Slutrapport. Titel DNA-markører til forældreudvalg

Størrelse: px
Starte visningen fra side:

Download "Slutrapport. Titel DNA-markører til forældreudvalg"

Transkript

1 Slutrapport Titel DNA-markører til forældreudvalg Projektansvarlig og deltagere Projektansvarlig: Hanne Grethe Kirk, Landbrugets Kartoffelfond (LKF), Grindstedvej 55, DK-7184 Vandel, tlf , fax , Projektdeltager: Kirsten Kørup Sørensen, Aarhus Universitet, Det Jordbrugsvidenskabelige Fakultet, DJF, Jordbrugsproduktion og Miljø (JPM), Postboks 50, DK-8830 Tjele, tlf , Resumé Formålet med projektet var at etablere et redskab til at bedømme, hvor nært beslægtede potentielle krydsningsforældre er indenfor de enkelte sortstyper, og dermed undgå indavl. En vigtig del af projektet var en kompetenceopbygning hos LKF i form af indlæring af teknikkerne omkring DNAoprensning samt håndtering og kørsel af mikrosatellit markører, der gør det muligt fremover at anvende disse i forædlingsarbejdet. Allerede ved projektets start i 2002 var det klart, at den type DNA-markører, der egnede sig bedst til fremtidigt rutinearbejde, var mikrosatellitterne, også kaldet SSR (simple sequence repeats). På det tidspunkt var der imidlertid ikke fundet tilstrækkeligt af denne type markører i kartofler, så det var nødvendigt at starte med en anden type kaldet AFLP (amplified fragment length polymorphism) for hurtigt at få de første data til slægtskabsberegningerne. AFLP kræver faciliteter til arbejde med radioaktive stoffer og kunne kun udføres ved DJF, Foulum. AFLP-arbejdet strakte sig over perioden og 116 sorter blev målt. I 2003 bevilgede KAF et beløb til indkøb af en brugt DNA-sekvenator, der muliggjorde automatisering af mikrosatellit-analyser. Mikrosatellitter består af et antal korte, gentagne sekvenser af DNA. Når cellerne deler sig, kopieres DNA, så der kommer et helt sæt kromosomer i hver celle. Under kopieringen, der foregår ved hjælp af enzymer, sker der i meget sjældne tilfælde en fejl, så originalen og den ufærdige kopi skilles ad for tidligt. DNA er imidlertid klæbrigt, og da de to strenge passer sammen som nøgle og lås, samles de næsten altid korrekt igen. Hvis kopieringen er kommet til en mikrosatellit, hvor der er flere identiske låse, kan samlingen gå skævt, så der kommer en eller flere gentagelser for meget eller for lidt i kopien. Alle efterfølgende kopier af denne mikrosatellit vil have den nye længde, så afkommet af den sort, hvor denne fejl er sket, vil skille sig ud fra andre sorter. Det er langt fra alle mikrosatellitter, der findes i forskellige længder (er polymorfe), men fejlen sker tit nok til at man med et tilstrækkeligt stort antal mikrosatellitter kan skille alle sorter fra hinanden. Kartofler har fire sæt kromosomer, så den enkelte sort kan have op til fire størrelser i hver mikrosatellit stammende fra fire fejlkopieringer tilbage i sortens stamtræ. At mikrosatellitter har forskellig længde udnyttes i DNA-sekvenatoren, der ved hjælp af elektrisk spænding kan få DNA-stykkerne til at vandre i en gel - de korteste vandrer hurtigst. Inden kørselen på sekvenatoren bliver stykkerne opformeret i en PCR-maskine, der efterligner den kopiering, der sker i cellen, og forsynet med en fluorescerende farve. Når de passerer en laserstråle, lyser de op, og

2 passagen registreres af maskinen. Maskinen kan skelne mellem fem farver, hvoraf den ene bruges som standard, så fire forskellige mikrosatellitter kan køres på en gang (Figur 1). DNA-sekvenatoren blev i første omgang anbragt på DJF, Foulum. Der blev i perioden afprøvet og optimeret på et stort antal mikrosatellitter, som dels var designet på Ålborg Universitet, men ikke afprøvet i praksis, dels var angivet i litteraturen. Når der er fundet nogle mikrosatellitter, der virker og er polymorfe, skal de samles i sæt, hvor størrelserne ikke overlapper for meget, og som helst skal kunne opformeres og farvemærkes sammen, da det sparer både tid og dyre kemikalier. Ved overflytningen til LKF i foråret 2006 var der udvalgt og optimeret 52 mikrosatellitter, der kunne køres som 13 sæt á 4 på DNA-sekvenatoren. Figur 1. Eksempel på toppe i fire farver målt på DNA-sekvenator. De grønne toppe tilhører to forskellige mikrosatellitter. Efter overførsel til LKF er der sket en yderligere tilpasning af mikrosatellit-sættene, da nogle viste sig at være mindre velegnede til rutinekørsel. Tre mikrosatellitter er udgået og seks nye kommet til. De sidste tre er sat ind i allerede eksisterende sæt, hvor forskellen i størrelse er stor nok til at der kan skelnes mellem f. eks to grønne mikrosatellitter som i Figur 1, hvilket er en meget billig måde at øge antallet af markører på. I projektets løb er der oprenset DNA fra 1700 sorter, hvoraf 330 sorter i 2006/2007 er karakteriseret med mikrosatellitter. Der er beregnet slægtskab mellem sorterne, der supplerer de afstamningsdata, vi i øvrigt har (Figur 2). I Figur 2 ses det beregnede slægtskab i en potentiel krydsning mellem Royal og sorten LRC V0416-7, der er af canadisk oprindelse, og som det ikke er lykkedes at finde afstamningen på. Den beregnede indavlskoefficient er 0, da ingen forældre går igen på begge sider. Fingerprintingen, der er beregnet ud fra mikrosatellit-data, giver et tal mellem 0 og 1, hvor en selvbestøvning giver 1. En fingerprintingværdi på 0,382 er ret lav og viser, at denne krydsning kan laves uden risiko for indavl. En yderligere detalje, der er et direkte resultat af et andet projekt om glycoalkaloider i kartofler, er den nederste rubrik. Heri angives, om de mikrosatellitter, der flankerer et gen, der bestemmer glycoalkaloidindholdet i knoldene, indicerer et højt eller lavt indhold. For LRC-sortens vedkommende får vi indikation på et lavt indhold. Royal har ikke den specifikke markørkombination, så der kan ikke siges noget om den.

3 Figur 2. Beregning af slægtskab i en potentiel krydsning. Markøren for glycoalkaloidindhold er det første eksempel på, at de markører, der benyttes til slægtskabsberegning, samtidig kan sige noget om specifikke egenskaber. Det forventes, at der i fremtiden vil identificeres mange flere af disse markører.

4 Projektets faglige forløb Projektet er foregået i tæt samarbejde mellem DJF og LKF. En oversigt over projektforløbet fremgår af Tabel 1. Tabel 1. Oversigt over projektforløbet År DJF LKF 2002 AFLP-kørsel og manuel scoring af geler. DNA-oprensning. Udvælgelse af metode samt oprensning af 150 sorter. Opbygning af databasesystem AFLP-kørsel og manuel scoring af geler. Start på indkøring af DNA-sekvenator. Marianne Madsen erstattet af Kirsten Kørup som projektleder hos DJF. AFLP-kørsel med både traditionelle metoder og på DNA-sekvenator. Start på kørsel af SSR på sekvenator. Test af SSR fra Ålborg Universitet. Test af SSR fundet gennem litteraturen samt fra Ålborg Universitet. Optimering af kørsel af SSR på sekvenator. Kursus i brug af sekvenator for LKFpersonale ved DJF, Foulum. DNA-oprensning med ny og bedre metode. Afprøvning af programmet NTSYS til slægtskabsanalyse. DNA-oprensning og manuel scoring af AFLP-geler. DNA- oprensning. Beregning af slægtskab ud fra AFLP data på 116 sorter. Kursus på Foulum. Optimering af SSR kørsel på sekvenator før flytning til Vandel. Assistance i forbindelse med flytningen og DNA-oprensning. Indkøring af sekvenator på Vandel opstarten i Vandel. Kromosomlokalisering af nye og måling af SSR. Slægtskabsanalyser. SSR fra Ålborg Universitet og STPRINSPG (en SSR fra litteraturen).. Sekventering af seks SSR fra Ålborg Universitet. Præsentation af resultater ved Plant Biotech Denmark møde i København. DNA-oprensning. Måling af SSR på sekvenator. Slægtskabsanalyser. Præsentation af resultater ved Plant Biotech Denmark møde i København. DNA-oprensning. Der er oprenset DNA fra både in vitro planter, drivhusplanter og planter fra marken. Plantematerialet blev til og med 2005 lynfrosset i flydende kvælstof i reagensglas med teflonkugler og knust på rysteapparat (Vortex). Fra 2006 lejedes en svingmølle (Retsch, Mixer mill 301), der knuste plantematerialet meget hurtigere og overflødiggjorde den flydende kvælstof. Der er i projektet afprøvet flere metoder til oprensning af DNA. I 2002 blev en metode med chloroform/isoamylalkohol og isopropanol tilpasset, dels fra DJF, dels fra Sejet forædlingsstation. Metoden gav et højt udbytte af DNA. Indledende afprøvninger på Foulum viste, at kvaliteten var god nok, og alle oprensningerne i 2002 blev derfor foretaget med denne metode. Efterfølgende viste det sig, at alt for mange analyser ikke virkede, så vi besluttede at finde en bedre metode i Der er udviklet mange færdige kits til oprensning af forskellige typer DNA. Et af dem, Nucleospin, blev testet i februar/marts Det gav DNA af høj kvalitet, men i så små mængder, at metoden blev opgivet. Dernæst prøvedes kittet Genelute, der gav høj-kvalitetsdna i rimelige mængder. Dette kit er vi fortsat med siden. AFLP Markører af typen AFLP blev brugt i begyndelsen af projektet. Ved AFLP skæres kartoflernes DNA i mange små stykker vha. såkaldte restriktionsenzymer. Disse stykker mærkes med et

5 radioaktivt stof, mangfoldiggøres og køres på en gel. De forskellige bånd kan ses på et billede af gelen. En enkelt kombination kan give mere end 40 forskellige bånd og AFLP har derfor en høj informations værdi. Til dette projekt blev restriktionsenzymerne EcoRI (E), MseI (M) og HindIII (H) afprøvet med i alt 19 kombinationer (Tabel 2), og EB, EC samt EH blev brugt til markøranalyser. I Tabel 2 er primerne angivet med enzymforkortelsen samt yderligere tre bogstaver, der står for DNA-baser. Restriktionsenzymerne laver så mange stykker, at hvis de alle opformeres vil man på gelen ikke se en række bånd, men en udtværet skygge. For at reducere antallet af bånd opformeres kun de stykker, der starter med de tre angivne baser. Tabel 2. Afprøvede primerkombinationer til AFLP. Forkortelser: EcoRI (E), MseI (M) og HindIII (H) Markør Pri1navn Pri2navn EA E-AAC M-CAC EB E-AAC M-CAG EC E-ACA M-CAC ED E-ACA M-CAG EF E-ACT M-CAC EG E-ACT M-CAG EH E-AGA M-CAG EI E-ATG M-CAG EJ E-ATG M-CTA EK E-ATG M-CAC HA H-AAC M-CAC HB H-AAC M-CTA HC H-ACT M-CAC HD H-ACT M-CAG HE H-ACT M-CTA HF H-ATG M-CAC HH H-ATG M-CAG HJ H-ACA M-CAG HK H-ATC M-CAC Mikrosatellitter (SSR) Der benyttes 55 SSR fordelt på alle 12 kromosomer (Tabel 3) Tabel 3. Fordeling af de anvendte SSR mellem kartoflens 12 kromosomer. De, der er markeret med rødt, flankerer et gen for glycoalkaloidindhold på kromosom 1. SSR Kromosom SSR Kromosom STM0019b? StI015 VI STM2020 I StI016 VI LeatpacA I StI004 VI STM2030 I STM0019a VI STM5136(pt) I STM0028 VII STM5127 I STM0052 VII STM1049 I STM3009 VII STM1102 I, IX STM0031 VII STM2022 II TC84379 VII STM3001 II STM1005/STMFWAX VIII STM0038 II STM1024 VIII StI013 III STM1016 VIII

6 STM1054 III STWAX-2 VIII STM1058 III STM1104 VIII TC85064 III TC77529 VIII STM3016 IV STM1106 X STM5140 IV STM0051 X STM3023 IV +? TC74728 X STM1051 IX STSNRNA10 X? STM3012 IX STM2005 XI STM1052 IX TC84781 XI STM1017/STGLGPB IX STM5130 XI STM1031 V STM0025 XI TC75529 V STM0037 XI STPoAc58 V STM2028 XII STPRINPSG V STM0030 XII STM5148(pt) V STM0003 XII StI051 XII Principielt er forskellene i længderne af en bestemt SSR lig med minimum en repetition, men i praksis kan der være andre variationskilder som f.eks. tab af enkeltbaser. I Figur 3 ses en SSR med dels store spring i længde svarende til hele repetitioner, dels med et dobbeltbånd, der svarer til en forskel på en base (indrammet). Disse variationer er lige så gode markører som de hele spring og registreres så vidt det er muligt at skelne dem. STM1052 sæt 7 grøn SSR længde, antal baser Hold Figur 3. Eksempel på SSR med to meget tætliggende bånd (indrammet), der er svære at skille Før måling sker en opformering ved hjælp af PCR, hvor en fluorescensfarve sættes på. De enkelte SSR samles i sæt, der så vidt muligt kan opformeres sammen i PCR, og som ikke overlapper for

7 meget (Figur 4). Hvorfor henvises der til Figur 5 før Figur 4? De fluorescerende farver overlapper i bølgelængde, så f.eks. en meget kraftig rød farve også vil ses som en gul top. Man kan delvis, men ikke helt, undgå problemet ved at definere den relative intensitet af de forskellige farver i de fire målepunkter. De gennemblødningstoppe, der ikke fjernes af maskinen, må derefter vurderes manuelt (Figur 5). Sæt nr STM1049 TC85064 TC77529 TC74728 STM1017/ST 13 STM0019b STM0019a STM5148(pt STM STM5140 STM1058 STM5136(pt STSNRNA10 11 STM0007 STM3023 STM0003 STM TC84379 STM5130 STM STM0025 TC84781 StI013 STM0031 STM STM3012 STPRINPSG STM1052 STM STM3001 STM1102 STPoAc58 STM STM1104 STWAX-2 STM2030 StI016 StI004 5 STM0030 STM1016 STM0051 StI015 4 LeatpacA STM3016 STM2005 STM STM2022 TC77529 STM2028 STM1005/ST 2 STM1106 STM1031 STM1051 STM STM SSR længde, antal baser

8 Figur 4. Størrelser af de anvendte SSR. I hvert sæt er der minimum en SSR af hver af de fire farver. Figur 5. SSR toppe. Den gule top (tegnet med sort for at kunne ses) er meget kraftig og bløder igennem i både den grønne og den røde farve. Slægtskabsberegning Til at beregne, hvor tæt beslægtede sorterne er, benyttes programmet NTSYS. Det er et specielt statistikprogram, der sammenligner hver sort med hver af de andre og beregner, hvor ens, de er. Disse beregninger placeres i en tabel, hvorfra fingerprintoplysninger hentes til krydsningsplanlægning (Figur 2). Ud fra tabellen kan programmet tegne et familietræ, der grupperer sorterne efter, hvor ens deres DNA er (Figur 6). Træet læses fra venstre mod højre. Jo mere forskellige to sorter er, jo længere mod venstre ligger forgreningspunktet. Familietræet anvendes til at få overblik over de mulige krydsningspartnere og udpege interessante sorter med en anderledes genetisk baggrund. Kromosomlokalisering En af fordelene ved SSR frem for AFLP er, at de er anvendelige som ankermarkører til identifikation af koblingsgrupper, dvs. at SSR, der i andre studier er kortlagt på bestemte kromosomer, også med meget stor sandsynlighed er placeret på samme kromosom i de aktuelle kloner. Nye designede SSR-markører vil kunne lokaliseres ud fra disse ankermarkører vha. koblingsstudier. En sådan kortlægning af markører til kromosomer kræver at markørerne bliver testet i en familie, dvs. forældre og et passende antal ( ) afkom. Til dette formål var HCDHDN familien, som blev anvendt i et projekt vedr. glycoalkaloider, til rådighed. Først blev der gennemført laboratorieanalyser af alle markører og kloner. Derefter blev klonerne vurderet mht. om de havde båndet/båndene fra markørerne eller ej. Kun markører, der er polymorfe er informative.

9 Disse data blev brugt til kortlægningen som blev udført med computerprogrammet JoinMap. Programmet er baseret på statistiske analyser, som beregner rækkefølgen af og afstanden imellem markørerne. Først udvælger programmet de to markører, som med størst sandsynlighed er tættest koblede, og derefter tilføjes mindre tæt koblede markører. Alle markører som er koblet direkte eller indirekte danner en koblingsgruppe. I kartofler findes 12 forskellige koblingsgrupper svarende til de 12 forskellige kromosomer. Hvilket kromosomnummer nye markører er lokaliseret på, kan defineres ud fra ankermarkørerne. I dette projekt blev de seks markører, der starter med TC samt STPRINPSG kortlagt (Tabel 3). Sekventering For at udvide antallet af anvendelige SSR-markører i kartofler blev der udviklet seks markører specifikt til dette projekt, og disse markører blev sekventeret. Ved en sekventering fastlægges rækkefølgen af baser, for at efterprøve om markøren er identisk med den kartoffel sekvens, hvorfra den oprindeligt blev designet. Dette er også nødvendigt for at kende den nøjagtige opbygning af DNA-stykket og størrelsen af markøren. Sekventeringen foregår ved at hver enkelt SSR-markør splejses ind i en bestemt type Eschericia coli bakterie, hvorefter det inkorporerede stykke mangfoldiggøres ved opformering af bakterierne i et vækstsubstrat. Det interessante DNA-stykke kan skæres ud og analyseres på en sekvenator, hvorved rækkefølgen af baser fastlægges. Sekventeringen af de seks nyudviklede SSR i dette projekt (Figur 7) viste at der var god overensstemmelse mellem den forventede og den aktuelle rækkefølge af baser.

10 Figur 6. Slægtskabstræ for 122 sorter analyseret med SSR

11 TC74728: HDN-45 1 GGACATGAGGAGAGGCAGAGCAACTCCGGCGGTG CCGGTGAAGCC S. tuberosum 1 GGACATGAGGAGAGGCAGAGCAACTCCGGCGGCGGCGGCGGCGGCGGCGCCGGTGAAGCC ******************************** * *********** HDN AGATGGATCTGGTGGATTGAACAAGAT S. tuberosum 61 AGATGGATCTGGTGGATTGAACGAGAT ********************** **** TC75529: 90-HAG-15 1 AGAAGCCGCCAAGCTTGAGCGCCAGCGCCGCCGTCAAGAGGCAGCCGCCGCTGCCGCCGC S. tuberosum 241 AGAAGCCGCCAAGCTTGAGCGCCAGCGCCGCCGTCAAGAGGCAGCCGCCGCCGCCGCCGC *************************************************** ******** 90-HAG C------ACTGCTGTCTCCACCGTCTCCA S. tuberosum 301 CGCCGCCACTGCTGTCTCCACCGTCTCCA * ********************** TC77529: HDN TGGATCTCACGCGCCACCAGAATGGTGGTAATAATTTGGGAGACTACTACGAATCTGAAG S. tuberosum 1 TGGATCTCACGCGCCACCAGAATGGTGGTAATAATTTGGGAGACTACTACGAATCTGAAG ************************************************************ HDN AGGAAGATGATGATGATGATGATGATGATAGTGGTGAGATTCCTATAGCACATCCTGTAA S. tuberosum 61 AGGAAGAAGATGATGATGATGATGATGATAGTGGTGAGATTCCTATAGCACATCCTGTAA ******* **************************************************** HDN CGGATTACGGGATCC S. tuberosum 121 CGGATTACGGGATCC *************** TC84379: HDN-05 1 ACCATCACCACCACCTTCAGCCGCCGCAGCTGCAGCAGCAGCAGCT------TGTGAATC S. tuberosum 149 ACCATCACCACCACCTTCAGCCGCCGCAGCTGCAGCAGCAGCAGCAGCAGCATGTGAATC ********************************************* ******** HDN GTGAACAAGGAGGAGGAGGAGCTGCAGTAAGGAACACCGTC S. tuberosum 209 GTGAACAAGGAGGAGGAGGAGCTGCAGTAAGGAACACCGTC ***************************************** TC84781: HDN-02 1 GGGTACTTCACTTTGTGGTAAGCCACTTGATTCATGTGATGGTAGTAGTAGTAGTAGTA- S. tuberosum 1 GGGTACTTCACTTTGTGGTAAGCCACTTGATTCATGTGATGGTAGTAGTAGTAGTAGTAG *********************************************************** HDN TTGGAGAAGGTAAAAAGAAGAAACTTTCTGGTGGAGCAATTGCTGGTATAGTAATTGG S. tuberosum 61 TATTGGAGAAGGTAAAAAGAAGAAACTTTCAGGTGGAGCAATTGCTGGTATAGTAATTGG **************************** ***************************** HDN TTGTGTTGTTAGTTTGCTTTTGCTTCTTTGTTTGCTGTTTTTCTGTTGTAGAAAAAGGGG S. tuberosum 121 TTGTGTTGTTGGTTTGCTTTTGCTTCTTTGTTTGCTGTTTTTCTGTTGTAGAAAAAGGGG ********** ************************************************* HDN TAAAAAAGAAACAAGATCTGCTGATAGTGGTG S. tuberosum 181 TAAAAAAGAAACAAGATCTGCTGATAGTGGTG ******************************** TC85064: HDN-05 1 GTGCTCAACTTTCCATGTCTGTACCATTAGAACATGATTATATAGGTCTATCAGAACCTT S. tuberosum 1 GTGCTCAACTTTCCATGTCTGTACCATTAGAACATGATTATATAGGTCTATCAGAACCTT ************************************************************ HDN CTTTAATGGAAAAAAGTTCTGATAAGATTTCTTCTTCTTCTTCTTC---CTCTGTTCTCA S. tuberosum 61 CTTTAATGGAAGAAAGTTCTGATAAGATTTCTTCTTCTTCTTCTTCTTCCTCTGTTCTCA *********** ********************************** ***********

12 HDN ACCTGAAAGAGACTGAGCTGAGACTTGGGTT S. tuberosum 121 ACCTGAAAGAGACTGAGCTGAGACTTGGGTT ******************************* Figur 7. Sammenligning af sekvenser for seks udviklede SSR mellem 90-HAG-15 forælderen eller HCDHDN afkom (HDN-02, HDN-05, HDN-45 og HDN-135) og Solanum tuberosum (kartoffel). Stjerner indikerer identiske nukleotid enheder. Primer sekvenser er understreget, og den repetetive sekvens er markeret med fed skrift. Afledt arbejde PÅ LKF har den opkvalificering, der er sket som følge af projektet, åbnet for en vifte af nye muligheder. I projektet Udvikling af et nyt værktøj til forædling af økologiske kartofler med høj naturlig skimmelresistens vha. DNA-markører undersøges, om skimmelresistensen i et par af de ungarske sorter fra Sarpo-forædlingsstationen er forbundet med bestemte SSR-kombinationer. Vi ved, at resistensen er knyttet til et R-gen og let brydes. Hvis man vha. markører kan udpege sorter med flere R-gener, vil deres resistens være væsentlig mere holdbar. I projektet Glykoalkaloider i kartofler er der identificeret to SSR, der flankerer et gen for glykoalkaloidindhold i knolde. Disse SSR indgår i de 55, der bliver kørt på alle sorter, og kan derfor benyttes til at vurdere glykoalkaloidindholdet i nye krydsningspartnere. Det er planlagt at samkøre SSR-data med en række forskellige egenskaber som tørstof, friteringsfarve, udbytte og resistenser for alle målte sorter for på den måde at prøve at finde brugbare sammenhænge, der kan udnyttes i forædlingen. Konklusion Projektet har været en stor succes. LKF s personale er blevet i stand til selvstændigt at udføre DNAarbejde og et stort antal sorter er analyseret. Resultaterne indgår i høj grad i krydsningsplanlægningen og som et nødvendigt fundament for videre udnyttelse af DNAteknikkerne. Denne overførsel af viden er sket i sidste øjeblik, da der ikke længere arbejdes med kartoffelmarkører ved DJF. Offentliggørelser vedrørende projektet Sørensen KK, DNA-markører - et redskab til kartoffelforædling. Kartoffelproduktion 31(5): 4-8 Sørensen KK, HG Kirk, J Emmersen, Familietræer i kartofler og forædling efter højere udbytte. Kartoffelproduktion 33(4): 8-9 Artiklerne fra Kartoffelproduktion kan læses på: Sørensen KK, HG Kirk, J Emmersen, Microsatellites used for estimation of relationship between potato breeding clones. I: Plant Biotech Denmark Annual meeting 2007 January 23-24, University of Copenhagen. Posters 9: Breeding Bach, IC, KK Sørensen og HG Kirk, Kartoflens genetiske puslespil klassisk forædling og ny teknologi. slespil_klassisk_foraedling_og_ny_teknologi

Supplerende tilskud til projekt under FØTEK-4, finansieret af Direktoratet for FødevareErhverv

Supplerende tilskud til projekt under FØTEK-4, finansieret af Direktoratet for FødevareErhverv Slutrapport Supplerende tilskud til projekt under FØTEK-4, finansieret af Direktoratet for FødevareErhverv Titel Glycoalkaloider i kartofler Projektansvarlig og deltagere Projektansvarlig: Forskningsleder,

Læs mere

Introduktion af resistens mod Hvid cystenematod (Globodera pallida) i fremtidige danske kartoffelsorter. Løbetid: Statusrapport 2011

Introduktion af resistens mod Hvid cystenematod (Globodera pallida) i fremtidige danske kartoffelsorter. Løbetid: Statusrapport 2011 Introduktion af resistens mod Hvid cystenematod (Globodera pallida) i fremtidige danske kartoffelsorter. Løbetid: 2009-2012 Statusrapport 2011 Ansøger: Landbrugets Kartoffelfond Grindstedvej 55 7184 Vandel

Læs mere

Anvendelse af DNA markører i planteforædlingen

Anvendelse af DNA markører i planteforædlingen Anvendelse af DNA markører i planteforædlingen Forsker Gunter Backes, Afdeling for Planteforskning, Forskningscentret Risø DNA-markører på kontaktfladen mellem molekylær genetik og klassisk planteforædling

Læs mere

Introduktion af resistens mod Hvid cystenematod (Globodera pallida) i fremtidige danske kartoffelsorter. Løbetid: 2009-2012 Slutrapport

Introduktion af resistens mod Hvid cystenematod (Globodera pallida) i fremtidige danske kartoffelsorter. Løbetid: 2009-2012 Slutrapport Introduktion af resistens mod Hvid cystenematod (Globodera pallida) i fremtidige danske kartoffelsorter. Løbetid: 2009-2012 Slutrapport Landbrugets Kartoffelfond, Grindstedvej 55, 7184 Vandel, www.lkfvandel.dk

Læs mere

PCR (Polymerase Chain Reaction): Opkopiering af DNA

PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR til at opkopiere bestemte DNA-sekvenser i en prøve er nu en af genteknologiens absolut vigtigste værktøjer. Peter Rugbjerg, Biotech Academy PCR (Polymerase

Læs mere

Kartoflens genetiske puslespil

Kartoflens genetiske puslespil Kartoflens genetiske puslespil klassisk forædling og ny teknologi Kartoffelforædling lyder umiddelbart som en stilfærdig beskæftigelse, men forædleren skal være beredt på våbenkapløb med en svamp, klar

Læs mere

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et:

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: F2011-Opgave 1. En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: Forward primer: 5 CC ATG GGT ATG AAG CTT TGC AGC CTT

Læs mere

Restriktionsenzymer findes Genkendelsessekvens

Restriktionsenzymer findes Genkendelsessekvens Restriktionsenzymer Skanning Restriktionsenzymer findes i bakterier (forsvarsmekanisme) IKKE i eukaryote celler 3-5 - 5-3 - Restriktionsenzyme Genkendelsessekvens Palindromisk Otto, Anna, radar Madam I

Læs mere

Læring af test. Rapport for. Aarhus Analyse Skoleåret

Læring af test. Rapport for. Aarhus Analyse  Skoleåret Læring af test Rapport for Skoleåret 2016 2017 Aarhus Analyse www.aarhus-analyse.dk Introduktion Skoleledere har adgang til masser af data på deres elever. Udfordringen er derfor ikke at skaffe adgang

Læs mere

Ansøgning om tilskud i 2017

Ansøgning om tilskud i 2017 Ansøgning om tilskud i 2017 1. Markør-assisteret indkrydsning af brokresistens 2. Ansøger og projektansvarlig a. Navn og adresse: Danespo A/S, Ryttervangen 1, 7323 Give b. CVR-nummer: 10440831 c. web-adresse:

Læs mere

Slutrapport for projektet Bioaktive stoffer i kartofler under tørkestress

Slutrapport for projektet Bioaktive stoffer i kartofler under tørkestress Slutrapport for projektet Bioaktive stoffer i kartofler under tørkestress Projektansvarlig LKF, Grindstedvej 55, 7184 Vandel web-adresse: lkf@lkfvandel.dk Projektansvarlig: Hanne Grethe Kirk, hgk@lkfvandel.dk

Læs mere

GAPDH PCR modul Manual

GAPDH PCR modul Manual GAPDH PCR modul Manual Katalog nr. 166-5010EDU explorer.bio-rad.com Kopiering kun tilladt til undervisningsbrug Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende

Læs mere

MiSeq i den daglige rutine. MRSA og VRE Isolater.

MiSeq i den daglige rutine. MRSA og VRE Isolater. MiSeq i den daglige rutine. MRSA og VRE Isolater. 4. juni 2014 DTU Peder Worning, KMA Hvidovre Hvorfor Genomsekventere i Rutinen? Hvad bruger vi DNA-sekvenser til? Typning og bestemmelse af MRSA PCR baserede

Læs mere

Nye og traditionelle metoder i planteforædling. Søren K. Rasmussen Institut for Plante- og Jordbrugsvidenskab, 27. september 2016

Nye og traditionelle metoder i planteforædling. Søren K. Rasmussen Institut for Plante- og Jordbrugsvidenskab, 27. september 2016 Nye og traditionelle metoder i planteforædling Søren K. Rasmussen Institut for Plante- og Jordbrugsvidenskab, 27. september 2016 12-10-2016 2 Traditionel forædling Vælge forældrene Krydse forældrene Selektere

Læs mere

23. marts Afrapportering Titel. Betydning af klortilførsel for kvaliteten af spisekartofler

23. marts Afrapportering Titel. Betydning af klortilførsel for kvaliteten af spisekartofler 23. marts 2011 Afrapportering 2010 Titel. Betydning af klortilførsel for kvaliteten af spisekartofler Projektansvarlig og deltagere. Landskonsulent Lars Bødker Videncentret for landbrug, e-mail: lab@vfl.dk

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2014/2015, eksamen maj/juni 2015 Institution Kolding HF & VUC Uddannelse Fag og niveau Lærer(e)

Læs mere

Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport

Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport Projektperiode april december 2012 Deltagere Andreas Blennow (projektleder), Susanne L. Jensen (PhD studerende), Lisbeth

Læs mere

Kontrolmark for økologisk dyrkede læggekartofler

Kontrolmark for økologisk dyrkede læggekartofler Rapport Kontrolmark for økologisk dyrkede læggekartofler Støttet af Kartoffelafgiftsfonden Januar 214 Projektansvarlig og deltagere. Landskonsulent Lars Bødker, Videncentret for Landbrug, e-mail: lab@vfl.dk

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

Ansøgning om tilskud i 2017

Ansøgning om tilskud i 2017 1. Genbank for kartofler. Ansøgning om tilskud i 2017 2. Ansøger og projektansvarlig a. Navn og adresse: Danespo A/S, Ryttervangen 1, 7323 Give b. CVR-nummer: 10440831 c. web-adresse: www.danespo.com d.

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet?

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Lyn dine gener op! En baglæns besked, gemt i 'backup-dna'et'

Læs mere

Sorten er afgørende for planters evne til at sætte gode rødder

Sorten er afgørende for planters evne til at sætte gode rødder Sorten er afgørende for planters evne til at sætte gode rødder Ny forskning viser, at evnen til at etablere et godt rodnet og til at optage næringsstoffer varierer meget fra sort til sort i vårhvede, salat

Læs mere

MindLab. Institution MindLab. Forfattere Christian Bason, innovationschef Niels Hansen, projektleder. Opgavetypen der eksemplificeres Vidensproduktion

MindLab. Institution MindLab. Forfattere Christian Bason, innovationschef Niels Hansen, projektleder. Opgavetypen der eksemplificeres Vidensproduktion MindLab Institution MindLab Forfattere Christian Bason, innovationschef Niels Hansen, projektleder Opgavetypen der eksemplificeres Vidensproduktion Kort om MindLab MindLab er en udviklingsenhed, der har

Læs mere

Inholdsfortegnelse: 1. Allel-skema

Inholdsfortegnelse: 1. Allel-skema Stamtræsøvelse Inholdsfortegnelse: 1. Allel-skema 2. Hvem er far til Thor? 3. Saml stamtræet 4. Hvilke mænd skal Thor vælge til faderskabstesten? 5. Faderskabstesten 6. Ordforklaringer Du skal nu hjælpe

Læs mere

Bilag E: Besvarelse af spørgeskemaundersøgelse, del 2

Bilag E: Besvarelse af spørgeskemaundersøgelse, del 2 : Besvarelse af spørgeskemaundersøgelse, del 2 Kategori 1 At være i stand til at finde og bruge informationer handler for mig om at: Figur E1a: Kunne bruge IT Helt enig 13 57% Enig 8 35% Ved ikke 1 4%

Læs mere

Dandy Walker Like Malformation

Dandy Walker Like Malformation Dandy Walker Like Malformation Speciale af Hedvig Christiansson and Evelina Kling Vegeby Præsenteret af Helle Friis Proschowsky Dyrlæge, Phd., Specialkonsulent hos DKK DWLM projektet 1. Hvad er DWLM 2.

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

GENBANK FOR KARTOFLER Statusrapport 2013

GENBANK FOR KARTOFLER Statusrapport 2013 GENBANK FOR KARTOFLER Statusrapport 2013 Ansøger: Landbrugets Kartoffelfond Grindstedvej 55 7184 Vandel www.lkfvandel.dk Projektledelse: Jens Kr. Ege Olsen, jko@lkfvandel.dk Formål: Formålet med projektet

Læs mere

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' Forskere kan lave præcise ændringer

Læs mere

LUP læsevejledning til regionsrapporter

LUP læsevejledning til regionsrapporter Indhold Overblik... 2 Sammenligninger... 2 Hvad viser figuren?... 3 Hvad viser tabellerne?... 5 Eksempler på typiske spørgsmål til tabellerne... 6 Øvrigt materiale Baggrund og metode for LUP Fødende: Analysemetoderne,

Læs mere

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 20. maj 2008. Kl. 09.00 14.00 STX081-BIA STUDENTEREKSAMEN MAJ 2008

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 20. maj 2008. Kl. 09.00 14.00 STX081-BIA STUDENTEREKSAMEN MAJ 2008 STUDENTEREKSAMEN MAJ 2008 BIOLOGI A-NIVEAU Tirsdag den 20. maj 2008 NY ORDNING Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX081-BIA Undervisningsministeriet Side

Læs mere

Genetiske fingeraftryk identificerer torsk

Genetiske fingeraftryk identificerer torsk Genetiske fingeraftryk identificerer torsk Einar Eg Nielsen (een@dfu.min.dk) Michael Møller Hansen (mmh@dfu.min.dk) Danmarks Fiskeriundersøgelser, Afdeling for Ferskvandsfiskeri Forskere ved DFU har vist

Læs mere

Resultat af Ærteforsøg 2010

Resultat af Ærteforsøg 2010 Resultat af Ærteforsøg 2010 Ved et kursus på Institut for Jordbrug og Økologi, KU Life, blev dette ærteforsøg gennemført, med undervisning af Gunter Backes og Jihad Orabi. Skrevet af Søren Holt Frøsamlerne

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ofte stillede spørgsmål, januar 2011

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ofte stillede spørgsmål, januar 2011 Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ofte stillede spørgsmål, januar 2011 Svar på ofte stillede spørgsmål om HD - den første i en

Læs mere

Indhold. Nyheder og vejledninger. 2. maj 2016 Manuel tilpasning af investeringsbevisnote

Indhold. Nyheder og vejledninger. 2. maj 2016 Manuel tilpasning af investeringsbevisnote 2. maj 2016 Manuel tilpasning af investeringsbevisnote Indhold Manuel tilpasning af investeringsbevisnote... 2 Rettelse af summer fælles... 2 Rettelse af summer person 1... 5 Rettelser af summer person

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

INSTITUT FOR HUSDYRBIOLOGI OG -SUNDHED DET JORDBRUGSVIDENSKABELIGE FAKULTET AARHUS UNIVERSITET RAPPORT

INSTITUT FOR HUSDYRBIOLOGI OG -SUNDHED DET JORDBRUGSVIDENSKABELIGE FAKULTET AARHUS UNIVERSITET RAPPORT RAPPORT Næringsværdien i gastæt lagret korn sammenlignet med lagerfast korn Hanne Damgaard Poulsen Forskningsleder Dato: 24. september 2010 Side 1/5 Baggrund: Traditionelt lagres korn ved at det tørres

Læs mere

Bilagsnotat til: De nationale tests måleegenskaber

Bilagsnotat til: De nationale tests måleegenskaber Bilagsnotat til: De nationale tests måleegenskaber Baggrund Der er ti obligatoriske test á 45 minutters varighed i løbet af elevernes skoletid. Disse er fordelt på seks forskellige fag og seks forskellige

Læs mere

Undervisningsbeskrivelse fra august 2014

Undervisningsbeskrivelse fra august 2014 Undervisningsbeskrivelse fra august 2014 Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Oktober 2015 Institution Hansenberg Gymnasium Uddannelse Fag og niveau Lærer(e) Hold HTX Bioteknologi

Læs mere

Uddannelse som virtuel projektleder

Uddannelse som virtuel projektleder Uddannelse som virtuel projektleder Udnytter din virksomhed potentialet i virtuel projektledelse? Nye teknologier tordner frem i virksomheder og giver mulighed for at kommunikere og samarbejde på nye måder.

Læs mere

Regnskovens hemmeligheder

Regnskovens hemmeligheder Center for Undervisningsmidler, afdeling København Regnskovens hemmeligheder Øvelsesvejledning Formål Et gen for et kræfthelbredende protein er blevet fundet i nogle mystiske blade i regnskoven. Forskere

Læs mere

Guitar og noder. Melodispil og nodelære 1. position. John Rasmussen. Guitarzonen.dk

Guitar og noder. Melodispil og nodelære 1. position. John Rasmussen. Guitarzonen.dk Guitar og noder Melodispil og nodelære 1. position John Rasmussen Guitarzonen.dk Guitar og noder er udgivet som e-bog 2011 på guitarzonen.dk Forord Denne bog gennemgår systematisk tonernes beliggenhed

Læs mere

Indeks for HD BLUP - AM

Indeks for HD BLUP - AM Indeks for HD Per Madsen Seniorforsker Aarhus Universitet Det Jordbrugsvidenskabelige Fakultet Institut for Genetikk og Bioteknologi Forskningscenteret Foulum, Danmark Hofteledsdysplasi (HD) er en lidelse,

Læs mere

Anvendelse af DNA markører i planteforædlingen. - genteknik uden GMO er. Gunter Backes Forskningscenter Risø

Anvendelse af DNA markører i planteforædlingen. - genteknik uden GMO er. Gunter Backes Forskningscenter Risø Anvendelse af DNA markører i planteforædlingen - genteknik uden GMO er Gunter Backes Forskningscenter Risø Inddeling Hvad er molekylære markører? Hvordan kan man bruge dem? Konklusion Inddeling Hvad er

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

Læsevejledning til resultater på regions- og sygehusplan

Læsevejledning til resultater på regions- og sygehusplan Læsevejledning til resultater på regions- og sygehusplan Indhold 1. Overblik...2 2. Sammenligninger...2 3. Hvad viser figuren?...3 4. Hvad viser tabellerne?...6 6. Eksempler på typiske spørgsmål til tabellerne...9

Læs mere

Langtved Data A/S Nyhedsbrev

Langtved Data A/S Nyhedsbrev Langtved Data A/S Nyhedsbrev Nr. 2 Indledning I denne udgave af nyhedsbrevet har vi valgt at sætte fokus på interessante faciliteter som allerede benyttes af nogle af vores kunder og som kunne være interessante

Læs mere

Kartoffelafgiftsfonden - ændringsbudget Budget 2015 (senest indsendte)

Kartoffelafgiftsfonden - ændringsbudget Budget 2015 (senest indsendte) Kartoffelafgiftsfonden - ændrings Beløb i 1000 kr. Relativ fordeling af C i % Ændring A => B 100*(B-A)/A Note A B C D INDTÆGTER: 1 Overført fra forrige år 571 2.189 283,4 2 Produktionsafgifter 620 620

Læs mere

Litium-ion batterimanual. Ebike Elcykler

Litium-ion batterimanual. Ebike Elcykler Litium-ion batterimanual Ebike Elcykler Rev 30-12-2008 Litium ion batteriet Funktion Batteriet der forsyner elcyklen med strøm er et såkaldt litium ion batteri (Spænding: 36 Volt (V), Kapacitet: 10 Ampere

Læs mere

Test af tryk under dæk RAPPORT. Opmåling af kontaktfladeareal under dæk og beregning af specifikt tryk i kontaktfladearealet

Test af tryk under dæk RAPPORT. Opmåling af kontaktfladeareal under dæk og beregning af specifikt tryk i kontaktfladearealet Transportudvalget 2013-14 TRU Alm.del Bilag 358 Offentligt Test af tryk under dæk Opmåling af kontaktfladeareal under dæk og beregning af specifikt tryk i kontaktfladearealet RAPPORT AF Jørgen Pedersen

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2016/2017, eksamen december 2016 Institution Kolding HF & VUC Uddannelse Fag og niveau Lærer(e)

Læs mere

MEDDELELSE TIL MEDLEMMERNE

MEDDELELSE TIL MEDLEMMERNE EUROPA-PARLAMENTET 2009-2014 Udvalget for Andragender 8.10.2010 MEDDELELSE TIL MEDLEMMERNE Om: Andragende 0281/2010 af Marie Moritz, tysk statsborger, om dyrkningen af den genetisk modificerede kartoffelsort

Læs mere

Kommissionen har fastsat, at miljøinvesteringer foretaget via driftsprogrammet, som udgangspunkt, skal have en minimumseffekt på 25 %.

Kommissionen har fastsat, at miljøinvesteringer foretaget via driftsprogrammet, som udgangspunkt, skal have en minimumseffekt på 25 %. Ministeriet for Fødevarer, Landbrug og Fiskeri Institution: NaturErhvervstyrelsen Kontor/initialer: Center for projekttilskud, virksomhed / helh Kategori: Producentorganisationer Dato: 10. juli 2012 Miljøpositivliste

Læs mere

1. Manuel og automatisk registrering af punkter Her gennemgås hvordan punkter optages manuelt eller automatisk. Fra køreskærmen trykkes på Værktøj

1. Manuel og automatisk registrering af punkter Her gennemgås hvordan punkter optages manuelt eller automatisk. Fra køreskærmen trykkes på Værktøj Optagelse af punkter 1. Manuel og automatisk registrering af punkter Her gennemgås hvordan punkter optages manuelt eller automatisk. Fra køreskærmen trykkes på Værktøj 2. Valgmuligheder for lagring af

Læs mere

Perspektiverne for anvendelse af GMOkartofler. Kåre Lehmann Nielsen, Aalborg Universitet

Perspektiverne for anvendelse af GMOkartofler. Kåre Lehmann Nielsen, Aalborg Universitet Perspektiverne for anvendelse af GMOkartofler Kåre Lehmann Nielsen, Aalborg Universitet Fremtidens udfordring for Landbruget 9 milliarder mennesker på jorden i 2050. Norman Borlaug (2005): - By 2050 we

Læs mere

Arbejde med Regioner Lister, Playlists, og Cutlists i Sound Forge Pro

Arbejde med Regioner Lister, Playlists, og Cutlists i Sound Forge Pro Arbejde med Regioner Lister, Playlists, og Cutlists i Sound Forge Pro Gary Rebholz Du har sikkert allerede ved, at Sound Forge Pro software kan bruges til en imponerende række af audio opgaver. Alt fra

Læs mere

Farm Manager medarbejder: KMZ

Farm Manager medarbejder: KMZ J A S O P E L SF A R MMA NA G E R V A R ENR. : 4 0 2 0 0 0 3 9 D A NS K Titel: Basis bruger vejledning Side 2 of 8 1. Indholdsfortegnelse a. Punkt 2 - Forord b. Punkt 3 - System Introduktion c. Punkt

Læs mere

Vejledning. Tilskud til brun bi fra Læsø. Tilskudsåret 2015

Vejledning. Tilskud til brun bi fra Læsø. Tilskudsåret 2015 Vejledning Tilskud til brun bi fra Læsø Tilskudsåret 2015 Kolofon Vejledning Tilskud til brun bi fra Læsø, Tilskudsåret 2015 Denne vejledning er udarbejdet af NaturErhvervstyrelsen i 2015 Fotograf(er):

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Forsøgsvejledning Navn: Side 1 af 7 Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA

Læs mere

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Liselotte Wesley Andersen Institut for Bioscience

Læs mere

PRØVEPROJEKTER - SLUTRAPPORT

PRØVEPROJEKTER - SLUTRAPPORT PRØVEPROJEKTER - SLUTRAPPORT E. coli ESBL i dansk slagtefjerkræ og kyllingekød Projekt J. nr.: 2010-20-64-00284 BAGGRUND Som det fremgår af DANMAP rapporterne fra 2010 og 2011, er der tidligere påvist

Læs mere

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 19.oktober 2015 Liselotte Wesley Andersen

Læs mere

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D.

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D. 11-11-2013 Testet i udlandet Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 Forfatter: Janus Vang, Ph.D. ANSVARLIG: REGIN W. DALSGAARD, BESTYRELSESFORMAND FOR VINNUFRAMI INTRODUKTION Færøernes

Læs mere

7. Daglige opgaver. Udsendelse af hjemkaldelser og reserveringsmeddelelser

7. Daglige opgaver. Udsendelse af hjemkaldelser og reserveringsmeddelelser 7. Daglige opgaver Udsendelse af hjemkaldelser og reserveringsmeddelelser Indhold Udsendelse af hjemkaldelses- og reserveringsmeddelelser... 3 Hjemkaldelsesprofil: Låners lån eller filialens udlån?...

Læs mere

Nationale test. v. Marie Teglhus Møller. Slides er desværre uden eksempelopgaver, da disse ikke må udleveres. marie@eystein.dk

Nationale test. v. Marie Teglhus Møller. Slides er desværre uden eksempelopgaver, da disse ikke må udleveres. marie@eystein.dk Nationale test v. Marie Teglhus Møller Slides er desværre uden eksempelopgaver, da disse ikke må udleveres. marie@eystein.dk Oplæg for dagen Hvad er en pædagogisk test? Hvilke krav stilles der til opgaverne

Læs mere

Strandvejen 58. Gentoftegade 29, 2820 Gentofte, Danmark

Strandvejen 58. Gentoftegade 29, 2820 Gentofte, Danmark Capinordic A/S Strandvejen 58 Box 69 DK-2900 Hellerup Tlf. +45 8816 3000 Fax +45 8816 3003 CVR nr. 13255342 Selskabsmeddelelse nr. 14/2010 info@capinordic.com www.capinordic.com Den 9. april 2010 Dagsorden

Læs mere

Overskæring af læggekartofler

Overskæring af læggekartofler Overskæring af læggekartofler Skrevet af: Henrik Pedersen og Claus Nielsen AKV Langholt AmbA Gravsholtvej 92 9310 Vodskov i samarbejde med Lars Bødker, Videncentret for Landbrug Indhold Resumé... 3 Baggrund...

Læs mere

K-522. Betjeningsvejledning

K-522. Betjeningsvejledning K-522. Betjeningsvejledning 1 Beskrivelse Maskinen er specialudviklet til afbalancering af motorcykelhjul. I modsætning til en traditionel afbalanceringsmaskine, har K-22 en fast aksel, hvor det opspændte

Læs mere

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler DNA-profil analyse Indledning DNA-profil analyser eller i daglig tale DNA-fingeraftryk er en metode, der bruges, når man skal finde ud af, hvem der er far et barn, hvis der altså er flere muligheder. Det

Læs mere

Kjers. sygdom. Nyt fra forskningsfronten. Et studie der søger at påvise årsager til og behandling af denne hidtil uhelbredelige øjensygdom

Kjers. sygdom. Nyt fra forskningsfronten. Et studie der søger at påvise årsager til og behandling af denne hidtil uhelbredelige øjensygdom Kjers Nyt fra forskningsfronten sygdom Gitte Juul Almind Reservelæge, ph.d.-stud. Kennedy Centret Illustrationer: Mediafarm arvelig synsnerveskrumpning (ADOA - Autosomal Dominant Opticus Atrofi) Et studie

Læs mere

Vejledning i brug af Græsplanlægning ved Søren Greve Olesen, Sydvestjysk Landboforening

Vejledning i brug af Græsplanlægning ved Søren Greve Olesen, Sydvestjysk Landboforening Vejledning i brug af Græsplanlægning ved Søren Greve Olesen, Sydvestjysk Landboforening Indledning Græsplanlægning er et værktøj til planlægning af slæt og afgræsning. Det er udviklet som en hjælp til

Læs mere

Kennel Friis v/ Ejvind Friis Mikkelsen El-Vej 13, Seest, DK 6000 Kolding Tlf. (45) /5 52 83 03 Email: efriism@stofanet.dk

Kennel Friis v/ Ejvind Friis Mikkelsen El-Vej 13, Seest, DK 6000 Kolding Tlf. (45) /5 52 83 03 Email: efriism@stofanet.dk Kennel Friis v/ Ejvind Friis Mikkelsen El-Vej 13, Seest, DK 6000 Kolding Tlf. (45) /5 52 83 03 Email: efriism@stofanet.dk Foto: Friis Lara Mangler schæferhunden den genetiske variation? I pressen kan man

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Sommereksamen 2015 Institution 414 Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold HFe Biologi B Torben

Læs mere

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008 STUDENTEREKSAMEN AUGUST 2008 BIOLOGI A-NIVEAU Tirsdag den 19. august 2008 NY ORDNING Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX082-BIA Undervisningsministeriet

Læs mere

Bedømmelse af græsmarkens kløverindhold

Bedømmelse af græsmarkens kløverindhold Markbrug nr. 225 Juni 2000 Bedømmelse af græsmarkens kløverindhold Marian Damsgaard Thorsted og og Karen Søegaard Afdeling for for Plantevækst og og Jord, Forskningscenter Foulum Ministeriet for Fødevarer,

Læs mere

Husk altid at have strøm på batteriet. Ved vinteropbevaring oplad batteriet en time hver 2. måned

Husk altid at have strøm på batteriet. Ved vinteropbevaring oplad batteriet en time hver 2. måned Batteri manual LiFePO4 batterier til Ebike Elcykler Husk altid at have strøm på batteriet. Ved vinteropbevaring oplad batteriet en time hver 2. måned Rev 5-4-2011 Litium jernfosfat batteriet Funktion Batteriet

Læs mere

Microsoft Project 2013 DK

Microsoft Project 2013 DK Claus Hansen & Peter Kragh Hansen Microsoft Project 2013 DK ISBN nr.: 978-87-93212-05-3 I n d h o l d s f o r t e g n e l s e Lidt om Microsoft Office Project 2013... 1 Hvorfor skal man anvende Microsoft

Læs mere

I HVAD ER SAMFUNDSVIDENSKABELIGE METODER?

I HVAD ER SAMFUNDSVIDENSKABELIGE METODER? Indhold Forord............................................. 7 Kapitel I HVAD ER SAMFUNDSVIDENSKABELIGE METODER?.......... 11 Kapitel II HVORDAN KAN MAN TILRETTELÆGGE UNDERSØGELSEN?..... 25 Kapitel III

Læs mere

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold:

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold: Manual til Wordpress Sådan opdaterer du din hjemmeside i Wordpress: Dette er en manual til de mest grundlæggende ting, så du selv kan redigere indholdet eller tilføje nyt på din hjemmeside. Guiden er skrevet

Læs mere

BRUGSANVISNING MODEL

BRUGSANVISNING MODEL BRUGSANVISNING MODEL Tillykke med Deres nye multimeter, før De går igang med at bruge produktet, bedes De læse denne brugsanvisning grundigt. I. ANVENDELSE Dette kategori III multimeter kan anvendes til

Læs mere

Forældretilfredshed 2012

Forældretilfredshed 2012 Forældretilfredshed 2012 Antal svar: 34, svarprocent: 81% LÆSEVEJLEDNING TIL SIDER MED FREKVENSOVERSIGT Tema / Fokus Spørgsmål fra det givne tema Benchmark / sammenligning med alle institutioner i undersøgelsen

Læs mere

REVISIONSFIRMAET ERIK CHRISTENSEN

REVISIONSFIRMAET ERIK CHRISTENSEN REVISIONSFIRMAET ERIK CHRISTENSEN STATSAUTORISEREDE REVISORER I/S VESTER VOLDGADE 106, 1552 KØBENHAVN V TLF: 33 13 29 12. FAX: 33 32 02 12. E-MAIL: EC@REVEC.DK ANSVARLIGE INDEHAVERE: HENNING ROSENVOLD.

Læs mere

Ansøgning om tilskud i 2017

Ansøgning om tilskud i 2017 . Ansøgning om tilskud i 2017 1. Titel. Resistens mod brok ( Synchytrium endobioticum). Kortlægning af gener, udvikling af brugbare markører og søgning efter ny resistens 2. Ansøger og projektansvarlig

Læs mere

matematik Demo excel trin 2 bernitt-matematik.dk 1 excel 2 2007 by bernitt-matematik.dk

matematik Demo excel trin 2 bernitt-matematik.dk 1 excel 2 2007 by bernitt-matematik.dk matematik excel trin 2 bernitt-matematik.dk 1 excel 2 2007 by bernitt-matematik.dk matematik excel 2 1. udgave som E-bog 2007 by bernitt-matematik.dk Kopiering af denne bog er kun tilladt efter aftale

Læs mere

IsenTekst Indhold til Internettet. Manual til Wordpress.

IsenTekst Indhold til Internettet. Manual til Wordpress. Manual til Wordpress Sådan opdaterer du din hjemmeside i Wordpress. Dette er en manual til de mest grundlæggende ting, så du selv kan redigere indholdet eller tilføje nyt på din hjemmeside. Guiden er skrevet

Læs mere

Bilag 4.A s MASH. Indhold

Bilag 4.A s MASH. Indhold Bilag 4.A s MASH Indhold 1.1 Indledning 1 1.1.1 Formål med undersøgelsen 1 1.1.2 Beskrivelse af smash metoden 1 1.2 s MASH målinger (omfang, placering og resultater) 1.2.1 Undersøgelsens forløb 5 5 1.2.2

Læs mere

Nokia-bilhåndsæt Installationsvejledning Brugervejledning

Nokia-bilhåndsæt Installationsvejledning Brugervejledning Nokia-bilhåndsæt Installationsvejledning Brugervejledning HSU-4 CUW-3 9232831 2. udgave 2004-2006 Nokia. Alle rettigheder forbeholdes. Kopiering, overførsel, overdragelse eller lagring af en del eller

Læs mere

LEKTION 22 FARVEBEHANDLING

LEKTION 22 FARVEBEHANDLING LEKTION 22 FARVEBEHANDLING I hvert eneste spil skal man som spilfører tage stilling til, hvordan samtlige fire farver skal spilles. Derfor er dette et vigtigt område i selve spilføringen. Mange kombinationer

Læs mere

VMP3-projekt: Udpegning af risikoområder for fosfortab til overfladevand

VMP3-projekt: Udpegning af risikoområder for fosfortab til overfladevand VMP3-projekt: Udpegning af risikoområder for fosfortab til overfladevand VMP3-projekt: Udpegning af risikoområder for fosfortab til overfladevand VMP3 Halvering af P-overskuddet 50.000 ha randzoner langs

Læs mere

Genomisk selektion ny teknologi, der virker i praksis

Genomisk selektion ny teknologi, der virker i praksis Genomisk selektion ny teknologi, der virker i praksis Mogens Sandø Lund Guosheng Su Bernt Guldbrandtsen Aarhus Universitet DJF Inst for Genetik og Bioteknologi Foulum Dansk Kvæg Kongres 23. Februar 2009

Læs mere

Teknikker til forædling af frø

Teknikker til forædling af frø Teknikker til forædling af frø Temamøde i Økologisk Landsforening 7/3-2015 Hans Henrik Kampmann VEGINOVA IVS Rytmen i et forædlingsprojekt Analysere markedet og markeds trends Analysere hvad der er muligt:

Læs mere

matematik Demo excel trin 1 preben bernitt bernitt-matematik.dk 1 excel 1 2007 by bernitt-matematik.dk

matematik Demo excel trin 1 preben bernitt bernitt-matematik.dk 1 excel 1 2007 by bernitt-matematik.dk matematik excel trin 1 preben bernitt bernitt-matematik.dk 1 excel 1 2007 by bernitt-matematik.dk matematik excel 1 1. udgave som E-bog 2007 by bernitt-matematik.dk Kopiering af denne bog er kun tilladt

Læs mere

Spillebeskrivelse. Rev. 02. Compu-Game A/S, Randersvej 36, DK 6700 Esbjerg Tlf.: 76 10 98 00 Fax: 76 10 98 98

Spillebeskrivelse. Rev. 02. Compu-Game A/S, Randersvej 36, DK 6700 Esbjerg Tlf.: 76 10 98 00 Fax: 76 10 98 98 Spillebeskrivelse Rev. 02 Compu-Game A/S, Randersvej 36, DK 6700 Esbjerg Tlf.: 76 10 98 00 Fax: 76 10 98 98 Opstillingsvejledning for Compu-Game automater. Indgreb i automatens elektriske og mekaniske

Læs mere

REGISTRERING AF TRÆNGSEL

REGISTRERING AF TRÆNGSEL REGISTRERING AF TRÆNGSEL MED BLUETOOTH Finn Normann Pedersen Jens Peder Kristensen Management Konsulent, KeyResearch Direktør, KeyResearch fnp@keyresearch.dk jpk@keyresearch.dk +45 29 89 31 16 +45 22 23

Læs mere

PowerPoint Intro 2010 Segment - en del af dit netværk

PowerPoint Intro 2010 Segment - en del af dit netværk PowerPoint Intro 2010 7 Arbejde med objekter Formål Udover at arbejde med almindelig tekst og punktopstillinger, kan du i PowerPoint indsætte diverse objekter. Med objekter menes der fx; billeder, figurer,

Læs mere

HASTEMEDDELELSE FOR SIKKER BRUG Reservebatterier og nye instruktioner til brugere af PAD 300/PAD 300P (hjertestarter med offentlig adgang)

HASTEMEDDELELSE FOR SIKKER BRUG Reservebatterier og nye instruktioner til brugere af PAD 300/PAD 300P (hjertestarter med offentlig adgang) september, 26 2012 HASTEMEDDELELSE FOR SIKKER BRUG Reservebatterier og nye instruktioner til brugere af PAD 300/PAD 300P (hjertestarter med offentlig adgang) Kære Kunde, Formålet med dette brev er at informere

Læs mere

Enten med kabel eller med trådløs forbindelse

Enten med kabel eller med trådløs forbindelse Internet Enten med kabel eller med trådløs forbindelse Internet Computer med kabel computer trådløs - router modem stikdåse verden udenfor Internetadresser Hovedregel eksempel: www.gammelby.eu (1 punktum

Læs mere