Kortlægning af interaktion mellem IFN λ3 og IL- 10R2

Størrelse: px
Starte visningen fra side:

Download "Kortlægning af interaktion mellem IFN λ3 og IL- 10R2"

Transkript

1 Kortlægning af interaktion mellem IFN λ3 og IL- 10R2 Et eksperimentelt bachelor projekt i molekylærbiologi Af Sanne Ea Jørgensen Ved associated professor Rune Hartmann Molekylærbiologisk institut Aarhus universitet Afleveret d. 22. Juni

2 Indholdsfortegnelse ABSTRACT... 3 INTERFERON... 4 SIGNALERING... 4 STRUKTUREN AF Λ3 OG DENS RECEPTOR IL- 10R METODER OG MATERIALER... 9 MEDIER, BUFFERE, PLADER, GELER OG MARKØRER... 9 SITE DIRECTED MUTAGENESIS OG OPRENSNING AF PLASMID TRANSFORMATION OG OPFORMERING AF DH5Α CELLER TIL OPFORMERING AF PLASMID OPRENSNING AF PLASMID OG SEKVENTERING TRANSFORMATION OG OPFORMERING AF BL21DE3 CELLER TIL PROTEIN PRODUKTION PROTEIN OPRENSNING OG REFOLDNING PROTEIN GELER SEKVENTERING PROTEIN OPRENSNING OG REFOLDNING DISKUSSION/KONKLUSION TAK TIL REFERENCE LISTE

3 Abstract Interferon (IFN)- λ3 is the most potent of the three IFN- λ (8). Due to its antiviral effect and the limited tissues that responds to it, it has a great potential in treatment of viral infections. IFN- λ3 binds to the receptors IL- 10R2 and IFN- λr1. In this project, I wish to limit the location of the binding site between IFN- λ3 and its receptor chain IL- 10R2. To do this, I have chosen three amino acids, which I believe is located, at the periphery of the binding site. I have assessed this, from the structure of the complex between IFN- λ3 and its receptor chains IFN- λr1 and IL- 10R2. Besides this, I have examined the amino acid 49 in IFN- λ3, this site is exposed to single- nucleotide polymorphisms (SNP), and it is thought to be important in the recovery from and treatment of hepatitis C. According to the literature, it has no significant effect on the virus replication and the signalling of IFN- λ3, I wish to verify this in our antiviral assay. I have mutated the four amino acids in IFN- λ3 and purified the proteins. I found that the protocol I used to purify IFN- λ3 and the mutants gives a clean product. Unfortunately there was no time to run the antiviral assay, but I do not expect that any of my mutations have any effect in the assay. The three of them are located outside of the binding site between IFN- λ3 and IL- 10R2, and the amino acid 49 have not previously shown any effect in the literature. 3

4 Introduktion Interferon Interferoner er en gruppe cytokiner der har en antiviral effekt (7). De er opdelt i tre grupper; type I, II og III interferon (7). Hos pattedyr består type I IFN af IFN- α, - β, - ω, - ε, - τ, - δ og - κ, det er dog kun IFN- α og - β der induceres af og beskytter imod virus (7). Både IFN- α og - β består af flere subtyper af interferoner hos pattedyr(7). Type II interferon består kun af IFN- γ (7), som jeg ikke vil beskæftige mig mere med her. Type III interferon blev opdaget samtidigt af to grupper under ledelse af henholdsvis P. Sheppard (1) og S. Kotenko (2) i De fandt, at der er 3 subtyper, og de navngav dem henholdsvis IL- 28A/IFN- λ2, IL- 28B/IFN- λ3 og IL- 29/IFN- λ1 (1, 2). De demonstrerede den antivirale aktivitet af IFN- λ, ved at vise at IFN- λ inducerer de antivirale proteiner 2,5 - OAS og MxA, og at IFN- λ induceres af virus (2). Senere fandt man at induktionen af IFN- λ sker via Toll- like receptor (TLR) 3 og 9 (4). IFN- λ produceres af de fleste celler, men det er dog hovedsageligt dendritcellerne, der står for IFN- λ produktionen (4). Derimod er det ikke alle celler der responderer på IFN- λ. Et respons på IFN- λ kræver at begge receptoren for IFN- λ er udtrykt på en celles overflade (6), og da IFN- λr1 hovedsageligt er udtrykt på epithel celler, ses der kun et respons på IFN- λ, i organer der er rige på epithel celler, som f.eks. huden, tarmen, maven og lungerne (6). IFN- α og - λ inducerer de samme gener og dermed det samme antivirale respons i celler (5). I modsætning til IFN- λ receptorerne udtrykkes IFN- α receptorerne i flere celle typer (5). Denne fordeling af responset, kan netop være en af grundene til, at vi både har IFN- α og - λ, der ellers ser ud til at spille den samme rolle i immunforsvaret (5, 6). Grundet den antivirale effekt af IFN- α, benyttes det i dag i behandlingen af hepatitis C, men behandlingen har en lang række bivirkninger (13). Fordi færre celler responderer på IFN- λ, er der håb om, at man kan erstatte IFN- α med IFN- λ og dermed opleve færre bivirkninger (5). Ud af IFN- λ1, 2 og 3 er det IFN- λ3, der er bedst til at bekæmpe virale infektioner i mammale celler(8). Derfor ønsker vi at kende bindingsstedet mellem IFN- λ3 og receptorkæden IL- 10R2. Signalering Type I og III IFN signalerer via Jak- STAT signal vejen, men de benytter forskellige receptorer (9). Jeg vil her beskrive den generelle signalvej for type I og III IFN. Før IFN binder til receptor kæderne er Tyrosin kinase 2 (Tyk2) bundet til IFNAR1, og tyrosin kinasen Janus kinase 1 4

5 (JAK1) IFNAR2. Ved binding af IFN til receptor kæderne, sker der en konformatiel ændring, dette resulterer i at Tyk2 og JAK1 kryds- phosphorylerer hinanden, hvorved de aktiveres. Denne aktivering resulterer i phosphoryleringen af IFNAR1, hvorefter STAT2 kan bindes og phosphoryleres af Tyk2. Samtidigt phosphoryleres STAT1 af JAK1. STAT1 og 2 er allerede svagt bundne til hinanden, før IFN binder til receptoren, og phosphoryleringen resulterer i, at de to STAT proteiner binder stærkere til hinanden, og danner en heterodimer. Heterodimeren danner et kompleks med IFN regulerende faktor 9 (IRF- 9), dette kompleks kaldes IFN Stimuleret Gen Faktor 3 (ISGF3). ISGF3 binder IFN- Stimuleret Response Elementer (ISRE), der findes i promoter regionerne til de fleste IFN Stimulerede Gener (ISG) (fig. 1) (7, 9). Figur 1 Oversigt over signalvejene for IFN- α og IFN- λ. Signalvejene for de to inteferoner er ens, men receptorene er forskellige. IFN- α signalerer via IFNAR1 og 2 og IFN- λ signalerer via IFNλR1 og IL- 10R2. Når interferon binder til receptor kæder kryds- phosphoryleres Jak1 og Tyk2, der derefter phosphorylere STAT 1 og 2. STAT 1 og 2 danner en heterodimer, der binder IRF- 9, dette kompleks kaldes ISGF3 og binder til ISRE segmentet i promoteren til ISG, hvorved ISG er udtrykkes. 5

6 Strukturen af λ3 og dens receptor IL- 10R2 IFN- λ binder til receptorkæderne IFN- λr1 (CRF2-12) og IL- 10R2 (CRF2-4) (2). Jeg fokuserer her på bindingen mellem IFN- λ3 og IL- 10R2 og vil derfor kort beskrive strukturen af IFN- λ3 og IL- 10R2. Strukturen af IFN- λ3 blev bestemt i 2009 af H. Gad et al. (11). Strukturen består af 6 sekundære strukturelementer, der er navngivet A- F, alle på nær B elementet er alfa helixer, B elementet er et fleksibelt loop (11). F helixen indeholder et knæk og danner sammen med A, C og D helixerne en kerne af helixer. B elementet forbinder A og C helixerne og ligger uden for denne kerne sammen med E helixen (11). Det er kun strukturen af den ekstracellulære del af IL- 10R2 (sil- 10R2), der er bestemt. Den blev bestemt af S. Yoon et al. (3) i sil- 10R2 består af to fibronectin type III domæner, hvert domæne består af 7 beta strenge, der er forbundet af loops. De to domæner sidder i en vinkel på 95 o, med det N- terminale domæne (D1) længst væk fra cellemembranen og det C- terminale domæne (D2) tættest på cellemembranen (3). 6

7 A B C Figur2 IFN- λ3 (blå) i kompleks med receptor kæderne IFN- λr1 (lys blå) og IL- 10R2 (gul og rød). Strukturerne er lavet af Ole Jensen Hamming, baseret på PDB entery 3OG4 (12) og 3LQM (3). A: Her ses hele komplekset. B: Aminosyrener S110, D89 og K82 på IFN- λ3 er markert med grøn. Til venstre i billedet ses IL- 10R2 i rød og gul. De aminosyrer der er angivet med navn på IFN- λ3, er aminosyrer der er muteret af andre i gruppen. C: Aminosyren K49 på IFN- λ er markeret med grøn. Til venstre i billedet ses IFN- λr1 i lys blå og til højre ses IL- 10R2 i rød. De grønne aminosyrer der ikke er navngivne, er de aminosyrer der ses på fig. 2A. 7

8 Det forventede bindingssted mellem IL- 10R2 og IFN- λ er mellem D1 på IL- 10R2 og helix C og D på IFN- λ. På fig. 2A ses komplekset af IL- 10R2 (gul og rød), IFN- λr1 (lys blå) og IFN- λ3 (blå). Fig. 2A er lavet ud fra strukturen af IFN- λ3 receptor komplekset samlet af Ole Jensen Hamming, baseret på PDB entery 3OG4 (12) og 3LQM (3). IL- 10R2 er receptor for fem forskellige klasse cytokiner, der i blandt IFN- λ3 (3). S. Yoon et al. fandt at tyrosin 59 på IL- 10R2 er vigtig for bindingen mellem IL- 10 og IL- 10R2, men ikke for bindingen mellem IL- 22 og IL- 10R2. Derudover fandt de, at tyrosin 82 på IL- 10R2 er vigtige for IL- 10R2 s binding til både IL- 22 og IL- 10 (3). Ud fra dette og strukturen på fig. 2A har vi i gruppen udvalgt en række aminosyrer på IFN- λ3, der kunne være vigtige for bindingen mellem IFN- λ3 og IL- 10R2, disse aminosyrer ses på fig. 2B. Vi har i gruppen foretaget alanin scans over disse aminosyrer, for at se betydningen af disse aminosyrer for IFN- λ3 s antivirale effekt. Jeg har valgt at mutere aminosyrerne serin 110, asparaginsyre 89 og lysin 82, det er de aminosyrer der ses farvet med grøn på fig. 2B. Jeg har valgt disse aminosyrer, fordi de på strukturen ser ud til, at ligge for langt væk fra Y59 og Y82 til at de kan interagere. De kan derfor være med til, at afgrænse bindings stedet mellem IFN- λ3 og IL- 10R2. Udover disse tre aminosyrer, ønsker jeg også at kigge på lysin 49. Denne aminosyre varierer i single- nukleotide polymorphisms (SNP) hos mennesker, og dette har betydning for, hvor let man har ved at komme over en hepatitis C infektion, og hvor modtagelig man er for behandling med pegifn- α (11). Jeg sammenligner derfor vild typen (med lysin 49) med proteinet IFN- λ3_k49r og IFN- λ3_k49a, for på denne måde at se, om disse mutationer har nogen betydning for IFN- λ3 s antivirale effekt. Jeg har valgt at muterer lysin 49 til arginin, fordi der på IFN- λ2, sidder en arginin på position 49 (2), og jeg ved at IFN- λ2 har en langt mindre antiviral effekt end IFN- λ3 (8). På fig. 2C ses lysin 49 s placering i strukturen, den ser ikke ud til at kunne have nogen effekt på bindingen til receptorkæderne IL- 10R2 og IFN- λr1. Jeg vil foretage alanin scans af disse fire aminosyrer og undersøge deres aktivitet i et antiviralt assay. Men jeg forventer ikke at alanin scans af disse aminosyrer vil have nogen effekt på et antiviralet aktivitets assay. 8

9 Metoder og Materialer Medier, buffere, plader, geler og markører Luria Bertani (LB) medie: 5% (w/v) gær ekstrakt, 10% (w/v) bacto tryptone, 5% (w/v) NaCl, H2O tilsat til en liter. Mediet blev autoklaveret med det samme efter blanding. Phosphate buffered saline solution (PBS): En PBS tablet fra Gibco opløses i 500 ml H2O ifølge producentens instruktioner og autoklaveres. KCM: 120 mm KCl, 20 mm NaCl, 10 mm Tris- HCl, 0,5 mm EDTA (VWR), 0,1% [v/v] Triton X- 100 i H2O. Lyserings buffer: 300 mm NaCl, 50 mm NaH2PO4, 8 M urea, H2O, ph indstilles med HCL og NaOH til ph 8,0. Vaske buffer: 500 mm NaCl, 50mM NaH2PO4, 10 mm imidazole, 8 M urea, H2O, ph indstilles med HCL og NaOH til ph 8,0. 5 mm β- mercaptoethanol tilsættes kort før brug. Eluerings buffer: 20 mm Tris/HCL, 100 mm NaCl, 250 mm imidazole, 8 M urea, H2O, ph indstilles med HCL og NaOH til ph 7,5. 5 mm β- mercaptoethanol tilsættes kort før brug. Dialyse buffer no. 2: 50 mm Tris/HCL, 100 mm NaCl, 6 M urea, H2O, ph indstilles med HCL og NaOH til ph 6,5. Refoldnings buffer no. 4: 50 mm MES, 240 mm NaCl, 10 mm KCl, 0,5 M L- Arginine, 0,75 M guanidine HCl, 0,5% triton X- 100, H2O ph indstilles med HCL og NaOH til ph 6,0. 2 mm reduceret glutathione og 0,5 mm oxideret glutathion tilsættes kort før brug. Dialyse buffer no.4: 20 mm MES, 200 mm NaCl, 5% glycerol, H2O, ph indstilles med HCL og NaOH til ph 6,5. 9

10 Ionbytter Buffer 1A: 20 mm HEPES, 25 mm NaCl, H2O, ph indstilles med HCL og NaOH til ph 6,8. Bufferen filtreres før brug. Ionbytter Buffer 1B: 20 mm HEPES, 1 M NaCl, H2O, ph indstilles med HCL og NaOH til ph 6,8. Bufferen filtreres før brug. Agar plader med ampicilin: 5% (w/v) gær ekstrakt, 10% (w/v) bacto tryptone, 5% (w/v) NaCl, 12% (w/v) agar, H2O tilsat til en liter. Mediet blev autoklaveret med det samme efter blanding. 0,1% (v/v) ampicillin blev tilsat kort før blandingen blev fyldt i petri- skåle. Agarose gel: 80 ml TBE, 0,8 g agarose, 3 μl ethidium bromid. 12% Acrylamid gel: gelen består af en stacking gel og en running gel. Stacking gel: 3,3 ml 30% acrylamid, 6,3 ml Flig C ph 6,8, 15,0 ml H2O, 250 µl 10% SDS, 125 µl 10% APS, 25 µl TEMED. Running gel: 40 ml 30% acrylamid, 25 ml flig B ph 8,85, 33,5 ml H2O, 1,0 ml 10% SDS, 500 µl 10% APS, 50 µl TEMED. Site directed mutagenesis og oprensning af plasmid For hver mutant kører jeg to PCR reaktioner, en med 25 ng template og en med 100 ng template, dette gøres for at sikre et produkt. For lidt template kan resultere i at plasmidet ikke opformeres og hvis der er for meget template kan det være svært at komme af med efter reaktionen. Jeg lavede derfor to reaktions blandinger for hver mutant. 10

11 Tabel 1 Reaktions blandingen til site directed mutagenesis. 25 ng template 100 ng template 36,5 µl ddh 2 O 33,5 µl ddh2o 5 μl pfuultra II reaction buffer 5 μl pfuultra II reaction buffer 5 μl dntp mix 5 μl dntp mix 1 µl IFN- λ3- pet- 15b 4 µl IFN- λ3- pet- 15b 1 μl forward primere 1 μl forward primere 1μL reverse primer 1μL reverse primer 0,5 μl pfuultra II fusion HS DNA polymerase 0,5 μl pfuultra II fusion HS DNA polymerase Jeg benyttede følgende primere. Tabel 2 Primere K70R_upper K70R_lower K70A_upper K70A_lower S110A_upper S110A_lower D89A_lower D89A_lower K82A_upper K82A_lower GACGGCTACGGCATCTACAATCTTTCAGCAGC GCTGCTGAAAGATTGTAGATGCCGTAGCCGTC GACGGCTACGGCATGCACAATCTTTCAGCAGC GCTGCTGAAAGATTGTGCATGCCGTAGCCGTC GCATCATATTCTGGCCCAGCTGCGTGCGTG CACGCACGCAGCTGGGCCAGAATATGATGC GGAAGCGACCGCCGCTACCGATCCGGCGCTGGG CCCAGCGCCGGATCGGTAGCGGCGGTCGCTTCC GGCGCTGACCCTGGCAGTTCTGGAAGCGACCGC GCGGTCGCTTCCAGAACTGCCAGGGTCAGCGCC Jeg kørte reaktionerne ved følgende program på PCR maskinen: 2 min ved 95 o C, (30 s ved 95 o C, 1 min ved 52 o C og 7 min og 30 s ved 65 o C) i 4cykler, (30 s ved 95 o C, 1 min ved 55 o C og 7 min og 30 s ved 65 o C) i 20 cykler. 11

12 Efter PCR reaktionen kløvede jeg templaten med Dpn 1 ved 37 o C i 1 time, for at fjerne den methylerede umuterede template. Efter kløvningen med Dpn 1 oprensede jeg plasmiderne på en agarose gel, hvorefter jeg udskar de bånd, der indeholdte plasmiderne og oprensede plasmiderne fra dem med illustra GFX PCR DNA and gel band purification kit fra GE helthcares efter producentens instruktioner. Det oprensede plasmid blev opbevaret på is. Transformation og opformering af DH5α celler til opformering af plasmid Til transformeringen af DH5α celler blev brugt en blanding af: Tabel 3 transformations blandingen til transformation af DH5 α celler. Transformations blanding Oprenset plasmid KCM buffer ddh2o DH5α celler 40 μl 20 μl 40 μl 100 μl Blandingen blev inkuberet på is i 20 min og derefter ved stue temperatur i 10 min. Jeg tilsatte så 800 µl LB medie og inkuberede blandingen i ryste inkubatoren med 180 rpm i 1 time ved 37 o C. Cellerne er nu transformerede og 150 µl bakterie kultur plades ud på agarplader med ampicillin, for at selektere for de transformerede celler. Cellerne gror på pladerne natten over ved 37 o C. Der blev også lavet en negativ kontrol plade, hvor bakterierne havde fået tilsat 40µL ddh2o i stedet for 40 µl plasmid. Dagen efter blev der først undersøgt, at der ikke var bakterie kolonier på kontrolpladen. Derefter blev bakterier fra en koloni pr. Mutant overført til rør sammen med 5 ml autoklaveret LB medie og 5 µl ampicillin. Rørene blev inkuberet natten over i ryste inkubatoren med 180 rpm ved 37 o C. 12

13 Oprensning af plasmid og sekventering For at kunne sekventere det muterede plasmid, og dermed fastslå om de ønskede mutationer er opnået, blev plasmiderne først oprenset fra DH5α cellerne fra dagen før. Dette blev gjort med GenElute Plasmid miniprep kit fra Sigma, jeg fulgte producentens anvisninger. Det oprensede plasmid blev sendt til sekventring hos eurofins. Sekvenserne fra eurofins blev undersøgt i CLC main workbench 5. I menuen Toolbox valgte jeg Sequencing Data Analysis og Assemble Sequences to Reference, her valgte jeg at sammenligne de sekventerede plasmider med wt sekvensen i vektoren IFN- λ3 pet- 15b. For at kontrollere at de mutationer der måtte være, udover den ønskede mutation, var nonsense mutationer, translaterede jeg sekvensen i CLC main workbench 5, på denne måde kan jeg verificere at jeg kun har en mutation i hver sekvens, og at denne mutation er den ønskede mutation. Transformation og opformering af BL21DE3 celler til protein produktion Transformationen af BL21DE3 celler foregik som transformation af DH5α celler ovenfor. Jeg transformerede celler både med mine fem mutanter og med vild typen. Som ovenfor blev det først tjekket, at der ikke var kolonier på kontrol pladen. Så overførte jeg cellerne fra agarpladerne til kolber med LB medie og 0,1 mg/ml ampicillin. Kolberne blev inkuberet i ryste inkubatoren ved 37 o C og 180 rpm indtil OD600 nm kom over 0,6 (3-4 timer), 0,5-2 mm Isopropyl- B- D Thiogalactopyraniside (IPTG) blev nu tilsat og kulturen blev inkuberet i yderligere 2-3 timer. Protein oprensning og refoldning Celle kulturene blev centrifugeret i en Avanti J- 26 XPI centrifuge ved 7000 rpm i 15 min. Supernantanten blev fjernet og bakterie peleten vasket i koldt PBS og overført til 50 ml nunc rør. Cellerne fryses ned natten over. Cellerne optøs og opløses i ml lyserings buffer pr. liter bakterie kultur, hvorefter de lyseres ved at køre dem igennem en høj tryks homoganisator 2 gange. Lysatet centrifugeres ved rpm i 35 min for at peletere celle rester. Supernantanten inkuberes på rystebord med 1,5 ml Ni- NTA beads pr. L bakterie kultur i 1,5 timer ved stue temperatur eller natten over ved 4 o C. 13

14 Efter inkuberingen blev prøven centrifugeret i 10 min ved 500 rpm og beadsene vaskes med vaske buffer, hvorefter centrifugeringen gentages, vasken gentages to gange, indtil supernantanten er klar. NI- NTA beadsene genopløses nu i vaske buffer, hvorefter de overføres til en søjle. Beadsene vaskes grundigt med vaske buffer ved at hælde vaske buffer over beadsene og lade det dryppe igennem søjlen, dette gøres med et volumen vaske buffer der svare ca. til 10 gange det brugte volumen Ni- NTA. Efter vasken tilsættes ca ml eluerings buffer og eluenten opsamles nu i 50 ml nunc rør. Der tilsættes DTT til en koncentration på mm (1 ml 0,5 M DTT pr. 50 ml eluent) til eluenten og den inkuberes i ca. 1 time ved stue temperatur. Proteinerne skal nu refoldes. Dette gøres ved først at overføre proteinet til Da dialyse poser og fortynde det med dialyse buffer no. 2 til en protein koncentration på under 0,5 mg/ml. Proteinet dialyseres så mod dialyse buffer no. 2. Derefter dialyseres det mod refoldnings buffer no. 2 og til sidst mod dialyse buffer no. 4. Dialyserne kørers hver i sær natten over. Der kan opstå bundfald i dialyse poserne, dette er protein der ikke er refoldet korrekt og derfor fælder ud. Efter refoldningen centrifugeres indholdet af dialyse poserne ved 6500 rpm i 35 min for at fjerne bundfald, og supernantanten fortyndes med ion exchange buffer 1A til ca. den dobbelte volumen. Proteinerne køres på HiTrap SP FF 5 ml kationbytter søjer med en peristaltisk pumpe, med et flow på 2 ml/min (søjlen med protein kan inkuberes natten over ved 4 o C). Derefter monterede jeg søjlen på Äktaen og jeg eluerede prøven ved at kørte ionexchange buffer 1A og 1B over søjlen med en flowrate på 0,5 ml/min, i en gradient længde på 15 base til en ionexchange buffer 1B koncentration på 100 %. Fraktionerne der indeholder IFN- λ3 eller dens mutanter samles og opkoncentreres med et centrifugal filter device. Proteinet køres nu på HiLoade 16/60 Superdex 75 gelfiltrerings søjlen, og elueres med PBS med en flowrate på 1 ml/min. Koncentrationen af de fraktioner der indeholder proteinet måles og fraktionerne fortyndes med 50% glycerol i PBS, til en glycerol koncentration på 10 %. De målte koncentrationer kan ganges med 1,48, der er absorptions koefficienten for IFN- λ3_his, og den nye koncentration kan beregnes og noteres før prøverne fryses ned ved 80 o C. 14

15 Protein geler Undervejs i forsøget er prøver med protein kørt på 12 % acrylamid geler. På hver gel er kørt en LMW markør og op til 9 prøver. Prøverne koges med SDS, før de køres på gelen, for at denaturere proteinet. 15

16 Resultater Sekventering For at gennemgå resultaterne af mine protein oprensninger, har jeg valgt at vise data fra oprensningen af IFN- λ3_k49r. Mutationen af IFN- λ3_k49r er foretaget tidligere af en anden i gruppen, og jeg har ikke haft adgang til sekventerings data for denne mutant. Derfor har jeg valgt at vise sekventeringen fra mutanten IFN- λ3_d89. Sekvenserne af de muterede plasmider, blev sammenlignet med sekvensen for IFN- λ3 vild typen i CLC main workbench 5, som beskrevet i afsnittet metoder og matrialer. Her har jeg kontrolleret, at der kun er den ønskede mutation i plasmidet, og at der ikke er sekundærer mutationer, der kunne påvirke mit resultat, dvs. sekundære mutationer der påvirker læserammen eller aminosyre sekvensen. På fig. 3 ses sammenligningen mellem IFN- λ3 vild typen (øverst på fig. 3) og IFN- λ3_d89a (nederst på fig. 3) i CLC main workbench 5. Placeringen af mutationen fremgår tydeligt, af den nederste del af fig. 3, i konsensus sekvensen (den midterste sekvens på fig. 3) er mutationen markeret med en rød trekant over nukleotid sekvensen, og både i konsensus sekvensen og i sekvensen for IFN- λ3_d89a, er mutationen i aminosyre sekvensen markeret med rødt. Nederst på fig. 3 ses trace data for sekventeringen af _D89A, det ses her at sekventeringen er god, da toppene for de forskellige aminosyre er adskilte og høje i forhold til baggrunden. Hele sekvensen er gennemset for mutationer, og jeg fandt kun den ønskede mutationer. Det samme er gjort for de andre muterede sekvenser og resultatet kan ses i tabel 4. 16

17 Figur 3 Sekventering af mutanten IFN- λ3_d89a sammenlignet med vild typen i CLC work bench. Øverst ses vildtypen. Midterst ses en consensus sekvens. Dette er en sammenligning af vild type sekvensen og sekvensen for IFN- λ3_d98a, hvoraf mutationer i nukleotid og aminosyre sekvensen fremgår, mutationen i nukleotid sekvensen er markeret med en rød trekant og mutationen i aminosyre sekvensen er markeret med rødt. Nederst ses sekvensen for IFN- λ3_d98a og trace data fra sekventeringen, mutationen er her markeret med henholdsvis rød overstregning og rød skrift. Tabel 4 Mutationer fundet i de forskellige sekvenser ved brug af CLC main workbench 5. Mutanterne IFN- λ3_k49a og IFN- λ3_k49a er foretaget og kontrolleret af Susanne Vends. Sekvens Ønsket mutation Sekundære mutationer IFN- λ3_s110a Ja Nej IFN- λ3_k82a Ja Nej IFN- λ3_d98a Ja Nej IFN- λ3_k49a Ja Nej IFN- λ3_k49r Ja Nej 17

18 LMW - lys +lys - Ni V1 VS E +D T HiLoad Figur 4 oprensningen af mutanten IFN- λ3_k49r: LMW: LMW markør, - lys: medie med celler, +lys: lyserede celler i lysis buffer, - Ni: det er ikke bandt til Ni- NTA beads, V1: første vask af Ni- NTA beads, VS: anden vask af Ni- NTA beads, E: eluent fra Ni- NTA, +D: refoldet protein, T: tom, HiLoad: Proteinet oprenset på HiLoad 16/60 Superdex 75 gelfiltrerings søjle. Protein oprensning og refoldning De sekventerede plasmider kan nu udtrykkes i BL21DE3 celler, og proteinet kan oprenses som beskrevet i afsnittet materialer og metoder. På fig. 4 kan ses en gel over de forskellige trin i oprensningen. IFN- λ3_his har en masse på 21,2 kda og er markeret på fig. 4 med en pil. I de ikke lyserede og lyserede celler (- lys og +lys) er der meget protein. De fleste af disse proteiner binder ikke til Ni- NTA beadsene (- Ni), og kan vaskes væk (V1 og VS). Derfor er der langt færre proteiner i eluenten fra Ni- NTA beadsene (E). I dialysen og refoldningen af IFN- λ3_k49r (+D) har jeg fortyndet prøven kraftigt og derfor ses kun meget svage bånd. Efter refoldningen af proteinet, har jeg oprenset proteinet på en HiTrap SP FF 5 ml kationbytter søjle, da IFN- λ3_his har en pi på 8,4 vil det have en positiv ladning ved den neutral ph i ionbytter buffer 1A og derfor binde til søjlen. Chromatogrammet for ionbytter søjlen ses på fig. 5. IFN- λ3_k49r elueres ved 45 ms/cm i toppen fra 12,5 ml til 18 ml. De kraftige toppe før dette, skyldes kontaminanter der skyldes væk før IFN- λ3_k49r elueres fra søjlen. 18

19 Efter ionbytter søjlen, blev prøven opkoncentreret og kørt på en HiLoad 16/60 Superdex 75 gelfiltrerings søjle. Chromatogrammet for gelfiltereings søjlen ses på fig. 6, her ses en lille top i begyndelsen af chromatogrammet, det skyldes at søjlen ikke er vasket grundigt nok inden jeg kørte programmet. Toppene fra 45 ml til 75 ml er IFN- λ3_k49r, af dem har jeg dog kun opsamlet fraktionerne D13- D5. Der er to Toppe fra 45 ml til 75 ml, fordi IFN- λ3 findes i en dynamisk ligevægt mellem en monomer og en dimer (8). Jeg har kørt to geler af toppene (fig. 7 og 8), og her ses det, at de to toppe indeholder det samme protein. På gelerne ses der to tydelige bånd i hver bane og tre bånd i bane 5-8 på fig. 8, dette skyldes at his taget afkløves, uden at jeg har tilsat Tev protease, min prøve indeholder altså IFN- λ3_k49r med og uden his tag. IFN- λ3_k49r er nu færdigt oprenset (fig. 4 HiLoad), og det ses, at der som på fig. 7 og 8 er to bånd, dette skyldes som sagt at his taget afkløves under oprensningen. Proteinet er nu fuldt oprenset, der ses et bånd ved ca. 40 kda, dette er en kontaminant jeg ikke adressere yderligere. 19

20 KS HiTrap SP FF 5 ml k70r 10 maj001:10_uv1_280nm KS HiTrap SP FF 5 ml k70r 10 maj001:10_cond KS HiTrap SP FF 5 ml k70r 10 maj001:10_conc KS HiTrap SP FF 5 ml k70r 10 maj001:10_fractions mau F2 A3 A5 A7 A9 A11 A13 A15 B14 B12 B10 B8 B6 B4 B2 C1 C3 C5 C7 C9 C11 C13 C15 D14 D12 D10 D8 D6 D4 D2 E1 E3 E5 E7 E9 E11 E13 E ml Figur 5 Chromatogram over elueringen fra ionbytter søjlen af IFN- λ3_k49r. Den blå graf markerer absorbansen ved 280 nm, det viser direkte hvornår proteiner elueres. Den grønne graf viser koncentrationen af salt, og dermed salt gradienten. Den brune graf viser konduktiviteten efter søjlen, og dermed hvornår saltet kommer ud af søjlen. X aksen viser hvor mange ml der er løbet igennem søjlen og de fraktion numre der passer til, Y aksen viser absorbansen ved 280 nm i mau. Toppene i begyndelsen af chromatogramet skyldes kontaminanter der skyldes væk før IFN- λ3_k49r elueres fra søjlen. 20

21 HiLoad 1660 Superdex K70R 10 maj001:10_uv1_280nm HiLoad 1660 Superdex K70R 10 maj001:10_conc HiLoad 1660 Superdex K70R 10 maj001:10_fractions mau F2 A2 A4 A6 A8 A10 A13 B15 B12 B9 B7 B5 B3 B1 C2 C4 C6 C8 C10 C13 D15 D12 D9 D7 D5 D3 D1 E2 E4 E6 E8 E10 E13 F15F13F11 F9 F7 F5 F3 F1 G2 G ml Figur 6 Chromatogram over elueringen fra gelfiltreringen af IFN- λ3_k49r. Den blå graf markerer absorbansen ved 280 nm, det viser direkte hvornår proteiner elueres. Den grønne graf viser salt koncentrationen, her er ingen ændring da søjlen kun elueres med PBS. X aksen viser hvor mange ml der er løbet igennem søjlen og de fraktion numre der passer til, Y aksen viser absorbansen ved 280 nm i mau. Toppen i begyndelsen af chromatogramet er der fordi jeg ikke har fået vasket søjlen grundigt nok inden jeg kørte programmet. 21

22 D14 D12 D10 T D9 D8 D7 D6 D5 LMW Figur 7 Fraktionerne D14- D5 af min gelfiltrering af mutanten IFN- λ3_k49r. D14: fraktion D14, D12: fraktion D12, D10: fraktion D10, T: overflow fra bane 3, men ellers tom, D9: fraktion D9, D8: fraktion D8, D7: fraktion D7, D6: fraktion D6, D5: fraktion D5, LMW: LMW markør. D4 D2 D3 E1 E3 E5 E7 E9 LMW Figur 8 Fraktionerne D4- E9 fra min gelfiltrering af mutanten IFN- λ3_k49r. D4: fraktion D4, D2: fraktion D2, D3: fraktion D3, E1: fraktion E1, E3: fraktion E3, E5: fraktion E5, E7: fraktion E7, E9: fraktion E9, LMW: LMW markør. 22

23 Tabel 5 Koncentration, volumen og mængde af protein under oprensningen af IFN- λ3_k49r fra 4 L bakterie medie. Oprensnings trin koncentrationer af IFN- λ3_k49r (mg/ml) Volumen prøve (ml) Mængde af protein (mg) Udbytte (%) Eluent fra Ni- NTA søjlen 1, ,5 100 Efter dialyse og refoldning af 0, ,3 109 proteinet Eluenten fra ionbytter søjlen 4, ,5 30,5 Den opkoncentrerede eluent 8, ,8 21,3 fra ionbytter søjlen Eluenten fra gelfiltreringssøjlen 0,49 9 4,4 5,3 Som det ses på fig. 4 tabes der IFN- λ3_k49r for hvert trin i oprensningen. I tabel 5 ses protein koncentrationer af min prøve undervejs i oprensningen. De målte koncentrationer er ganget med 1,48, absorptions koefficienten for IFN- λ3_his, udregnet fra CLC main workbench 5. Denne konstant er specifik for IFN- λ3_his, og ikke for konterminanterne. Jeg har i denne udregning, ikke taget højde for renheden af proteinet. Koncentrationen af protein i eluenten fra Ni- NTA søjlen er upålidelig, da eluation bufferen indeholder imidazole, og det absorberer UV lys ved samme bølgelængde som de aromatiske aminosyrer; derfor ses en stigning i mængden af protein efter dialysen og refoldningen. Jeg taber protein over ionbytter søjlen, fordi urenheder som f.eks. neutralt og negativt ladede ioner, der ikke binder til søjlen vaskes væk. Derudover dækker dette tab også over tabet i dialysen og refoldningen. Under dialysen diffunderer mindre proteiner ud af dialyse posen, og under refoldningen udfældes noget af proteinet, fordi det ikke foldes korrekt. Tabet af protein under opkoncentreringen skyldes, at jeg ikke har fået genopløst alt IFN- λ3_k49r fra filteret efter opkoncentreringen, og at noget af proteinet bundfældes. Tabet af protein på gelfiltreringssøjlen skyldes, at jeg ikke har opsamlet alle de fraktioner der indeholdte IFN- λ3_k49r, for at sikre en tilfredstillende koncentration. Eluenten fra gelfiltreringssøjlen, er fortyndet med glycerol, og den nye koncentration kan ses i tabel 6, sammen med koncentrationerne af de andre proteiner jeg har oprenset. Alle proteinerne i tabel 6, på nær IFN- λ3_d89a, har været igennem hele oprensningen. På grund af den lave koncentration af IFN- λ3_d89a og forventningen om et tab under gelfiltreringssøjlen (tabel 5), valgte jeg at stoppe opkoncentreringen efter ionbytter søjlen. Men som det fremgår 23

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Navn: Forsøgsvejledning Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA sekvens,

Læs mere

BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER

BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER FAGLIG BAGGRUND Det forudsættes, at den grundlæggende teori bag rekombinant protein ekspression og proteinopresning er bekendt. For dette henvises til undervisningsmateriale

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Oprensning af genomisk DNA fra plantemateriale Manual Katalog nr. 166-5005EDU explorer.bio-rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, februar 2009

Læs mere

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares.

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. Bioteknologi A Studentereksamen Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. frs111-btk/a-31052011 Tirsdag den 31. maj 2011 kl. 9.00-14.00

Læs mere

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse www.volvoxdk.dk C. Girnth-Diamba og B. Fahnøe, 2010 Claudia Girnth-Diamba og Bjørn Fahnøe Solrød Gymnasium, Solrød Center 2 DK 2680 Solrød Strand, Denmark E: sgcg@solgym.dk og sgbf@solgym.dk Plasmidoprensning

Læs mere

Isolering af DNA fra løg

Isolering af DNA fra løg Isolering af DNA fra løg Formål: At afprøve en metode til isolering af DNA fra et levende væv. At anvende enzymer.. Indledning: Isolering af DNA fra celler er første trin i mange molekylærbiologiske undersøgelser.

Læs mere

Syv transmembrane receptorer

Syv transmembrane receptorer Syv transmembrane receptorer Receptoren som kommunikationscentral Cellemembranen definerer grænsen mellem en celles indre og ydre miljø, der er meget forskelligt. Det er essentielt for cellens funktion

Læs mere

Godkendelse produktionslokale genetisk modificerede Escherichia coli

Godkendelse produktionslokale genetisk modificerede Escherichia coli Immunitrack ApS Københavns Biocenter Ole Maaløes Vej 5 2200 København N Pesticider og Genteknologi J.nr. MST-6840-00021 Ref. johpe Den 04. august 2015 Godkendelse af produktionslokale og genetisk modificerede

Læs mere

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det.

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Samarbejde mellem gymnasier og Aarhus Universitet Bioteknologiske eksperimenter Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Denne øvelse er baseret på øvelseskittet:

Læs mere

Androstenon-indol-skatol-protokol.

Androstenon-indol-skatol-protokol. Androstenon-indol-skatol-protokol. Indholdsfortegnelse: 1. Formål side 2 2. Teori side 2 2. Prøvebehandling side 2 3. Materialer side 2 3.1 Apparatur side 2 3.2 Kemikalier side 3 3.3 Reagenser side 3 4.

Læs mere

Konjugering af Alexa Fluor 488 til Insulin

Konjugering af Alexa Fluor 488 til Insulin Konjugering af Alexa Fluor 488 til Insulin Modul 2 Projekt i Kemi Institut for Natur, Systemer og Modeller Roskilde Universitetscenter Juni 2007 Skrevet af: Simon Hockenhull Vejleder: Søren Hvidt Abstract

Læs mere

Test'af'EML4.ALK'fusion'i'lungeadenokarcinom.

Test'af'EML4.ALK'fusion'i'lungeadenokarcinom. Test'af'EML4.ALK'fusion'i'lungeadenokarcinom. Anbefalingerne udarbejdede af: Overlæge,Dr.Med.BirgitGuldhammerSkov.BispebjergHospital,PatologiskAfdeling. Professor,overlægeMogensVyberg.AalborgUniversitetshospital,PatologiskInstitut.

Læs mere

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Formål: at undersøge udviklingen i mængden af tilsatte patogene bakterier til hønsegødning.

Læs mere

Proteinelektroforese af GFP Suppleringskit til pglo

Proteinelektroforese af GFP Suppleringskit til pglo Proteinelektroforese af GFP Suppleringskit til pglo Katalognummer nr. 166 0013EDU www.bio rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, Nærum Hovedgade 30, 2850 Nærum Birgitjustesen@gmail.com

Læs mere

Protein identifikation ved hjælp af Matrix- Assisted Laser Desorption Masse Spektrometri (MALDI-MS).

Protein identifikation ved hjælp af Matrix- Assisted Laser Desorption Masse Spektrometri (MALDI-MS). Teori til elevforløb på Institut for Biokemi og Molekylærbiologi på Syddansk Universitet: Protein identifikation ved hjælp af Matrix- Assisted Laser Desorption Masse Spektrometri (MALDI-MS). Peter Windfeldt

Læs mere

Salte, Syre og Baser

Salte, Syre og Baser Salte, Syre og Baser Fysik/Kemi Rapport 4/10 2011 MO Af Lukas Rønnow Klarlund 9.y Indholdsfortegnelse: Formål s. 2 Salte og Ioner s. 3 Syrer og Baser s. 5 phværdi s. 5 Neutralisation s. 6 Kunklusion s.

Læs mere

Kvantitativ bestemmelse af reducerende sukker (glukose)

Kvantitativ bestemmelse af reducerende sukker (glukose) Kvantitativ bestemmelse af reducerende sukker (glukose) Baggrund: Det viser sig at en del af de sukkerarter vi indtager med vores mad er hvad man i fagsproget kalder reducerende sukkerarter. Disse vil

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D.

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D. 11-11-2013 Testet i udlandet Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 Forfatter: Janus Vang, Ph.D. ANSVARLIG: REGIN W. DALSGAARD, BESTYRELSESFORMAND FOR VINNUFRAMI INTRODUKTION Færøernes

Læs mere

Måling af ledningsevne. I rent og ultrarent vand

Måling af ledningsevne. I rent og ultrarent vand Måling af ledningsevne I rent og ultrarent vand Anvendelse af ledningsevne Mest anvendt til kvalitets kontrol Overvågning af renhed på vand til processen Kontrol af vand i processen Kontrol af drikkevand

Læs mere

Betydning af revision af en DS/EN ISO standard

Betydning af revision af en DS/EN ISO standard By- og Landskabsstyrelsens Referencelaboratorium Betydning af revision af en DS/EN ISO standard Bestemmelser af total cyanid og fri cyanid i vand med flow analyse By- og Landskabsstyrelsen Rapport Juni

Læs mere

Komplementsystemets fysiologi og patofysiologi. Søren Hansen, Cancer og Inflammationsforskning, WP21-1, SHansen@health.sdu.dk

Komplementsystemets fysiologi og patofysiologi. Søren Hansen, Cancer og Inflammationsforskning, WP21-1, SHansen@health.sdu.dk Komplementsystemets fysiologi og patofysiologi C3 Søren Hansen, Cancer og Inflammationsforskning, WP21-1, SHansen@health.sdu.dk Detaljeret - aktiveringsmekanismer - opbygning - effektorfunktioner (incl.

Læs mere

Maxwell 16 Blood DNA Purification System

Maxwell 16 Blood DNA Purification System Teknisk vejledning Maxwell 16 Blood DNA Purification System Forsigtig - håndter kassettene med omhu, kanterne på forsejlingen kan være skarpe. 2800 Woods Hollow Rd. Madison, WI USA In vitro diagnostisk

Læs mere

Dødelighed i ét tal giver det mening?

Dødelighed i ét tal giver det mening? Dødelighed i ét tal giver det mening? Jacob Anhøj Diagnostisk Center, Rigshospitalet 2014 Hospitalsstandardiseret mortalitetsrate, HSMR Definition HSMR = antal d/odsfald forventet antal d/odsfald 100 Antal

Læs mere

Titel: OPLØSELIGHEDEN AF KOBBER(II)SULFAT. Litteratur: Klasse: Dato: Ark 1 af. Helge Mygind, Kemi 2000 A-niveau 1, s. 290-292 8/9-2008/OV

Titel: OPLØSELIGHEDEN AF KOBBER(II)SULFAT. Litteratur: Klasse: Dato: Ark 1 af. Helge Mygind, Kemi 2000 A-niveau 1, s. 290-292 8/9-2008/OV Fag: KEMI Journal nr. Titel: OPLØSELIGHEDEN AF KOBBER(II)SULFAT Navn: Litteratur: Klasse: Dato: Ark 1 af Helge Mygind, Kemi 2000 A-niveau 1, s. 290-292 8/9-2008/OV Formålet er at bestemme opløseligheden

Læs mere

Kemi Kulhydrater og protein

Kemi Kulhydrater og protein Kemi Kulhydrater og protein Formål: Formålet med forsøget er at vise hvordan man kan påvise protein, fedtstof, simple sukkerarter eller stivelse i forskellige fødevarer. Samtidig kan man få en fornemmelse

Læs mere

[ ] =10 7,4 = 40nM )

[ ] =10 7,4 = 40nM ) Syre og base homeostasen (BN kap. 9) Nyrefysiologi: Syre/base homeostase, kap. 9 Normal ph i arterielt plasma: 7,4 ( plasma H + [ ] =10 7,4 = 40nM ) o ECV indhold af H+: 40 nm (ph 7,4) x 15 l =600 nmol

Læs mere

NDRG2 s Interaction with Api5

NDRG2 s Interaction with Api5 Naturvidenskabeligt Basisstudium Roskilde Universitet 2. semesterprojekt Juni 2012 Hus 13.1 NDRG2 s Interaction with Api5 NDRG2 s interaktion med Api5 Gruppe 12: Freya Armstrong Annaleigh Ohrt Fehler Cecilie

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

IONER OG SALTE. Et stabilt elektronsystem kan natrium- og chlor-atomerne også få, hvis de reagerer kemisk med hinanden:

IONER OG SALTE. Et stabilt elektronsystem kan natrium- og chlor-atomerne også få, hvis de reagerer kemisk med hinanden: IONER OG SALTE INDLEDNING Når vi i daglig tale bruger udtrykket salt, mener vi altid køkkensalt, hvis kemiske navn er natriumchlorid, NaCl. Der findes imidlertid mange andre kemiske forbindelser, som er

Læs mere

Opgaver til: 6. Syrer og baser

Opgaver til: 6. Syrer og baser Opgaver til: 6. Syrer og baser 1. Færdiggør følgende syre-basereaktioner: a) HNO 3 + H 2 O b) H 2 SO 4 + H 2 O c) HNO 3 + NH 3 d) SO 2-3 + H 2O e) PO 3-4 + H 2O f) H 3 PO 4 + H 2 O g) O 2- + H 2 O h) CO

Læs mere

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod.

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod. Gå op i røg Hvilke konsekvenser har rygning? Udfordringen Denne udfordring handler om nogle af de skader, der sker på kroppen, hvis man ryger. Du kan arbejde med, hvordan kulilten fra cigaretter påvirker

Læs mere

Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold.

Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold. Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold. Juni 2011 Helle Frank Skall og Niels Jørgen Olesen Veterinærinstituttet, Danmarks

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

MJPower engineering Ecu Link.

MJPower engineering Ecu Link. MJPower engineering Ecu Link. Trin for trin instruktioner. I dette eksempel starter vi med at teste en cykel med et Power Commander nul map. Man er nødt til at have en præcis omdrejningstal registrering,

Læs mere

QUICK START Updated: 18. Febr. 2014

QUICK START Updated: 18. Febr. 2014 QUICK START Updated: 18. Febr. 2014 For at komme hurtigt og godt igang med dine nye Webstech produkter, anbefales at du downloader den senest opdaterede QuickStart fra vores hjemmeside: In order to get

Læs mere

Resultat af Ærteforsøg 2010

Resultat af Ærteforsøg 2010 Resultat af Ærteforsøg 2010 Ved et kursus på Institut for Jordbrug og Økologi, KU Life, blev dette ærteforsøg gennemført, med undervisning af Gunter Backes og Jihad Orabi. Skrevet af Søren Holt Frøsamlerne

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Dæmpning af immunsystemet hjælper HSmus

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Dæmpning af immunsystemet hjælper HSmus Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Dæmpning af immunsystemet hjælper HSmus CB2-aktiverende lægemiddel forbedrer overlevelse og symptomer

Læs mere

Måling af ph i syrer og baser

Måling af ph i syrer og baser Kemiøvelse 1 1.1 Måling af ph i syrer og baser Øvelsens pædagogiske rammer Sammenhæng Denne øvelse er tilpasset kemiundervisningen på modul 1 ved bioanalytikeruddannelsen. Øvelsen skal betragtes som en

Læs mere

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Exiqons cloud-løsning hjælper forskere med at analysere og forstå genomics og big data Hvad er genomics? Genomics er

Læs mere

Denne står som udgangspunkt på 0,9000, men før programmet tages i brug på jeres afdeling skal jeres specifikke elueringseffektivitet indtastes.

Denne står som udgangspunkt på 0,9000, men før programmet tages i brug på jeres afdeling skal jeres specifikke elueringseffektivitet indtastes. Elueringseffektivitet Denne står som udgangspunkt på 0,9000, men før programmet tages i brug på jeres afdeling skal jeres specifikke elueringseffektivitet indtastes. Dette gøres nemmest ved tage nogle

Læs mere

Madkemi Kulhydrater: er en gruppe af organiske stoffer der består af kul, hydrogen og oxygen (de sidste to i forholdet 2:1, ligesom H 2

Madkemi Kulhydrater: er en gruppe af organiske stoffer der består af kul, hydrogen og oxygen (de sidste to i forholdet 2:1, ligesom H 2 Madkemi Kulhydrater: er en gruppe af organiske stoffer der består af kul, hydrogen og oxygen (de sidste to i forholdet 2:1, ligesom H 2 O); derfor navnet kulhydrat (hydro: vand (græsk)). fælles for sukkermolekylerne

Læs mere

Bilag 1: ph. ph er dimensionsløs. Den har en praktisk betydning men ingen fundamental betydning.

Bilag 1: ph. ph er dimensionsløs. Den har en praktisk betydning men ingen fundamental betydning. Bilag 1: Introduktion har afgørende betydning for det kommende afværgeprojekt ved Høfde 4. Det skyldes, at basisk hydrolyse, som er det første trin i den planlagte treatment train, foregår hurtigere, jo

Læs mere

RentCalC V2.0. 2012 Soft-Solutions

RentCalC V2.0. 2012 Soft-Solutions Udlejnings software Vores udvikling er ikke stoppet!! by Soft-Solutions RentCalC, som er danmarks ubetinget bedste udlejnings software, kan hjælpe dig med på en hurtigt og simple måde, at holde styr på

Læs mere

Brugsanvisning IVD Matrix HCCA-portioned

Brugsanvisning IVD Matrix HCCA-portioned Brugsanvisning IVD Matrix HCCA-portioned Rendyrket matrixsubstans til matrix-assisteret-laser-desorption-ionisering time-of-flight-massespektrometri (MALDI-TOF-MS). CARE- produkterne er designet til at

Læs mere

Teknologisk Institut Side 1 af 11 30. April 2009 - HCN

Teknologisk Institut Side 1 af 11 30. April 2009 - HCN Teknologisk Institut Side 1 af 11 30. April 2009 - HCN Undersøgelse af drabseffekten overfor mikroorganismer ved hjælp af Clean Air Systemet til rensning af cirkulationsluften og overflader i en kølecontainer.

Læs mere

Bestemmelse af celletal

Bestemmelse af celletal Bioteknologi 2, Tema 3 Forsøg 4 Bestemmelse af celletal Mange klassiske mikrobiologiske metoder har til formål at undersøge hvor mange mikroorganismer man har i sin prøve. Det undersøger man gennem forskellige

Læs mere

EVENT DESCRIPTION RES-e Regions

EVENT DESCRIPTION RES-e Regions EVENT DESCRIPTION RES-e Regions Title: Visions for Solar Energy & Sustainable Energy Systems for Cities Date & location: 18 April 2007, Copenhagen Organizer: SolarCity Copenhagen and DTI Number of Participants:

Læs mere

1. Fakta om drikkevand 2. Vand og geologi 3. Kalk og kridt 4. Grundvand 5. Drikkevand 6. Overvågning og forurening

1. Fakta om drikkevand 2. Vand og geologi 3. Kalk og kridt 4. Grundvand 5. Drikkevand 6. Overvågning og forurening 6 1. Drikkevand 1. Fakta om drikkevand 2. Vand og geologi 3. Kalk og kridt 4. Grundvand 5. Drikkevand 6. Overvågning og forurening 7. Case A: Syrer og baser Case B: Østerbyværket Case C: Rensning Case

Læs mere

Kemi A. Studentereksamen

Kemi A. Studentereksamen Kemi A Studentereksamen 2stx111-KEM/A-30052011 Mandag den 30. maj 2011 kl. 9.00-14.00 pgavesættet består af 4 opgaver med i alt 18 spørgsmål samt 2 bilag i 2 eksemplarer. Svarene på de stillede spørgsmål

Læs mere

Opstilling af model ved hjælp af differentialkvotient

Opstilling af model ved hjælp af differentialkvotient Opstilling af model ved hjælp af differentialkvotient N 0,35N 0, 76t 2010 Karsten Juul Til eleven Dette hæfte giver dig mulighed for at arbejde sådan med nogle begreber at der er god mulighed for at der

Læs mere

Syrer, baser og salte

Syrer, baser og salte Syrer, baser og salte Navn: Indholdsfortegnelse: Ion begrebet... 2 Ætsning af Mg bånd med forskellige opløsninger... 5 Elektrolyse af forskellige opløsninger... 7 Påvisning af ioner i forskellige opløsninger

Læs mere

Exoterme og endoterme reaktioner (termometri)

Exoterme og endoterme reaktioner (termometri) AKTIVITET 10 (FAG: KEMI) NB! Det er i denne øvelse ikke nødvendigt at udføre alle forsøgene. Vælg selv hvilke du/i vil udføre er du i tvivl så spørg. Hvis du er interesseret i at måle varmen i et af de

Læs mere

Start af nyt schematic projekt i Quartus II

Start af nyt schematic projekt i Quartus II Start af nyt schematic projekt i Quartus II Det følgende er ikke fremstillet som en brugsanvisning der gennemgår alle de muligheder der er omkring oprettelse af et Schematic projekt i Quartus II men kun

Læs mere

Muterede Bygplanter Absorptionsspektrum

Muterede Bygplanter Absorptionsspektrum Muterede Bygplanter Absorptionsspektrum Når planter skal lave fotosyntese absorberer de lys fra solen. Sollys består af lys med forskellige bølgelængder. Når en plante bruger sollys til fotosyntese absorberer

Læs mere

Overfør fritvalgskonto til pension

Overfør fritvalgskonto til pension Microsoft Development Center Copenhagen, January 2009 Løn Microsoft Dynamics C52008 SP1 Overfør fritvalgskonto til pension Contents Ønsker man at overføre fritvalgskonto til Pension... 3 Brug af lønart

Læs mere

Tabeller og diagrammer

Tabeller og diagrammer Tabeller og diagrammer Udarbejdet af: Niels Jørgen Andreasen, VUC Århus nja@vucaarhus.dk Modul,7 - tabeller og diagrammer Side 7 : Tabellen og diagrammet herunder viser, hvor mange børn der blev født i

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Emneopgave: Lineær- og kvadratisk programmering:

Emneopgave: Lineær- og kvadratisk programmering: Emneopgave: Lineær- og kvadratisk programmering: LINEÆR PROGRAMMERING I lineær programmering løser man problemer hvor man for en bestemt funktion ønsker at finde enten en maksimering eller en minimering

Læs mere

De fremstillede transformerede kloner kan eventuel analyseres som beskrevet i punkt C.

De fremstillede transformerede kloner kan eventuel analyseres som beskrevet i punkt C. 11. juni UVM sags nr. 166.471.021 AT jnr. 20050002257 Aftale mellem Undervisningsministeriet og Arbejdstilsynet om retningslinjer for godkendte forsøg med genteknologi i henhold til Bekendtgørelse om genteknologi

Læs mere

Virk.dk. A one-stop-shop for businesses. Peter Bay Kirkegaard, pbk@eogs.dk Special Advisor Danish Commerce and Companies Agency

Virk.dk. A one-stop-shop for businesses. Peter Bay Kirkegaard, pbk@eogs.dk Special Advisor Danish Commerce and Companies Agency Virk.dk A one-stop-shop for businesses Peter Bay Kirkegaard, pbk@eogs.dk Special Advisor Danish Commerce and Companies Agency Agenda Background Status Future 16-10-2007 2 Virk.dk 16-10-2007 3 Vision Political

Læs mere

Nyhedsbrev nr. 1, 2014.

Nyhedsbrev nr. 1, 2014. Nyhedsbrev nr. 1, 2014. Kære kollega, Vi ved godt, at hverdagen er travl, og at du formentlig har masser af andre ting at give dig til lige nu, så tak fordi du giver dig tid til at læse vores nyhedsbrev.

Læs mere

Fra spild til penge brug enzymer

Fra spild til penge brug enzymer Fra spild til penge brug enzymer Køreplan 01005 Matematik 1 - FORÅR 2010 Denne projektplan er udarbejdet af Per Karlsson og Kim Knudsen, DTU Matematik, i samarbejde med Jørgen Risum, DTU Food. 1 Introduktion

Læs mere

Børsteormene Marenzelleria

Børsteormene Marenzelleria Børsteormene Marenzelleria - PCR optimering i forbindelse med identifikation af siblingearter Roskilde Universitet 2011 Bachelor projekt Safa Maarouf og Nanna Høegh Jensen. Samarbejde med Jasna Mozina

Læs mere

Da beskrivelserne i danzig Profile Specification ikke er fuldt færdige, foreslås:

Da beskrivelserne i danzig Profile Specification ikke er fuldt færdige, foreslås: NOTAT 6. juni 2007 J.nr.: 331-3 LEA Bilag A danzig-møde 15.6.2007 Opdatering af DAN-1 og danzig Profile Specification Forslag til opdatering af Z39.50 specifikationerne efter udgivelse af Praksisregler

Læs mere

UPDATE EFTERÅR 2015. Denovix ny leverandør Spektrofotometer og fluorometer i ét og samme instrument Se side 3

UPDATE EFTERÅR 2015. Denovix ny leverandør Spektrofotometer og fluorometer i ét og samme instrument Se side 3 EFTERÅR 2015 UPDATE Denovix ny leverandør Spektrofotometer og fluorometer i ét og samme instrument Se side 3 Azure Imaging System Chemiluminiscens detektion: Afløseren til dit mørkekammer Se side 4 - på

Læs mere

Bakterier Venner eller fjender?

Bakterier Venner eller fjender? Akademiet for Talentfulde Unge 2013: Bakterier Venner eller fjender? Ole Skovgaard olesk@ruc.dk Ole Skovgaard, 2013 Bakterier: Er en ur-gammel livsform! Indeholder langt større variationer end de store

Læs mere

Sjov med tal. Introduktion til statistisk kvalitetsudvikling. Jacob Anhøj. Dansk Selskab for Patientsikkerhed

Sjov med tal. Introduktion til statistisk kvalitetsudvikling. Jacob Anhøj. Dansk Selskab for Patientsikkerhed Sjov med tal Introduktion til statistisk kvalitetsudvikling Jacob Anhøj Dansk Selskab for Patientsikkerhed 2013 Dilbert om tal Jacob Anhøj (DSFP) Sjov med tal 2013 2 / 28 Tre spørgsmål og en cykel??? o^ô

Læs mere

Mercodia Proinsulin ELISA

Mercodia Proinsulin ELISA Mercodia Proinsulin ELISA Brugsanvisning 10-1118-01 REAGENS TIL 96 BESTEMMELSER Til in vitro-diagnosticering Fremstillet af Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Sverige FORKLARING AF SYMBOLER

Læs mere

Bilag. Resume. Side 1 af 12

Bilag. Resume. Side 1 af 12 Bilag Resume I denne opgave, lægges der fokus på unge og ensomhed gennem sociale medier. Vi har i denne opgave valgt at benytte Facebook som det sociale medie vi ligger fokus på, da det er det største

Læs mere

Bioaugmentering til oprensning af pesticidpunktkilder

Bioaugmentering til oprensning af pesticidpunktkilder Bioaugmentering til oprensning af pesticidpunktkilder MCPP Anders Johansen, Aarhus Universitet, Institut for Miljøvidenskab. Miljøingeniør Katrine Smith, Miljøstyrelsen. Hydrogeolog Hasse Milter, Region

Læs mere

2013 SP1. Konfiguration af koncernindblik. Configuration Guide

2013 SP1. Konfiguration af koncernindblik. Configuration Guide 2013 SP1 Konfiguration af koncernindblik Configuration Guide Intellectual Property Rights This document is the property of ScanJour. The data contained herein, in whole or in part, may not be duplicated,

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet?

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Lyn dine gener op! En baglæns besked, gemt i 'backup-dna'et'

Læs mere

Hovedbunds behandlinger

Hovedbunds behandlinger New Generation Hovedbunds behandlinger introduktion af Active hair power side 4-15 Kontrol af fedtet hår, -hårserie - Balance Shampoo Energy Shampoo Anti skæl program - Purify shampoo Anti skæl program

Læs mere

mrna-status Verifikation Ved Promoter Varianter

mrna-status Verifikation Ved Promoter Varianter En bachelorafhandling ved Molekylærgenetisk Diagnostisk Afsnit, Rigshospitalet, København. mrna-status Verifikation Ved Promoter Varianter Afprøvning af en ny metode indenfor functional promotor assays

Læs mere

Video Projector Controller. Brugermanual

Video Projector Controller. Brugermanual Jægergårdsgade 152/05A DK-8000 Aarhus C DENMARK WWW.WAHLBERG.DK l Video Projector Controller Brugermanual WWW.WAHLBERG.DK TELEPHONE +45 86 18 14 20 CELL PHONE +45 40 52 20 88 EMAIL: mads@wahlberg.dk Feb

Læs mere

Trolling Master Bornholm 2013

Trolling Master Bornholm 2013 Trolling Master Bornholm 2013 (English version further down) Tilmeldingerne til 2013 I dag nåede vi op på 85 tilmeldte både. Det er stadig lidt lavere end samme tidspunkt sidste år. Tilmeldingen er åben

Læs mere

To modeller af NDRG2 proteinet: RCSB Protein Data Bank

To modeller af NDRG2 proteinet: RCSB Protein Data Bank 2009 Roskilde Universitet Naturvidenskabelige Basisstudium 4. Semesters Projekt To modeller af NDRG2 proteinet: RCSB Protein Data Bank Bassam Tawfik Florian Malte Hermann Kenneth Ege Jørgensen Lena de

Læs mere

Anvendt BioKemi: Blod som et kemisk system, Struktur af blod

Anvendt BioKemi: Blod som et kemisk system, Struktur af blod Anvendt BioKemi: Struktur 1) MM1 Intro: Terminologi, Enheder Math/ biokemi : Kemiske ligninger, syre, baser, buffer Små / Store molekyler: Aminosyre, proteiner 2) MM2 Anvendelse: blod som kemiske systemer

Læs mere

Biologisk rensning Fjern opløst organisk stof fra vand

Biologisk rensning Fjern opløst organisk stof fra vand Spildevandscenter Avedøre Biologisk rensning Fjern opløst organisk stof fra vand Øvelse I Formål: På renseanlægget renses et mekanisk, biologisk og kemisk. I den biologiske rensning på renseanlægget benyttes

Læs mere

Projektrapport Introduktion af nye og forbedrede vildarts-egenskaber i kartoffel

Projektrapport Introduktion af nye og forbedrede vildarts-egenskaber i kartoffel Projektrapport Introduktion af nye og forbedrede vildarts-egenskaber i kartoffel Overordnet rapportering Projektet Introduktion af nye og forbedrede vildarts-egenskaber i kartoffel som er et samarbejde

Læs mere

LW313 Sweex Wireless 300N Adapter USB

LW313 Sweex Wireless 300N Adapter USB LW313 Sweex Wireless 300N Adapter USB Bemærk venligst! Udsæt ikke Sweex Wireless 300N Adapter USB for ekstreme temperaturer. Placér ikke adapteren i direkte sollys eller i nærheden af radiatorer eller

Læs mere

Redoxprocessernes energiforhold

Redoxprocessernes energiforhold Bioteknologi 2, Tema 3 Opgave 8 Redoxprocessernes energiforhold Dette link uddyber energiforholdene i redoxprocesser. Stofskiftet handler jo netop om at der bindes energi i de organiske stoffer ved de

Læs mere

Oste-kemi. Størstedelen af proteinerne i mælken findes som små kugleformede samlinger, kaldet miceller.

Oste-kemi. Størstedelen af proteinerne i mælken findes som små kugleformede samlinger, kaldet miceller. Man behøver ikke at sætte sig ind i de mere tekniske eller kemiske forhold for at lave ost selv, men for dem som gerne vil vide mere om hvad der grundlæggende sker ved forvandlingen af mælk til ost, så

Læs mere

Fyld en reaktor spillet

Fyld en reaktor spillet Fyld en reaktor spillet Velkommen i dit nye job som katalysatorsælger hos Haldor Topsøe. I dag skal du stå for at loade en hydrotreating reaktor med nye katalysatorer. Udfordringen lyder på at optimere

Læs mere

Hvor er mine runde hjørner?

Hvor er mine runde hjørner? Hvor er mine runde hjørner? Ofte møder vi fortvivlelse blandt kunder, når de ser deres nye flotte site i deres browser og indser, at det ser anderledes ud, i forhold til det design, de godkendte i starten

Læs mere

Pepticate information og gode råd om mælkeallergi hos de mindste

Pepticate information og gode råd om mælkeallergi hos de mindste Pepticate information og gode råd om mælkeallergi hos de mindste Brystmælk er den bedste ernæring til spædbørn. Pepticate er en fødevare til særlige medicinske formål, som anvendes i samråd med læge eller

Læs mere

Mod Infektioner. Foto Aktiveret Terapi

Mod Infektioner. Foto Aktiveret Terapi Mod Infektioner Foto Aktiveret Terapi PACT er et varemærke fra: Hahn Medical Systems Foto Aktiveret Terapi Foto Aktiveret Terapi har været uundværlig i moderne medicin siden 1990 erne, i behandlingen af

Læs mere

Baltic Development Forum

Baltic Development Forum Baltic Development Forum 1 Intelligent Water Management in Cities and Companies developing and implementing innovative solutions to help achieve this objective. Hans-Martin Friis Møller Market and Development

Læs mere

Programmering af Babysimulator

Programmering af Babysimulator Programmering af Babysimulator Indhold Introduktion... 3 Programmering via computeren... 3 Class... 5 Student... 5 Baby... 6 Start/stop... 6 Schedule order... 6 Quiet Times... 7 Daycare vuggestue... 7

Læs mere

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres.

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres. Epigenetik Men hvad er så epigenetik? Ordet epi er af græsk oprindelse og betyder egentlig ved siden af. Genetik handler om arvelighed, og hvordan vores gener videreføres fra generation til generation.

Læs mere

Grønlandsk kartoffelavl uden pesticider men med gavnlige antifungale bakterier

Grønlandsk kartoffelavl uden pesticider men med gavnlige antifungale bakterier Grønlandsk kartoffelavl uden pesticider men med gavnlige antifungale bakterier Peter Stougaard og Charlotte Frydenlund Michelsen* Institut for Plante- og Miljøvidenskab Sektion for Genetik og Mikrobiologi

Læs mere

Livets molekylære kode

Livets molekylære kode 4. ÅR R. 2 / 2006 Livets molekylære kode -kemi og biologi mødes D livets molekylære kode D findes i alle levende organismer og indeholder koden til organismen informationer, der afgør om organismen er

Læs mere

Variabel- sammenhænge

Variabel- sammenhænge Variabel- sammenhænge 2008 Karsten Juul Dette hæfte kan bruges som start på undervisningen i variabelsammenhænge for st og hf. Indhold 1. Hvordan viser en tabel sammenhængen mellem to variable?... 1 2.

Læs mere

Nyhedsbrev løn. Microsoft Dynamics C5 2012 Service pack 1 Hotfix 5 & 2010 Service pack 2 Hotfix 3. Ferie 2014

Nyhedsbrev løn. Microsoft Dynamics C5 2012 Service pack 1 Hotfix 5 & 2010 Service pack 2 Hotfix 3. Ferie 2014 Microsoft Dynamics C5 2012 Service pack 1 Hotfix 5 & 2010 Service pack 2 Hotfix 3 Ferie 2014 Marts 2014 Contents Overførsel af ferieoplysninger pr. 01/05-2014 3 Overførsel af feriepenge på fratrådte funktionærer

Læs mere

Lægemiddelregning. Opgaver og e-læring

Lægemiddelregning. Opgaver og e-læring Lægemiddelregning Opgaver og e-læring Regn den ud! Hospitalsapoteket har udarbejdet dette sæt opgaver i lægemiddelregning. Flere sygeplejersker har efterspurgt dette, og flere undersøgelser har vist, at

Læs mere

UNDERSØGELSE AF JORDRESPIRATION

UNDERSØGELSE AF JORDRESPIRATION UNDERSØGELSE AF JORDRESPIRATION Formål 1. At bestemme omsætningen af organisk stof i jordbunden ved at måle respirationen med en kvantitative metode. 2. At undersøge respirationsstørrelsen på forskellige

Læs mere