTAATGGAAGAAAGTTCTGATAAGATTTCTTCTTCTTCTTCTTCTTCCTCTGTTCTCA *********** ********************************** ***********

12 HDN ACCTGAAAGAGACTGAGCTGAGACTTGGGTT S. tuberosum 121 ACCTGAAAGAGACTGAGCTGAGACTTGGGTT ******************************* Figur 7. Sammenligning af sekvenser for seks udviklede SSR mellem 90-HAG-15 forælderen eller HCDHDN afkom (HDN-02, HDN-05, HDN-45 og HDN-135) og Solanum tuberosum (kartoffel). Stjerner indikerer identiske nukleotid enheder. Primer sekvenser er understreget, og den repetetive sekvens er markeret med fed skrift. Afledt arbejde PÅ LKF har den opkvalificering, der er sket som følge af projektet, åbnet for en vifte af nye muligheder. I projektet Udvikling af et nyt værktøj til forædling af økologiske kartofler med høj naturlig skimmelresistens vha. DNA-markører undersøges, om skimmelresistensen i et par af de ungarske sorter fra Sarpo-forædlingsstationen er forbundet med bestemte SSR-kombinationer. Vi ved, at resistensen er knyttet til et R-gen og let brydes. Hvis man vha. markører kan udpege sorter med flere R-gener, vil deres resistens være væsentlig mere holdbar. I projektet Glykoalkaloider i kartofler er der identificeret to SSR, der flankerer et gen for glykoalkaloidindhold i knolde. Disse SSR indgår i de 55, der bliver kørt på alle sorter, og kan derfor benyttes til at vurdere glykoalkaloidindholdet i nye krydsningspartnere. Det er planlagt at samkøre SSR-data med en række forskellige egenskaber som tørstof, friteringsfarve, udbytte og resistenser for alle målte sorter for på den måde at prøve at finde brugbare sammenhænge, der kan udnyttes i forædlingen. Konklusion Projektet har været en stor succes. LKF s personale er blevet i stand til selvstændigt at udføre DNAarbejde og et stort antal sorter er analyseret. Resultaterne indgår i høj grad i krydsningsplanlægningen og som et nødvendigt fundament for videre udnyttelse af DNAteknikkerne. Denne overførsel af viden er sket i sidste øjeblik, da der ikke længere arbejdes med kartoffelmarkører ved DJF. Offentliggørelser vedrørende projektet Sørensen KK, DNA-markører - et redskab til kartoffelforædling. Kartoffelproduktion 31(5): 4-8 Sørensen KK, HG Kirk, J Emmersen, Familietræer i kartofler og forædling efter højere udbytte. Kartoffelproduktion 33(4): 8-9 Artiklerne fra Kartoffelproduktion kan læses på: Sørensen KK, HG Kirk, J Emmersen, Microsatellites used for estimation of relationship between potato breeding clones. I: Plant Biotech Denmark Annual meeting 2007 January 23-24, University of Copenhagen. Posters 9: Breeding Bach, IC, KK Sørensen og HG Kirk, Kartoflens genetiske puslespil klassisk forædling og ny teknologi. slespil_klassisk_foraedling_og_ny_teknologi

Resultat af Ærteforsøg 2010

Resultat af Ærteforsøg 2010 Resultat af Ærteforsøg 2010 Ved et kursus på Institut for Jordbrug og Økologi, KU Life, blev dette ærteforsøg gennemført, med undervisning af Gunter Backes og Jihad Orabi. Skrevet af Søren Holt Frøsamlerne

Læs mere

REVISIONSFIRMAET ERIK CHRISTENSEN

REVISIONSFIRMAET ERIK CHRISTENSEN REVISIONSFIRMAET ERIK CHRISTENSEN STATSAUTORISEREDE REVISORER I/S VESTER VOLDGADE 106, 1552 KØBENHAVN V TLF: 33 13 29 12. FAX: 33 32 02 12. E-MAIL: EC@REVEC.DK ANSVARLIGE INDEHAVERE: HENNING ROSENVOLD.

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet?

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Lyn dine gener op! En baglæns besked, gemt i 'backup-dna'et'

Læs mere

DNA og stamtræer. Fra DNA-sekvens til stamtræ. 50 Brug Botanisk Have i undervisningen

DNA og stamtræer. Fra DNA-sekvens til stamtræ. 50 Brug Botanisk Have i undervisningen DN og stamtræer Kan vi se skoven for bar træer? 11 Ole Seberg, professor*, oles@snm.ku.dk Gitte Petersen, professor*, gittep@snm.ku.dk * otanisk Have og Museum, Statens Naturhistoriske Museum Københavns

Læs mere

Struktur og funktion af gener

Struktur og funktion af gener Molekylærbiologi og genetik S4, F2008 f Malene Munk Jørgensen Emne: Struktur og funktion af gener Link: undervisningsplanen for S4-molekylærbiologi og genetik MMJ, VI niversity ollege Bioanalytikeruddannelsen

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Oprensning af genomisk DNA fra plantemateriale Manual Katalog nr. 166-5005EDU explorer.bio-rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, februar 2009

Læs mere

Livets molekylære kode

Livets molekylære kode 4. ÅR R. 2 / 2006 Livets molekylære kode -kemi og biologi mødes D livets molekylære kode D findes i alle levende organismer og indeholder koden til organismen informationer, der afgør om organismen er

Læs mere

Uddannelse som virtuel projektleder

Uddannelse som virtuel projektleder Uddannelse som virtuel projektleder Udnytter din virksomhed potentialet i virtuel projektledelse? Nye teknologier tordner frem i virksomheder og giver mulighed for at kommunikere og samarbejde på nye måder.

Læs mere

Eksempel I. Tiden mellem kundeankomster på et posthus er eksponential fordelt med middelværdi µ =2minutter.

Eksempel I. Tiden mellem kundeankomster på et posthus er eksponential fordelt med middelværdi µ =2minutter. Eksempel I Tiden mellem kundeankomster på et posthus er eksponential fordelt med middelværdi µ =2minutter. Per Bruun Brockhoff IMM DTU 02402 Eksempler 1 Eksempel I Tiden mellem kundeankomster på et posthus

Læs mere

Har grovfoder en ernæringsmæssig værdi for slagtesvin?

Har grovfoder en ernæringsmæssig værdi for slagtesvin? Har grovfoder en ernæringsmæssig værdi for slagtesvin? Alle husdyr skal have grovfoder I det økologiske husdyrhold skal dyrene have adgang til grovfoder. Grovfoderet skal ikke udgøre en bestemt andel af

Læs mere

Hvad er meningen? Et forløb om opinionsundersøgelser

Hvad er meningen? Et forløb om opinionsundersøgelser Hvad er meningen? Et forløb om opinionsundersøgelser Jette Rygaard Poulsen, Frederikshavn Gymnasium og HF-kursus Hans Vestergaard, Frederikshavn Gymnasium og HF-kursus Søren Lundbye-Christensen, AAU 17-10-2004

Læs mere

Elevnavn: Elevnummer: Skole: Hold:

Elevnavn: Elevnummer: Skole: Hold: Folkeskolens afgangsprøve Maj 2011 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/23 B3 Indledning Bioteknologi Teknikker som for eksempel gensplejsning anvendes i

Læs mere

Bilag 4.A s MASH. Indhold

Bilag 4.A s MASH. Indhold Bilag 4.A s MASH Indhold 1.1 Indledning 1 1.1.1 Formål med undersøgelsen 1 1.1.2 Beskrivelse af smash metoden 1 1.2 s MASH målinger (omfang, placering og resultater) 1.2.1 Undersøgelsens forløb 5 5 1.2.2

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Navn: Forsøgsvejledning Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA sekvens,

Læs mere

IT/Regneark Microsoft Excel 2010 Grundforløb

IT/Regneark Microsoft Excel 2010 Grundforløb Januar 2014 Indhold Opbygning af et regneark... 3 Kolonner, rækker... 3 Celler... 3 Indtastning af tekst og tal... 4 Tekst... 4 Tal... 4 Værdier... 4 Opbygning af formler... 5 Indtastning af formler...

Læs mere

Hvorfor er det nødvendigt at have standarder for sidekapacitet?

Hvorfor er det nødvendigt at have standarder for sidekapacitet? Indledning Hvorfor er det nødvendigt at have standarder for sidekapacitet? Sidekapaciteten angiver det anslåede antal sider, der kan udskrives med en bestemt tonerpatron. Tidligere har producenterne af

Læs mere

Er erhvervsgrunden forurenet? Værd at vide om kortlægning af jordforurening

Er erhvervsgrunden forurenet? Værd at vide om kortlægning af jordforurening Er erhvervsgrunden forurenet? Værd at vide om kortlægning af jordforurening Hvorfor kortlægger vi jordforurening? Jordforurening kan være til skade for mennesker og miljø. For at forhindre de skadelige

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Sommereksamen 2015 Institution 414 Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold HFe Biologi B Torben

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin August 2010 juni 2011 Institution Gymnasiet HTX - Skjern Uddannelse Fag og niveau Lærer(e) HTX Proces, levnedsmiddel

Læs mere

Graph brugermanual til matematik C

Graph brugermanual til matematik C Graph brugermanual til matematik C Forord Efterfølgende er en guide til programmet GRAPH. Programmet kan downloades gratis fra nettet og gemmes på computeren/et usb-stik. Det betyder, det også kan anvendes

Læs mere

SIND's På rø ren de råd giv ning

SIND's På rø ren de råd giv ning SIND's På rø ren de råd giv ning Idé Aktiviteter til brug i børnegrupper kata log for børn med psykisk syge forældre Udarbejdet af Joan Stæhr SIND s Pårørenderådgivning 2006 Journal nr.: 87131-0988 Dette

Læs mere

statistik statistik viden fra data statistik viden fra data Jens Ledet Jensen Aarhus Universitetsforlag Aarhus Universitetsforlag

statistik statistik viden fra data statistik viden fra data Jens Ledet Jensen Aarhus Universitetsforlag Aarhus Universitetsforlag Jens Ledet Jensen på data, og statistik er derfor et nødvendigt værktøj i disse sammenhænge. Gennem konkrete datasæt og problemstillinger giver Statistik viden fra data en grundig indføring i de basale

Læs mere

Er din boliggrund forurenet?

Er din boliggrund forurenet? Er din boliggrund forurenet? Værd at vide om kortlægning af jordforurening Hvorfor kortlægger vi jordforurening? Jordforurening kan være til skade for mennesker og miljø. For at forhindre de skadelige

Læs mere

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D.

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D. 11-11-2013 Testet i udlandet Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 Forfatter: Janus Vang, Ph.D. ANSVARLIG: REGIN W. DALSGAARD, BESTYRELSESFORMAND FOR VINNUFRAMI INTRODUKTION Færøernes

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

Der er afsat ca. 30 minutter til leverandørs disposition.

Der er afsat ca. 30 minutter til leverandørs disposition. Dagsorden - Parykker 1. Velkommen og præsentation Præsentation af KomUdbud Udbudsplan 2. Teknisk Dialog formål og afgrænsning 3. Præsentation af området - ved leverandør Der ønskes en præsentation af produktområdet

Læs mere

Af produktivitetschef Bjarne Palstrøm, Dansk Industri

Af produktivitetschef Bjarne Palstrøm, Dansk Industri Faldgruber i Lean Af produktivitetschef Bjarne Palstrøm, Dansk Industri Erfaringerne med indførelse af Lean-tankegangen viser, at virksomhederne fra tid til anden ikke får det forventede udbytte. Denne

Læs mere

EU-lande i fælles front mod kartoffelskimmel

EU-lande i fælles front mod kartoffelskimmel EU-lande i fælles front mod kartoffelskimmel Hvis der er rådne kartofler i den nyindkøbte pose, har kartoflerne med stor sandsynlighed kartoffelskimmel en alvorlig plantesygdom, som skyldes angreb af mikroorganismen,

Læs mere

OPDATERINGSVEJLEDNING FOR AKC5 1.20 DECEMBER 2008

OPDATERINGSVEJLEDNING FOR AKC5 1.20 DECEMBER 2008 OPDATERINGSVEJLEDNING FOR AKC5 1.20 DECEMBER 2008 Denne vejledning beskriver installation af opdatering, nyheder og ændringer som skal bruges fra og med 1. januar 2009. Det er derfor meget vigtigt at du

Læs mere

1. Hvad er kræft, og hvorfor opstår sygdommen?

1. Hvad er kræft, og hvorfor opstår sygdommen? 1. Hvad er kræft, og hvorfor opstår sygdommen? Dette kapitel fortæller om, cellen, kroppens byggesten hvad der sker i cellen, når kræft opstår? årsager til kræft Alle levende organismer består af celler.

Læs mere

Krydderurter udvikling af en stabil økologisk gødning i flydende og fastform

Krydderurter udvikling af en stabil økologisk gødning i flydende og fastform Slutrapport for græsrodsprojektet Krydderurter udvikling af en stabil økologisk gødning i flydende og fastform Gartneriet Vestjysk Krydderurter ApS Aksel Bruun, Mosebyvej 49, Mejrup 7500 Holstebro Journal

Læs mere

matematik Demo excel trin 1 preben bernitt bernitt-matematik.dk 1 excel 1 2007 by bernitt-matematik.dk

matematik Demo excel trin 1 preben bernitt bernitt-matematik.dk 1 excel 1 2007 by bernitt-matematik.dk matematik excel trin 1 preben bernitt bernitt-matematik.dk 1 excel 1 2007 by bernitt-matematik.dk matematik excel 1 1. udgave som E-bog 2007 by bernitt-matematik.dk Kopiering af denne bog er kun tilladt

Læs mere

Velkommen til 6. omgang

Velkommen til 6. omgang Velkommen til 6. omgang I dag Internet Hjemmeopgave 5 Mapper og filer Internet Vi så på faner sidst. og hurtigt på favoritter som ikke må forveksles med faner Favoritter Kan med fordel bruges til internetsider

Læs mere

Excel anvendt på laboratoriet

Excel anvendt på laboratoriet U D K A S T Plan for kursusforløb Excel anvendt på laboratoriet Statens Seruminstitut Foråret 2006 KURSUSFORLØB Det forventes, at der vil blive tale om 2 parallelle forløb: A: Forløb for deltagere på begynder-niveau

Læs mere

15. oktober. Maskine Udlejning. Jacob Weng, Jeppe Boese og Mads Anthony. Udlejningsvirksomhed. Roskilde Tekniske Gymnasium 3.4

15. oktober. Maskine Udlejning. Jacob Weng, Jeppe Boese og Mads Anthony. Udlejningsvirksomhed. Roskilde Tekniske Gymnasium 3.4 Maskine Udlejning 15. oktober 2010 Jacob Weng, Jeppe Boese og Mads Anthony Roskilde Tekniske Gymnasium Udlejningsvirksomhed 3.4 Indholdsfortegnelse Problemformulering:... 2 Planlægning:... 2 Analyse af

Læs mere

REGISTRERING AF TRÆNGSEL

REGISTRERING AF TRÆNGSEL REGISTRERING AF TRÆNGSEL MED BLUETOOTH Finn Normann Pedersen Jens Peder Kristensen Management Konsulent, KeyResearch Direktør, KeyResearch fnp@keyresearch.dk jpk@keyresearch.dk +45 29 89 31 16 +45 22 23

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Permeable belægninger til naturlig dræning

Permeable belægninger til naturlig dræning Permeable belægninger til naturlig dræning Thomas Pilegaard Madsen Teknologisk Institut Betoncentret 11. maj 2011 Lokal håndtering af regnvand Lokal afledning af regnvand hvor det falder forkortes LAR

Læs mere

Mikkel Skovs hjemmeside Ledervedlejning

Mikkel Skovs hjemmeside Ledervedlejning Mikkel Skovs hjemmeside Ledervedlejning Version 1.1 10/08/2008 Indhold Indledning...1 Åbningsside...2 Login...5 Leder Info...5 Oprettelse af indhold...5 Oprettelse af artikel...5 Gem artikel...11 Hvem

Læs mere

GMO GENMODIFICEREDE FØDEVARER. GMO Genmodificerede fødevarer

GMO GENMODIFICEREDE FØDEVARER. GMO Genmodificerede fødevarer GMO GENMODIFICEREDE FØDEVARER 1 GMO Genmodificerede fødevarer 2 GMO GENMODIFICEREDE FØDEVARER Hvad er GMO og genmodificering? Når man genmodificerer, arbejder man med de små dele af organismernes celler

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Business Check Kartofler Pæne tal på bundlinien. Martin Andersen Landbonord Sarpsborg den 9. nov. 2009

Business Check Kartofler Pæne tal på bundlinien. Martin Andersen Landbonord Sarpsborg den 9. nov. 2009 Business Check Kartofler Pæne tal på bundlinien. Martin Andersen Landbonord Sarpsborg den 9. nov. 2009 Lars Wiik, Sverige Stay-green projekt, 2003 2005 Udbytteoptimering i stivelseskartofler Helhedsvurdering

Læs mere

rdtaxaplan Vejledning

rdtaxaplan Vejledning ravnø data - svendborgvej 9-5750 ringe - www.ravno.dk - rd@ravno.dk - 6263 2667 2009 Ravnø Data Indhold 1. rdtaxaplan...5 1.1. Oversigt...5 1.2. Hovedmenu...5 1.3. Godt at vide, inden du går videre...6

Læs mere

Kursus i brug af Pinnacle Studio 9

Kursus i brug af Pinnacle Studio 9 Bent Sehested Odense Video Klub Side 20 Ved at markere en sekvens og med markøren peger på den blå linje i lydsporet, ændres markøren til en højttaler med en pil. I berøringspunktet opstår der en lille

Læs mere

Orddeling. Automatisk orddeling. Manuel orddeling. Word 2010 18 thoremil.dk. Vælg fanebladet [Sidelayout] Vælg [Orddeling] Markér Automatisk orddeling

Orddeling. Automatisk orddeling. Manuel orddeling. Word 2010 18 thoremil.dk. Vælg fanebladet [Sidelayout] Vælg [Orddeling] Markér Automatisk orddeling Orddeling Automatisk orddeling Vælg [Orddeling] Markér Automatisk orddeling Manuel orddeling Vælg [Orddeling] Klik [Manuelt] For hvert ord, som vises, kan der gøres følgende: Accepter det foreslåede orddelingssted

Læs mere

Undersøgelse af arvelige faktorer ved autisme

Undersøgelse af arvelige faktorer ved autisme Undersøgelse af arvelige faktorer ved autisme Nyhedsbrev nr. 3, februar 2006 Introduktion Det er med glæde, at vi her kan præsentere vores tredje nyhedsbrev til alle familierne, som deltager i projektet

Læs mere

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares.

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. Bioteknologi A Studentereksamen Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. frs111-btk/a-31052011 Tirsdag den 31. maj 2011 kl. 9.00-14.00

Læs mere

TUNGE SKILLEVÆGGE PÅ TRYKFAST ISOLERING BEREGNINGSMODELLER

TUNGE SKILLEVÆGGE PÅ TRYKFAST ISOLERING BEREGNINGSMODELLER pdc/sol TUNGE SKILLEVÆGGE PÅ TRYKFAST ISOLERING BEREGNINGSMODELLER Indledning Teknologisk Institut, byggeri har for EPS sektionen under Plastindustrien udført dette projekt vedrørende anvendelse af trykfast

Læs mere

Easy Guide i GallupPC

Easy Guide i GallupPC Easy Guide i GallupPC Version. 6.00.00 Gallup A/S Masnedøgade 22-26 DK 2100 København Ø Telefon 39 27 27 27 Fax 39 27 50 80 Indhold SÅDAN KOMMER DU I GANG MED AT ANVENDE GALLUPPC... 2 TILFØJELSE AF UNDERSØGELSER

Læs mere

BRUGSANVISNING BY0011 H610 CAL

BRUGSANVISNING BY0011 H610 CAL BRUGSANVISNING BY0011 CAL H610 FUNKTIONSOVERSIGT Gang reserve indikation Overopladning sikkerheds funktion Utilstrækkelig opladnings advarsels funktion (to-sekunders interval bevægelse) Energibesparende

Læs mere

Genetisk karakteristik af Jysk kvæg

Genetisk karakteristik af Jysk kvæg Genetisk karakteristik af Jysk kvæg December 2008 Anna Brüniche-Olsen Genetisk karakteristik af Jysk kvæg Jysk kvæg tyre (Anna Brüniche-Olsen) Rapporten er udarbejdet af Anna Brüniche-Olsen, specialestuderende

Læs mere

Supplement til manualen, Kalender-Semesterskema

Supplement til manualen, Kalender-Semesterskema Supplement til manualen, Kalender-Semesterskema Untis er et skemalægningsprogram, der anvendes i mange lande. I Gruber og Petters manual Kalender-Semesterskema (som du finder på vores hjemmeside under

Læs mere

NY PROCES TIL RAFFINERING AF KARTOFFELSTIVELSE OG FIBRE TIL LEVNEDSMIDLER MV. NYHEDER 01.09.2010

NY PROCES TIL RAFFINERING AF KARTOFFELSTIVELSE OG FIBRE TIL LEVNEDSMIDLER MV. NYHEDER 01.09.2010 NY PROCES TIL RAFFINERING AF KARTOFFELSTIVELSE OG FIBRE TIL LEVNEDSMIDLER MV. NYHEDER GENERELLE OPLYSNINGER OM PROJEKTET SE NEDENSTÅENDE 01.09.2010 Demonstrationsanlæg for afprøvning af ny proces til raffinering

Læs mere

REDIGERING AF REGNEARK

REDIGERING AF REGNEARK REDIGERING AF REGNEARK De to første artikler af dette lille "grundkursus" i Excel, nemlig "How to do it" 8 og 9 har været forholdsvis versionsuafhængige, idet de har handlet om ting, som er helt ens i

Læs mere

Eksamensspørgsmål til biocu til mandag d. 10. juni 2013

Eksamensspørgsmål til biocu til mandag d. 10. juni 2013 Eksamensspørgsmål til biocu til mandag d. 10. juni 2013 Nr. 1. Fra gen til protein. Hvordan er sammenhængen mellem DNA ets nukleotider og proteinets aminosyrer? Beskriv hvad der sker ved henholdsvis transskription

Læs mere

Spillebeskrivelse. Rev. 02. Compu-Game A/S, Randersvej 36, DK 6700 Esbjerg Tlf.: 76 10 98 00 Fax: 76 10 98 98

Spillebeskrivelse. Rev. 02. Compu-Game A/S, Randersvej 36, DK 6700 Esbjerg Tlf.: 76 10 98 00 Fax: 76 10 98 98 Spillebeskrivelse Rev. 02 Compu-Game A/S, Randersvej 36, DK 6700 Esbjerg Tlf.: 76 10 98 00 Fax: 76 10 98 98 Opstillingsvejledning for Compu-Game automater. Indgreb i automatens elektriske og mekaniske

Læs mere

Anvendelse af ufuldstændige blokforsøg

Anvendelse af ufuldstændige blokforsøg Anvendelse af ufuldstændige blokforsøg Kristian Kristensen 1, Jakob Willas 2, Lise Nistrup Jørgensen 3 og Rene Gislum 4 1 Forskergruppe for Biometri, Afd. for Husdyravl og Genetik, DJF 2 Afd. for Sortsafprøvning,

Læs mere

Vejledning KPK Online Prøverum

Vejledning KPK Online Prøverum Vejledning KPK Online Prøverum INDHOLD Introduktion side 2 Funktionsliste side 2 Få adgang til systemet side 3 Opload dine billeder side 4 Sådan bruges systemet side 5 Gem dine eksempler side 7 Side 1/7

Læs mere

Nr 1. Fra gen til protein

Nr 1. Fra gen til protein Nr 1 Fra gen til protein Med udgangspunkt i vedlagte illustrationer bedes du besvare følgende: Hvordan er sammenhængen mellem DNA ets nukleotider og proteinets aminosyrer? Beskriv hvad der sker ved henholdsvis

Læs mere

DIFFERENTIERET AVL AF ØKOLOGISKE GRISE VIA DANAVL

DIFFERENTIERET AVL AF ØKOLOGISKE GRISE VIA DANAVL DIFFERENTIERET AVL AF ØKOLOGISKE GRISE VIA DANAVL Med støtte fra: DIFFERENTIERET AVL AF GRISE VIA DANAVL Vejledning i brug af DanAvls udbud af KS til økologiske besætninger DIFFERENTIERET AVL AF GRISE

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Velkommen til 3. omgang af IT for let øvede

Velkommen til 3. omgang af IT for let øvede Velkommen til 3. omgang af IT for let øvede I dag Hjemmeopgave 2 NemId, E-boks, borger.dk Internet Hjemmeopgave 2 I har vel læst Komputer for Alles modul 27 om filer og mapper? Internet Kablede forbindelser

Læs mere

Grønlandsk kartoffelavl uden pesticider men med gavnlige antifungale bakterier

Grønlandsk kartoffelavl uden pesticider men med gavnlige antifungale bakterier Grønlandsk kartoffelavl uden pesticider men med gavnlige antifungale bakterier Peter Stougaard og Charlotte Frydenlund Michelsen* Institut for Plante- og Miljøvidenskab Sektion for Genetik og Mikrobiologi

Læs mere

Lav ultra lav input Afsluttende rapport

Lav ultra lav input Afsluttende rapport Lav ultra lav input Afsluttende rapport Projektansvarlig: Deltagere: KMC- Annette Dam Jensen Ytteborg Ole Elkjær Landmand Carl Heiselberg Resume: Der snakkes meget om IPM produktion i øjeblikket, men hvad

Læs mere

Integrationskontrakt

Integrationskontrakt Integrationskontrakt Vedrørende Cpr.nr. Grundoplysninger ved modtagelsen Dato for kommunalbestyrelsens overtagelse af integrationsansvaret: Tidspunkt for påbegyndelse af introduktionsforløb: I. Opholdsoplysninger

Læs mere

Gener, biologiske markører og valg af den rigtige behandling

Gener, biologiske markører og valg af den rigtige behandling Gener, biologiske markører og valg af den rigtige behandling Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt Vi oplever i disse år en sand revolution i udviklingen af nye teknologier

Læs mere

Stennedlægningsfræser, Muratori (se sidste års undersøgelse) Stenstrenglægning til 25 cm dybde (se sidste års undersøgelse) Plov

Stennedlægningsfræser, Muratori (se sidste års undersøgelse) Stenstrenglægning til 25 cm dybde (se sidste års undersøgelse) Plov Side 1 af 5 LandbrugsInfo Søg overalt Søg kun i FarmT.. Byggeri Driftsledelse IT Fjerkræ Får Heste Kvæg Lov&ret Maskiner Miljø Pelsdyr Planteavl Svin Tværfagligt Uddannelse LandbrugsInfo > Tværfaglige

Læs mere

Spiring og etablering af feltforsøg med in vitro klonede planter af nordmannsgran. 2000-2003.

Spiring og etablering af feltforsøg med in vitro klonede planter af nordmannsgran. 2000-2003. Spiring og etablering af feltforsøg med in vitro klonede planter af nordmannsgran. 2-23. Støttet af: Produktionsafgiftsfonden for juletræer og pyntegrønt & Skov- og Naturstyrelsen Rapport oktober 23 for

Læs mere

Word 2007 Vejledning til rapportskrivning

Word 2007 Vejledning til rapportskrivning Indholdsfortegnelse Generelt om Word 2007... 2 Opsætning af dokument... 2 Afsnit... 2 Sidelayout... 3 Skrifttype... 3 Indsæt sidetal... 4 Indsæt indholdsfortegnelse... 5 Overskrift til indholdsfortegnelse

Læs mere

Økologisk planteforædling

Økologisk planteforædling Økologisk planteforædling Økologikongres Vingstedcenteret 24. november 2011 Anders Borgen Økologi-visionen...en støtteordning for økologisk sortsudvikling og -afprøvning......arbejde for, at EU s udsædslovgivning

Læs mere

2/3 Akset digital tæller

2/3 Akset digital tæller SERIE Z59E 2/3 Akset digital tæller for Elgo Magnetisk målebånd og / eller Encoder ELGO - ELECTRIC Gerätebau und Steuerungstechnik GMBH D - 78239 Rielasingen, Postfach 11 30, Carl - Benz - Strafle 1 Telefon

Læs mere

Noter til Kartoffelafgiftsfondens budget 2012.

Noter til Kartoffelafgiftsfondens budget 2012. Noter til Kartoffelafgiftsfondens budget 2012. 1. Kvalitetsskadegørere i læggekartofler. Læggekartofler angribes af en række sygdomme, hvoraf en del forekommer latent og først kommer til udbrud under lagring

Læs mere

EXCEL 2010 KURSUSHÆFTE TRIN 1 EXCEL 2010 KURSUSHÆFTE TRIN 1

EXCEL 2010 KURSUSHÆFTE TRIN 1 EXCEL 2010 KURSUSHÆFTE TRIN 1 EXCEL 2010 KURSUSHÆFTE TRIN 1 EXCEL 2010 KURSUSHÆFTE TRIN 1 Excel 2010 for begyndere første trin Baseret på små overskuelige øvelser Mange store illustrationer i farver KURSUSHÆFTE TRIN 1 Excel 2010 kursushæfte

Læs mere

Introduktion til EXCEL med øvelser

Introduktion til EXCEL med øvelser Side 1 af 10 Introduktion til EXCEL med øvelser Du kender en almindelig regnemaskine, som kan være til stort hjælp, når man skal beregne resultater med store tal. Et regneark er en anden form for regnemaskine,

Læs mere

Filtyper, filformat og skabelon. Tabel. Tekstombrydning. Demo Fremstil, gem og brug en skabelon. Øvelser Fremstil, gem og brug en skabelon

Filtyper, filformat og skabelon. Tabel. Tekstombrydning. Demo Fremstil, gem og brug en skabelon. Øvelser Fremstil, gem og brug en skabelon Disposition for kursus i Word 2007 Filtyper, filformat og skabelon Demo Fremstil, gem og brug en skabelon Øvelser Fremstil, gem og brug en skabelon Tabel Demo Opret en tabel ud fra en tekst Øvelser Opret

Læs mere

Microsoft Excel - en kort introduktion. Grundlag

Microsoft Excel - en kort introduktion. Grundlag Microsoft Excel - en kort introduktion Grundlag Udover menuer og knapper - i princippet som du kender det fra Words eller andre tekstbehandlingsprogrammer - er der to grundlæggende vigtige størrelser i

Læs mere

Ringetoneaftale. Aftalens parter. På den ene side. Koda Landemærket 23-25 Postboks 2154 DK-1016 København K

Ringetoneaftale. Aftalens parter. På den ene side. Koda Landemærket 23-25 Postboks 2154 DK-1016 København K Ringetoneaftale Aftalens parter På den ene side Koda Landemærket 23-25 Postboks 2154 DK-1016 København K og Nordisk Copyright Bureau (NCB) Hammerichsgade 14 1611 København V herefter benævnt Koda/NCB og

Læs mere

PowerPoint Intro 2010 Segment - en del af dit netværk

PowerPoint Intro 2010 Segment - en del af dit netværk PowerPoint Intro 2010 7 Arbejde med objekter Formål Udover at arbejde med almindelig tekst og punktopstillinger, kan du i PowerPoint indsætte diverse objekter. Med objekter menes der fx; billeder, figurer,

Læs mere

1. Manuel og automatisk registrering af punkter Her gennemgås hvordan punkter optages manuelt eller automatisk. Fra køreskærmen trykkes på Værktøj

1. Manuel og automatisk registrering af punkter Her gennemgås hvordan punkter optages manuelt eller automatisk. Fra køreskærmen trykkes på Værktøj Optagelse af punkter 1. Manuel og automatisk registrering af punkter Her gennemgås hvordan punkter optages manuelt eller automatisk. Fra køreskærmen trykkes på Værktøj 2. Valgmuligheder for lagring af

Læs mere

Hvis dette kunne have jeres interesse vil jeg meget gerne være behjælpelig med yderlig information og evt. tilbud.

Hvis dette kunne have jeres interesse vil jeg meget gerne være behjælpelig med yderlig information og evt. tilbud. Dato: 06-2005 Hermed fremsendes uopfordret en brochure mappe med vores udstyr til måling af brændstof forbrug om borde på skibe. Jeg håber at i lige har tid til at gennemse det medsendte. Systemet har

Læs mere

Billeder og tegninger i Word 2007 Indhold

Billeder og tegninger i Word 2007 Indhold Billeder og tegninger i Word 2007 Indhold Indhold...1 Introduktion...2 Indsætte billeder...2 Formater billedet...3 Layout...4 Beskære billedet...4 Størrelse...5 Streger/ramme...6 Billedeffekter...6 Skygge...7

Læs mere

ViTal. Når ViTal er startet, kan du få læst tekst højt på flere måder - Du kan bl.a. bruge knapperne i ViTal Bjælken.

ViTal. Når ViTal er startet, kan du få læst tekst højt på flere måder - Du kan bl.a. bruge knapperne i ViTal Bjælken. ViTal Sådan læses op med ViTal Når ViTal er startet, kan du få læst tekst højt på flere måder - Du kan bl.a. bruge knapperne i ViTal Bjælken. Disse knapper er aktive, når du åbner ViTal og bruges til oplæsning

Læs mere

KOMMISSIONENS GENNEMFØRELSESFORORDNING (EU)

KOMMISSIONENS GENNEMFØRELSESFORORDNING (EU) 21.3.2013 Den Europæiske Unions Tidende L 79/7 KOMMISSIONENS GENNEMFØRELSESFORORDNING (EU) Nr. 254/2013 af 20. marts 2013 om ændring af forordning (EF) nr. 340/2008 om gebyrer og afgifter til Det Europæiske

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Januar-juni 2015 Institution Vestegnen hf og VUC Uddannelse Fag og niveau Lærer(e) Hold Hfe Biologi C Lene

Læs mere

Enten med kabel eller med trådløs forbindelse

Enten med kabel eller med trådløs forbindelse Internet Enten med kabel eller med trådløs forbindelse Internet Computer med kabel computer trådløs - router modem stikdåse verden udenfor Internetadresser Hovedregel eksempel: www.gammelby.eu (1 punktum

Læs mere

Spil og svar. Journal nr. 13.12.599. Et webbaseret værktøj udviklet af Programdatateket i Skive

Spil og svar. Journal nr. 13.12.599. Et webbaseret værktøj udviklet af Programdatateket i Skive Journal nr. 13.12.599 Spil og svar Et webbaseret værktøj udviklet af Programdatateket i Skive E-mail: programdatateket@viauc.dk Web: http://www.programdatateket.dk Kolofon HVAL-vejledning Spil og svar

Læs mere

HVOR AUTOMATISERET ER DEN DANSKE FREMSTILLINGSINDUSTRI?

HVOR AUTOMATISERET ER DEN DANSKE FREMSTILLINGSINDUSTRI? Centre for Economic and Business Research, CEBR Copenhagen Business School Dept. of Economics Porcelænshaven 16A DK-2000 Frederiksberg +45 3815 2575 RESEARCH NOTE 18. april 2013 HVOR AUTOMATISERET ER DEN

Læs mere

Elevskema. Med modulet Elevskema kan du fordele eleverne på kurser og danne individuelle elevskemaer.

Elevskema. Med modulet Elevskema kan du fordele eleverne på kurser og danne individuelle elevskemaer. Elevskema Med modulet Elevskema kan du fordele eleverne på kurser og danne individuelle elevskemaer. Forudsætningen for at arbejde med modulet Elevskema er, at der i Untis er oprettet elever, som er tilknyttet

Læs mere

Dansk Sportsdykker Forbund

Dansk Sportsdykker Forbund Dansk Sportsdykker Forbund Teknisk Udvalg Sid Dykketabellen Copyright Dansk Sportsdykker Forbund Indholdsfortegnelse: 1 FORORD... 2 2 INDLEDNING... 3 3 DEFINITION AF GRUNDBEGREBER... 4 4 FORUDSÆTNINGER...

Læs mere

3D visualisering af trafik omkring ny letbane

3D visualisering af trafik omkring ny letbane 3D visualisering af trafik omkring ny letbane Ole Munk Riberholt COWI A/S Indledning I foråret 2005 tog Københavns Amt initiativ til en udstilling om den mulige kommende letbane på Ring 3. Til udstillingen

Læs mere

This page intentionally left blank

This page intentionally left blank Kontrakter This page intentionally left blank Bjørn Saltorp & Erik Werlauff Kontrakter 2. udgave Jurist- og Økonomforbundets Forlag 2009 Kontrakter 2. udgave, 1. oplag 2009 by Jurist- og Økonomforbundets

Læs mere

Intra- og intermolekylære bindinger.

Intra- og intermolekylære bindinger. Intra- og intermolekylære bindinger. Dipol-Dipol bindinger Londonbindinger ydrogen bindinger ydrofil ydrofob 1. Tilstandsformer... 1 2. Dipol-dipolbindinger... 2 3. Londonbindinger... 2 4. ydrogenbindinger....

Læs mere

Velkommen til IT for let øvede

Velkommen til IT for let øvede Velkommen til IT for let øvede at dias ligger på hjemmesiden, så I kan se dem igen hjemme. Peter har ordet Blev vi færdige med vinduerne?? Øvelse tastatur og mus vi ikke kunne sidste gang får I som hjemmeopgave

Læs mere

Bedre fødevare forsyning. Supermarkede r ombygget

Bedre fødevare forsyning. Supermarkede r ombygget Eksempel på milepælsplanlægning Projektledelse bygger på målstyring. Det er ofte det eneste projektlederen har at holde fast i det eller de mål som skal realiseres. Projektledelse uden mål er en illusion.

Læs mere

EUROPÆISK POLITIK FOR ABO-HJEMMESIDER

EUROPÆISK POLITIK FOR ABO-HJEMMESIDER EUROPÆISK POLITIK FOR ABO-HJEMMESIDER 1 For at skabe opmærksomhed omkring Amway, Amways produkter og Amways forretningsmulighed, og med det formål at hjælpe ABOer med at etablere deres egen Amway-forretning,

Læs mere

Kromosomtranslokationer

Kromosomtranslokationer 12 Kromosomtranslokationer December 2009 Oversat af Anja Lisbeth Frederiksen, reservelæge, ph.d. Klinisk Genetisk Afdeling, Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet

Læs mere

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold:

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold: Manual til Wordpress Sådan opdaterer du din hjemmeside i Wordpress: Dette er en manual til de mest grundlæggende ting, så du selv kan redigere indholdet eller tilføje nyt på din hjemmeside. Guiden er skrevet

Læs mere

Gener, biologiske markører og valg af den rigtige behandling. Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt

Gener, biologiske markører og valg af den rigtige behandling. Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt Gener, biologiske markører og valg af den rigtige behandling Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt Vi oplever i disse år en sand revolution i udviklingen af nye teknologier

Læs mere