Kortlægning af interaktion mellem IFN λ3 og IL- 10R2

Størrelse: px
Starte visningen fra side:

Download "Kortlægning af interaktion mellem IFN λ3 og IL- 10R2"

Transkript

1 Kortlægning af interaktion mellem IFN λ3 og IL- 10R2 Et eksperimentelt bachelor projekt i molekylærbiologi Af Sanne Ea Jørgensen Ved associated professor Rune Hartmann Molekylærbiologisk institut Aarhus universitet Afleveret d. 22. Juni

2 Indholdsfortegnelse ABSTRACT... 3 INTERFERON... 4 SIGNALERING... 4 STRUKTUREN AF Λ3 OG DENS RECEPTOR IL- 10R METODER OG MATERIALER... 9 MEDIER, BUFFERE, PLADER, GELER OG MARKØRER... 9 SITE DIRECTED MUTAGENESIS OG OPRENSNING AF PLASMID TRANSFORMATION OG OPFORMERING AF DH5Α CELLER TIL OPFORMERING AF PLASMID OPRENSNING AF PLASMID OG SEKVENTERING TRANSFORMATION OG OPFORMERING AF BL21DE3 CELLER TIL PROTEIN PRODUKTION PROTEIN OPRENSNING OG REFOLDNING PROTEIN GELER SEKVENTERING PROTEIN OPRENSNING OG REFOLDNING DISKUSSION/KONKLUSION TAK TIL REFERENCE LISTE

3 Abstract Interferon (IFN)- λ3 is the most potent of the three IFN- λ (8). Due to its antiviral effect and the limited tissues that responds to it, it has a great potential in treatment of viral infections. IFN- λ3 binds to the receptors IL- 10R2 and IFN- λr1. In this project, I wish to limit the location of the binding site between IFN- λ3 and its receptor chain IL- 10R2. To do this, I have chosen three amino acids, which I believe is located, at the periphery of the binding site. I have assessed this, from the structure of the complex between IFN- λ3 and its receptor chains IFN- λr1 and IL- 10R2. Besides this, I have examined the amino acid 49 in IFN- λ3, this site is exposed to single- nucleotide polymorphisms (SNP), and it is thought to be important in the recovery from and treatment of hepatitis C. According to the literature, it has no significant effect on the virus replication and the signalling of IFN- λ3, I wish to verify this in our antiviral assay. I have mutated the four amino acids in IFN- λ3 and purified the proteins. I found that the protocol I used to purify IFN- λ3 and the mutants gives a clean product. Unfortunately there was no time to run the antiviral assay, but I do not expect that any of my mutations have any effect in the assay. The three of them are located outside of the binding site between IFN- λ3 and IL- 10R2, and the amino acid 49 have not previously shown any effect in the literature. 3

4 Introduktion Interferon Interferoner er en gruppe cytokiner der har en antiviral effekt (7). De er opdelt i tre grupper; type I, II og III interferon (7). Hos pattedyr består type I IFN af IFN- α, - β, - ω, - ε, - τ, - δ og - κ, det er dog kun IFN- α og - β der induceres af og beskytter imod virus (7). Både IFN- α og - β består af flere subtyper af interferoner hos pattedyr(7). Type II interferon består kun af IFN- γ (7), som jeg ikke vil beskæftige mig mere med her. Type III interferon blev opdaget samtidigt af to grupper under ledelse af henholdsvis P. Sheppard (1) og S. Kotenko (2) i De fandt, at der er 3 subtyper, og de navngav dem henholdsvis IL- 28A/IFN- λ2, IL- 28B/IFN- λ3 og IL- 29/IFN- λ1 (1, 2). De demonstrerede den antivirale aktivitet af IFN- λ, ved at vise at IFN- λ inducerer de antivirale proteiner 2,5 - OAS og MxA, og at IFN- λ induceres af virus (2). Senere fandt man at induktionen af IFN- λ sker via Toll- like receptor (TLR) 3 og 9 (4). IFN- λ produceres af de fleste celler, men det er dog hovedsageligt dendritcellerne, der står for IFN- λ produktionen (4). Derimod er det ikke alle celler der responderer på IFN- λ. Et respons på IFN- λ kræver at begge receptoren for IFN- λ er udtrykt på en celles overflade (6), og da IFN- λr1 hovedsageligt er udtrykt på epithel celler, ses der kun et respons på IFN- λ, i organer der er rige på epithel celler, som f.eks. huden, tarmen, maven og lungerne (6). IFN- α og - λ inducerer de samme gener og dermed det samme antivirale respons i celler (5). I modsætning til IFN- λ receptorerne udtrykkes IFN- α receptorerne i flere celle typer (5). Denne fordeling af responset, kan netop være en af grundene til, at vi både har IFN- α og - λ, der ellers ser ud til at spille den samme rolle i immunforsvaret (5, 6). Grundet den antivirale effekt af IFN- α, benyttes det i dag i behandlingen af hepatitis C, men behandlingen har en lang række bivirkninger (13). Fordi færre celler responderer på IFN- λ, er der håb om, at man kan erstatte IFN- α med IFN- λ og dermed opleve færre bivirkninger (5). Ud af IFN- λ1, 2 og 3 er det IFN- λ3, der er bedst til at bekæmpe virale infektioner i mammale celler(8). Derfor ønsker vi at kende bindingsstedet mellem IFN- λ3 og receptorkæden IL- 10R2. Signalering Type I og III IFN signalerer via Jak- STAT signal vejen, men de benytter forskellige receptorer (9). Jeg vil her beskrive den generelle signalvej for type I og III IFN. Før IFN binder til receptor kæderne er Tyrosin kinase 2 (Tyk2) bundet til IFNAR1, og tyrosin kinasen Janus kinase 1 4

5 (JAK1) IFNAR2. Ved binding af IFN til receptor kæderne, sker der en konformatiel ændring, dette resulterer i at Tyk2 og JAK1 kryds- phosphorylerer hinanden, hvorved de aktiveres. Denne aktivering resulterer i phosphoryleringen af IFNAR1, hvorefter STAT2 kan bindes og phosphoryleres af Tyk2. Samtidigt phosphoryleres STAT1 af JAK1. STAT1 og 2 er allerede svagt bundne til hinanden, før IFN binder til receptoren, og phosphoryleringen resulterer i, at de to STAT proteiner binder stærkere til hinanden, og danner en heterodimer. Heterodimeren danner et kompleks med IFN regulerende faktor 9 (IRF- 9), dette kompleks kaldes IFN Stimuleret Gen Faktor 3 (ISGF3). ISGF3 binder IFN- Stimuleret Response Elementer (ISRE), der findes i promoter regionerne til de fleste IFN Stimulerede Gener (ISG) (fig. 1) (7, 9). Figur 1 Oversigt over signalvejene for IFN- α og IFN- λ. Signalvejene for de to inteferoner er ens, men receptorene er forskellige. IFN- α signalerer via IFNAR1 og 2 og IFN- λ signalerer via IFNλR1 og IL- 10R2. Når interferon binder til receptor kæder kryds- phosphoryleres Jak1 og Tyk2, der derefter phosphorylere STAT 1 og 2. STAT 1 og 2 danner en heterodimer, der binder IRF- 9, dette kompleks kaldes ISGF3 og binder til ISRE segmentet i promoteren til ISG, hvorved ISG er udtrykkes. 5

6 Strukturen af λ3 og dens receptor IL- 10R2 IFN- λ binder til receptorkæderne IFN- λr1 (CRF2-12) og IL- 10R2 (CRF2-4) (2). Jeg fokuserer her på bindingen mellem IFN- λ3 og IL- 10R2 og vil derfor kort beskrive strukturen af IFN- λ3 og IL- 10R2. Strukturen af IFN- λ3 blev bestemt i 2009 af H. Gad et al. (11). Strukturen består af 6 sekundære strukturelementer, der er navngivet A- F, alle på nær B elementet er alfa helixer, B elementet er et fleksibelt loop (11). F helixen indeholder et knæk og danner sammen med A, C og D helixerne en kerne af helixer. B elementet forbinder A og C helixerne og ligger uden for denne kerne sammen med E helixen (11). Det er kun strukturen af den ekstracellulære del af IL- 10R2 (sil- 10R2), der er bestemt. Den blev bestemt af S. Yoon et al. (3) i sil- 10R2 består af to fibronectin type III domæner, hvert domæne består af 7 beta strenge, der er forbundet af loops. De to domæner sidder i en vinkel på 95 o, med det N- terminale domæne (D1) længst væk fra cellemembranen og det C- terminale domæne (D2) tættest på cellemembranen (3). 6

7 A B C Figur2 IFN- λ3 (blå) i kompleks med receptor kæderne IFN- λr1 (lys blå) og IL- 10R2 (gul og rød). Strukturerne er lavet af Ole Jensen Hamming, baseret på PDB entery 3OG4 (12) og 3LQM (3). A: Her ses hele komplekset. B: Aminosyrener S110, D89 og K82 på IFN- λ3 er markert med grøn. Til venstre i billedet ses IL- 10R2 i rød og gul. De aminosyrer der er angivet med navn på IFN- λ3, er aminosyrer der er muteret af andre i gruppen. C: Aminosyren K49 på IFN- λ er markeret med grøn. Til venstre i billedet ses IFN- λr1 i lys blå og til højre ses IL- 10R2 i rød. De grønne aminosyrer der ikke er navngivne, er de aminosyrer der ses på fig. 2A. 7

8 Det forventede bindingssted mellem IL- 10R2 og IFN- λ er mellem D1 på IL- 10R2 og helix C og D på IFN- λ. På fig. 2A ses komplekset af IL- 10R2 (gul og rød), IFN- λr1 (lys blå) og IFN- λ3 (blå). Fig. 2A er lavet ud fra strukturen af IFN- λ3 receptor komplekset samlet af Ole Jensen Hamming, baseret på PDB entery 3OG4 (12) og 3LQM (3). IL- 10R2 er receptor for fem forskellige klasse cytokiner, der i blandt IFN- λ3 (3). S. Yoon et al. fandt at tyrosin 59 på IL- 10R2 er vigtig for bindingen mellem IL- 10 og IL- 10R2, men ikke for bindingen mellem IL- 22 og IL- 10R2. Derudover fandt de, at tyrosin 82 på IL- 10R2 er vigtige for IL- 10R2 s binding til både IL- 22 og IL- 10 (3). Ud fra dette og strukturen på fig. 2A har vi i gruppen udvalgt en række aminosyrer på IFN- λ3, der kunne være vigtige for bindingen mellem IFN- λ3 og IL- 10R2, disse aminosyrer ses på fig. 2B. Vi har i gruppen foretaget alanin scans over disse aminosyrer, for at se betydningen af disse aminosyrer for IFN- λ3 s antivirale effekt. Jeg har valgt at mutere aminosyrerne serin 110, asparaginsyre 89 og lysin 82, det er de aminosyrer der ses farvet med grøn på fig. 2B. Jeg har valgt disse aminosyrer, fordi de på strukturen ser ud til, at ligge for langt væk fra Y59 og Y82 til at de kan interagere. De kan derfor være med til, at afgrænse bindings stedet mellem IFN- λ3 og IL- 10R2. Udover disse tre aminosyrer, ønsker jeg også at kigge på lysin 49. Denne aminosyre varierer i single- nukleotide polymorphisms (SNP) hos mennesker, og dette har betydning for, hvor let man har ved at komme over en hepatitis C infektion, og hvor modtagelig man er for behandling med pegifn- α (11). Jeg sammenligner derfor vild typen (med lysin 49) med proteinet IFN- λ3_k49r og IFN- λ3_k49a, for på denne måde at se, om disse mutationer har nogen betydning for IFN- λ3 s antivirale effekt. Jeg har valgt at muterer lysin 49 til arginin, fordi der på IFN- λ2, sidder en arginin på position 49 (2), og jeg ved at IFN- λ2 har en langt mindre antiviral effekt end IFN- λ3 (8). På fig. 2C ses lysin 49 s placering i strukturen, den ser ikke ud til at kunne have nogen effekt på bindingen til receptorkæderne IL- 10R2 og IFN- λr1. Jeg vil foretage alanin scans af disse fire aminosyrer og undersøge deres aktivitet i et antiviralt assay. Men jeg forventer ikke at alanin scans af disse aminosyrer vil have nogen effekt på et antiviralet aktivitets assay. 8

9 Metoder og Materialer Medier, buffere, plader, geler og markører Luria Bertani (LB) medie: 5% (w/v) gær ekstrakt, 10% (w/v) bacto tryptone, 5% (w/v) NaCl, H2O tilsat til en liter. Mediet blev autoklaveret med det samme efter blanding. Phosphate buffered saline solution (PBS): En PBS tablet fra Gibco opløses i 500 ml H2O ifølge producentens instruktioner og autoklaveres. KCM: 120 mm KCl, 20 mm NaCl, 10 mm Tris- HCl, 0,5 mm EDTA (VWR), 0,1% [v/v] Triton X- 100 i H2O. Lyserings buffer: 300 mm NaCl, 50 mm NaH2PO4, 8 M urea, H2O, ph indstilles med HCL og NaOH til ph 8,0. Vaske buffer: 500 mm NaCl, 50mM NaH2PO4, 10 mm imidazole, 8 M urea, H2O, ph indstilles med HCL og NaOH til ph 8,0. 5 mm β- mercaptoethanol tilsættes kort før brug. Eluerings buffer: 20 mm Tris/HCL, 100 mm NaCl, 250 mm imidazole, 8 M urea, H2O, ph indstilles med HCL og NaOH til ph 7,5. 5 mm β- mercaptoethanol tilsættes kort før brug. Dialyse buffer no. 2: 50 mm Tris/HCL, 100 mm NaCl, 6 M urea, H2O, ph indstilles med HCL og NaOH til ph 6,5. Refoldnings buffer no. 4: 50 mm MES, 240 mm NaCl, 10 mm KCl, 0,5 M L- Arginine, 0,75 M guanidine HCl, 0,5% triton X- 100, H2O ph indstilles med HCL og NaOH til ph 6,0. 2 mm reduceret glutathione og 0,5 mm oxideret glutathion tilsættes kort før brug. Dialyse buffer no.4: 20 mm MES, 200 mm NaCl, 5% glycerol, H2O, ph indstilles med HCL og NaOH til ph 6,5. 9

10 Ionbytter Buffer 1A: 20 mm HEPES, 25 mm NaCl, H2O, ph indstilles med HCL og NaOH til ph 6,8. Bufferen filtreres før brug. Ionbytter Buffer 1B: 20 mm HEPES, 1 M NaCl, H2O, ph indstilles med HCL og NaOH til ph 6,8. Bufferen filtreres før brug. Agar plader med ampicilin: 5% (w/v) gær ekstrakt, 10% (w/v) bacto tryptone, 5% (w/v) NaCl, 12% (w/v) agar, H2O tilsat til en liter. Mediet blev autoklaveret med det samme efter blanding. 0,1% (v/v) ampicillin blev tilsat kort før blandingen blev fyldt i petri- skåle. Agarose gel: 80 ml TBE, 0,8 g agarose, 3 μl ethidium bromid. 12% Acrylamid gel: gelen består af en stacking gel og en running gel. Stacking gel: 3,3 ml 30% acrylamid, 6,3 ml Flig C ph 6,8, 15,0 ml H2O, 250 µl 10% SDS, 125 µl 10% APS, 25 µl TEMED. Running gel: 40 ml 30% acrylamid, 25 ml flig B ph 8,85, 33,5 ml H2O, 1,0 ml 10% SDS, 500 µl 10% APS, 50 µl TEMED. Site directed mutagenesis og oprensning af plasmid For hver mutant kører jeg to PCR reaktioner, en med 25 ng template og en med 100 ng template, dette gøres for at sikre et produkt. For lidt template kan resultere i at plasmidet ikke opformeres og hvis der er for meget template kan det være svært at komme af med efter reaktionen. Jeg lavede derfor to reaktions blandinger for hver mutant. 10

11 Tabel 1 Reaktions blandingen til site directed mutagenesis. 25 ng template 100 ng template 36,5 µl ddh 2 O 33,5 µl ddh2o 5 μl pfuultra II reaction buffer 5 μl pfuultra II reaction buffer 5 μl dntp mix 5 μl dntp mix 1 µl IFN- λ3- pet- 15b 4 µl IFN- λ3- pet- 15b 1 μl forward primere 1 μl forward primere 1μL reverse primer 1μL reverse primer 0,5 μl pfuultra II fusion HS DNA polymerase 0,5 μl pfuultra II fusion HS DNA polymerase Jeg benyttede følgende primere. Tabel 2 Primere K70R_upper K70R_lower K70A_upper K70A_lower S110A_upper S110A_lower D89A_lower D89A_lower K82A_upper K82A_lower GACGGCTACGGCATCTACAATCTTTCAGCAGC GCTGCTGAAAGATTGTAGATGCCGTAGCCGTC GACGGCTACGGCATGCACAATCTTTCAGCAGC GCTGCTGAAAGATTGTGCATGCCGTAGCCGTC GCATCATATTCTGGCCCAGCTGCGTGCGTG CACGCACGCAGCTGGGCCAGAATATGATGC GGAAGCGACCGCCGCTACCGATCCGGCGCTGGG CCCAGCGCCGGATCGGTAGCGGCGGTCGCTTCC GGCGCTGACCCTGGCAGTTCTGGAAGCGACCGC GCGGTCGCTTCCAGAACTGCCAGGGTCAGCGCC Jeg kørte reaktionerne ved følgende program på PCR maskinen: 2 min ved 95 o C, (30 s ved 95 o C, 1 min ved 52 o C og 7 min og 30 s ved 65 o C) i 4cykler, (30 s ved 95 o C, 1 min ved 55 o C og 7 min og 30 s ved 65 o C) i 20 cykler. 11

12 Efter PCR reaktionen kløvede jeg templaten med Dpn 1 ved 37 o C i 1 time, for at fjerne den methylerede umuterede template. Efter kløvningen med Dpn 1 oprensede jeg plasmiderne på en agarose gel, hvorefter jeg udskar de bånd, der indeholdte plasmiderne og oprensede plasmiderne fra dem med illustra GFX PCR DNA and gel band purification kit fra GE helthcares efter producentens instruktioner. Det oprensede plasmid blev opbevaret på is. Transformation og opformering af DH5α celler til opformering af plasmid Til transformeringen af DH5α celler blev brugt en blanding af: Tabel 3 transformations blandingen til transformation af DH5 α celler. Transformations blanding Oprenset plasmid KCM buffer ddh2o DH5α celler 40 μl 20 μl 40 μl 100 μl Blandingen blev inkuberet på is i 20 min og derefter ved stue temperatur i 10 min. Jeg tilsatte så 800 µl LB medie og inkuberede blandingen i ryste inkubatoren med 180 rpm i 1 time ved 37 o C. Cellerne er nu transformerede og 150 µl bakterie kultur plades ud på agarplader med ampicillin, for at selektere for de transformerede celler. Cellerne gror på pladerne natten over ved 37 o C. Der blev også lavet en negativ kontrol plade, hvor bakterierne havde fået tilsat 40µL ddh2o i stedet for 40 µl plasmid. Dagen efter blev der først undersøgt, at der ikke var bakterie kolonier på kontrolpladen. Derefter blev bakterier fra en koloni pr. Mutant overført til rør sammen med 5 ml autoklaveret LB medie og 5 µl ampicillin. Rørene blev inkuberet natten over i ryste inkubatoren med 180 rpm ved 37 o C. 12

13 Oprensning af plasmid og sekventering For at kunne sekventere det muterede plasmid, og dermed fastslå om de ønskede mutationer er opnået, blev plasmiderne først oprenset fra DH5α cellerne fra dagen før. Dette blev gjort med GenElute Plasmid miniprep kit fra Sigma, jeg fulgte producentens anvisninger. Det oprensede plasmid blev sendt til sekventring hos eurofins. Sekvenserne fra eurofins blev undersøgt i CLC main workbench 5. I menuen Toolbox valgte jeg Sequencing Data Analysis og Assemble Sequences to Reference, her valgte jeg at sammenligne de sekventerede plasmider med wt sekvensen i vektoren IFN- λ3 pet- 15b. For at kontrollere at de mutationer der måtte være, udover den ønskede mutation, var nonsense mutationer, translaterede jeg sekvensen i CLC main workbench 5, på denne måde kan jeg verificere at jeg kun har en mutation i hver sekvens, og at denne mutation er den ønskede mutation. Transformation og opformering af BL21DE3 celler til protein produktion Transformationen af BL21DE3 celler foregik som transformation af DH5α celler ovenfor. Jeg transformerede celler både med mine fem mutanter og med vild typen. Som ovenfor blev det først tjekket, at der ikke var kolonier på kontrol pladen. Så overførte jeg cellerne fra agarpladerne til kolber med LB medie og 0,1 mg/ml ampicillin. Kolberne blev inkuberet i ryste inkubatoren ved 37 o C og 180 rpm indtil OD600 nm kom over 0,6 (3-4 timer), 0,5-2 mm Isopropyl- B- D Thiogalactopyraniside (IPTG) blev nu tilsat og kulturen blev inkuberet i yderligere 2-3 timer. Protein oprensning og refoldning Celle kulturene blev centrifugeret i en Avanti J- 26 XPI centrifuge ved 7000 rpm i 15 min. Supernantanten blev fjernet og bakterie peleten vasket i koldt PBS og overført til 50 ml nunc rør. Cellerne fryses ned natten over. Cellerne optøs og opløses i ml lyserings buffer pr. liter bakterie kultur, hvorefter de lyseres ved at køre dem igennem en høj tryks homoganisator 2 gange. Lysatet centrifugeres ved rpm i 35 min for at peletere celle rester. Supernantanten inkuberes på rystebord med 1,5 ml Ni- NTA beads pr. L bakterie kultur i 1,5 timer ved stue temperatur eller natten over ved 4 o C. 13

14 Efter inkuberingen blev prøven centrifugeret i 10 min ved 500 rpm og beadsene vaskes med vaske buffer, hvorefter centrifugeringen gentages, vasken gentages to gange, indtil supernantanten er klar. NI- NTA beadsene genopløses nu i vaske buffer, hvorefter de overføres til en søjle. Beadsene vaskes grundigt med vaske buffer ved at hælde vaske buffer over beadsene og lade det dryppe igennem søjlen, dette gøres med et volumen vaske buffer der svare ca. til 10 gange det brugte volumen Ni- NTA. Efter vasken tilsættes ca ml eluerings buffer og eluenten opsamles nu i 50 ml nunc rør. Der tilsættes DTT til en koncentration på mm (1 ml 0,5 M DTT pr. 50 ml eluent) til eluenten og den inkuberes i ca. 1 time ved stue temperatur. Proteinerne skal nu refoldes. Dette gøres ved først at overføre proteinet til Da dialyse poser og fortynde det med dialyse buffer no. 2 til en protein koncentration på under 0,5 mg/ml. Proteinet dialyseres så mod dialyse buffer no. 2. Derefter dialyseres det mod refoldnings buffer no. 2 og til sidst mod dialyse buffer no. 4. Dialyserne kørers hver i sær natten over. Der kan opstå bundfald i dialyse poserne, dette er protein der ikke er refoldet korrekt og derfor fælder ud. Efter refoldningen centrifugeres indholdet af dialyse poserne ved 6500 rpm i 35 min for at fjerne bundfald, og supernantanten fortyndes med ion exchange buffer 1A til ca. den dobbelte volumen. Proteinerne køres på HiTrap SP FF 5 ml kationbytter søjer med en peristaltisk pumpe, med et flow på 2 ml/min (søjlen med protein kan inkuberes natten over ved 4 o C). Derefter monterede jeg søjlen på Äktaen og jeg eluerede prøven ved at kørte ionexchange buffer 1A og 1B over søjlen med en flowrate på 0,5 ml/min, i en gradient længde på 15 base til en ionexchange buffer 1B koncentration på 100 %. Fraktionerne der indeholder IFN- λ3 eller dens mutanter samles og opkoncentreres med et centrifugal filter device. Proteinet køres nu på HiLoade 16/60 Superdex 75 gelfiltrerings søjlen, og elueres med PBS med en flowrate på 1 ml/min. Koncentrationen af de fraktioner der indeholder proteinet måles og fraktionerne fortyndes med 50% glycerol i PBS, til en glycerol koncentration på 10 %. De målte koncentrationer kan ganges med 1,48, der er absorptions koefficienten for IFN- λ3_his, og den nye koncentration kan beregnes og noteres før prøverne fryses ned ved 80 o C. 14

15 Protein geler Undervejs i forsøget er prøver med protein kørt på 12 % acrylamid geler. På hver gel er kørt en LMW markør og op til 9 prøver. Prøverne koges med SDS, før de køres på gelen, for at denaturere proteinet. 15

16 Resultater Sekventering For at gennemgå resultaterne af mine protein oprensninger, har jeg valgt at vise data fra oprensningen af IFN- λ3_k49r. Mutationen af IFN- λ3_k49r er foretaget tidligere af en anden i gruppen, og jeg har ikke haft adgang til sekventerings data for denne mutant. Derfor har jeg valgt at vise sekventeringen fra mutanten IFN- λ3_d89. Sekvenserne af de muterede plasmider, blev sammenlignet med sekvensen for IFN- λ3 vild typen i CLC main workbench 5, som beskrevet i afsnittet metoder og matrialer. Her har jeg kontrolleret, at der kun er den ønskede mutation i plasmidet, og at der ikke er sekundærer mutationer, der kunne påvirke mit resultat, dvs. sekundære mutationer der påvirker læserammen eller aminosyre sekvensen. På fig. 3 ses sammenligningen mellem IFN- λ3 vild typen (øverst på fig. 3) og IFN- λ3_d89a (nederst på fig. 3) i CLC main workbench 5. Placeringen af mutationen fremgår tydeligt, af den nederste del af fig. 3, i konsensus sekvensen (den midterste sekvens på fig. 3) er mutationen markeret med en rød trekant over nukleotid sekvensen, og både i konsensus sekvensen og i sekvensen for IFN- λ3_d89a, er mutationen i aminosyre sekvensen markeret med rødt. Nederst på fig. 3 ses trace data for sekventeringen af _D89A, det ses her at sekventeringen er god, da toppene for de forskellige aminosyre er adskilte og høje i forhold til baggrunden. Hele sekvensen er gennemset for mutationer, og jeg fandt kun den ønskede mutationer. Det samme er gjort for de andre muterede sekvenser og resultatet kan ses i tabel 4. 16

17 Figur 3 Sekventering af mutanten IFN- λ3_d89a sammenlignet med vild typen i CLC work bench. Øverst ses vildtypen. Midterst ses en consensus sekvens. Dette er en sammenligning af vild type sekvensen og sekvensen for IFN- λ3_d98a, hvoraf mutationer i nukleotid og aminosyre sekvensen fremgår, mutationen i nukleotid sekvensen er markeret med en rød trekant og mutationen i aminosyre sekvensen er markeret med rødt. Nederst ses sekvensen for IFN- λ3_d98a og trace data fra sekventeringen, mutationen er her markeret med henholdsvis rød overstregning og rød skrift. Tabel 4 Mutationer fundet i de forskellige sekvenser ved brug af CLC main workbench 5. Mutanterne IFN- λ3_k49a og IFN- λ3_k49a er foretaget og kontrolleret af Susanne Vends. Sekvens Ønsket mutation Sekundære mutationer IFN- λ3_s110a Ja Nej IFN- λ3_k82a Ja Nej IFN- λ3_d98a Ja Nej IFN- λ3_k49a Ja Nej IFN- λ3_k49r Ja Nej 17

18 LMW - lys +lys - Ni V1 VS E +D T HiLoad Figur 4 oprensningen af mutanten IFN- λ3_k49r: LMW: LMW markør, - lys: medie med celler, +lys: lyserede celler i lysis buffer, - Ni: det er ikke bandt til Ni- NTA beads, V1: første vask af Ni- NTA beads, VS: anden vask af Ni- NTA beads, E: eluent fra Ni- NTA, +D: refoldet protein, T: tom, HiLoad: Proteinet oprenset på HiLoad 16/60 Superdex 75 gelfiltrerings søjle. Protein oprensning og refoldning De sekventerede plasmider kan nu udtrykkes i BL21DE3 celler, og proteinet kan oprenses som beskrevet i afsnittet materialer og metoder. På fig. 4 kan ses en gel over de forskellige trin i oprensningen. IFN- λ3_his har en masse på 21,2 kda og er markeret på fig. 4 med en pil. I de ikke lyserede og lyserede celler (- lys og +lys) er der meget protein. De fleste af disse proteiner binder ikke til Ni- NTA beadsene (- Ni), og kan vaskes væk (V1 og VS). Derfor er der langt færre proteiner i eluenten fra Ni- NTA beadsene (E). I dialysen og refoldningen af IFN- λ3_k49r (+D) har jeg fortyndet prøven kraftigt og derfor ses kun meget svage bånd. Efter refoldningen af proteinet, har jeg oprenset proteinet på en HiTrap SP FF 5 ml kationbytter søjle, da IFN- λ3_his har en pi på 8,4 vil det have en positiv ladning ved den neutral ph i ionbytter buffer 1A og derfor binde til søjlen. Chromatogrammet for ionbytter søjlen ses på fig. 5. IFN- λ3_k49r elueres ved 45 ms/cm i toppen fra 12,5 ml til 18 ml. De kraftige toppe før dette, skyldes kontaminanter der skyldes væk før IFN- λ3_k49r elueres fra søjlen. 18

19 Efter ionbytter søjlen, blev prøven opkoncentreret og kørt på en HiLoad 16/60 Superdex 75 gelfiltrerings søjle. Chromatogrammet for gelfiltereings søjlen ses på fig. 6, her ses en lille top i begyndelsen af chromatogrammet, det skyldes at søjlen ikke er vasket grundigt nok inden jeg kørte programmet. Toppene fra 45 ml til 75 ml er IFN- λ3_k49r, af dem har jeg dog kun opsamlet fraktionerne D13- D5. Der er to Toppe fra 45 ml til 75 ml, fordi IFN- λ3 findes i en dynamisk ligevægt mellem en monomer og en dimer (8). Jeg har kørt to geler af toppene (fig. 7 og 8), og her ses det, at de to toppe indeholder det samme protein. På gelerne ses der to tydelige bånd i hver bane og tre bånd i bane 5-8 på fig. 8, dette skyldes at his taget afkløves, uden at jeg har tilsat Tev protease, min prøve indeholder altså IFN- λ3_k49r med og uden his tag. IFN- λ3_k49r er nu færdigt oprenset (fig. 4 HiLoad), og det ses, at der som på fig. 7 og 8 er to bånd, dette skyldes som sagt at his taget afkløves under oprensningen. Proteinet er nu fuldt oprenset, der ses et bånd ved ca. 40 kda, dette er en kontaminant jeg ikke adressere yderligere. 19

20 KS HiTrap SP FF 5 ml k70r 10 maj001:10_uv1_280nm KS HiTrap SP FF 5 ml k70r 10 maj001:10_cond KS HiTrap SP FF 5 ml k70r 10 maj001:10_conc KS HiTrap SP FF 5 ml k70r 10 maj001:10_fractions mau F2 A3 A5 A7 A9 A11 A13 A15 B14 B12 B10 B8 B6 B4 B2 C1 C3 C5 C7 C9 C11 C13 C15 D14 D12 D10 D8 D6 D4 D2 E1 E3 E5 E7 E9 E11 E13 E ml Figur 5 Chromatogram over elueringen fra ionbytter søjlen af IFN- λ3_k49r. Den blå graf markerer absorbansen ved 280 nm, det viser direkte hvornår proteiner elueres. Den grønne graf viser koncentrationen af salt, og dermed salt gradienten. Den brune graf viser konduktiviteten efter søjlen, og dermed hvornår saltet kommer ud af søjlen. X aksen viser hvor mange ml der er løbet igennem søjlen og de fraktion numre der passer til, Y aksen viser absorbansen ved 280 nm i mau. Toppene i begyndelsen af chromatogramet skyldes kontaminanter der skyldes væk før IFN- λ3_k49r elueres fra søjlen. 20

21 HiLoad 1660 Superdex K70R 10 maj001:10_uv1_280nm HiLoad 1660 Superdex K70R 10 maj001:10_conc HiLoad 1660 Superdex K70R 10 maj001:10_fractions mau F2 A2 A4 A6 A8 A10 A13 B15 B12 B9 B7 B5 B3 B1 C2 C4 C6 C8 C10 C13 D15 D12 D9 D7 D5 D3 D1 E2 E4 E6 E8 E10 E13 F15F13F11 F9 F7 F5 F3 F1 G2 G ml Figur 6 Chromatogram over elueringen fra gelfiltreringen af IFN- λ3_k49r. Den blå graf markerer absorbansen ved 280 nm, det viser direkte hvornår proteiner elueres. Den grønne graf viser salt koncentrationen, her er ingen ændring da søjlen kun elueres med PBS. X aksen viser hvor mange ml der er løbet igennem søjlen og de fraktion numre der passer til, Y aksen viser absorbansen ved 280 nm i mau. Toppen i begyndelsen af chromatogramet er der fordi jeg ikke har fået vasket søjlen grundigt nok inden jeg kørte programmet. 21

22 D14 D12 D10 T D9 D8 D7 D6 D5 LMW Figur 7 Fraktionerne D14- D5 af min gelfiltrering af mutanten IFN- λ3_k49r. D14: fraktion D14, D12: fraktion D12, D10: fraktion D10, T: overflow fra bane 3, men ellers tom, D9: fraktion D9, D8: fraktion D8, D7: fraktion D7, D6: fraktion D6, D5: fraktion D5, LMW: LMW markør. D4 D2 D3 E1 E3 E5 E7 E9 LMW Figur 8 Fraktionerne D4- E9 fra min gelfiltrering af mutanten IFN- λ3_k49r. D4: fraktion D4, D2: fraktion D2, D3: fraktion D3, E1: fraktion E1, E3: fraktion E3, E5: fraktion E5, E7: fraktion E7, E9: fraktion E9, LMW: LMW markør. 22

23 Tabel 5 Koncentration, volumen og mængde af protein under oprensningen af IFN- λ3_k49r fra 4 L bakterie medie. Oprensnings trin koncentrationer af IFN- λ3_k49r (mg/ml) Volumen prøve (ml) Mængde af protein (mg) Udbytte (%) Eluent fra Ni- NTA søjlen 1, ,5 100 Efter dialyse og refoldning af 0, ,3 109 proteinet Eluenten fra ionbytter søjlen 4, ,5 30,5 Den opkoncentrerede eluent 8, ,8 21,3 fra ionbytter søjlen Eluenten fra gelfiltreringssøjlen 0,49 9 4,4 5,3 Som det ses på fig. 4 tabes der IFN- λ3_k49r for hvert trin i oprensningen. I tabel 5 ses protein koncentrationer af min prøve undervejs i oprensningen. De målte koncentrationer er ganget med 1,48, absorptions koefficienten for IFN- λ3_his, udregnet fra CLC main workbench 5. Denne konstant er specifik for IFN- λ3_his, og ikke for konterminanterne. Jeg har i denne udregning, ikke taget højde for renheden af proteinet. Koncentrationen af protein i eluenten fra Ni- NTA søjlen er upålidelig, da eluation bufferen indeholder imidazole, og det absorberer UV lys ved samme bølgelængde som de aromatiske aminosyrer; derfor ses en stigning i mængden af protein efter dialysen og refoldningen. Jeg taber protein over ionbytter søjlen, fordi urenheder som f.eks. neutralt og negativt ladede ioner, der ikke binder til søjlen vaskes væk. Derudover dækker dette tab også over tabet i dialysen og refoldningen. Under dialysen diffunderer mindre proteiner ud af dialyse posen, og under refoldningen udfældes noget af proteinet, fordi det ikke foldes korrekt. Tabet af protein under opkoncentreringen skyldes, at jeg ikke har fået genopløst alt IFN- λ3_k49r fra filteret efter opkoncentreringen, og at noget af proteinet bundfældes. Tabet af protein på gelfiltreringssøjlen skyldes, at jeg ikke har opsamlet alle de fraktioner der indeholdte IFN- λ3_k49r, for at sikre en tilfredstillende koncentration. Eluenten fra gelfiltreringssøjlen, er fortyndet med glycerol, og den nye koncentration kan ses i tabel 6, sammen med koncentrationerne af de andre proteiner jeg har oprenset. Alle proteinerne i tabel 6, på nær IFN- λ3_d89a, har været igennem hele oprensningen. På grund af den lave koncentration af IFN- λ3_d89a og forventningen om et tab under gelfiltreringssøjlen (tabel 5), valgte jeg at stoppe opkoncentreringen efter ionbytter søjlen. Men som det fremgår 23

Protokol for genetisk bestemmelse af ABO blodtyper

Protokol for genetisk bestemmelse af ABO blodtyper Page1 Udarbejdet i samarbejde mellem: Kåre Lehmann, Annabeth Høgh Petersen, Anne Rusborg Nygaard og Jørn M. Clausen Page2 VIGTIGT: SKIFT PIPETTE SPIDSER/TIPS EFTER HVER GANG!! Så undgår du at forurene

Læs mere

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et:

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: F2011-Opgave 1. En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: Forward primer: 5 CC ATG GGT ATG AAG CTT TGC AGC CTT

Læs mere

DNA origami øvelse 2013. DNA origami øvelse

DNA origami øvelse 2013. DNA origami øvelse DNA origami øvelse Introduktion I denne øvelse bruger vi DNA origami teknikken til at samle en tavle af DNA med dimensioner på 70 nm x 100 nm. Tavlen dannes af et langt enkeltstrenget DNA molekyle, der

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Forsøgsvejledning Navn: Side 1 af 7 Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA

Læs mere

DNA origami øvelse DNA origami øvelse

DNA origami øvelse DNA origami øvelse DNA origami øvelse Introduktion I denne øvelse bruger vi DNA origami teknikken til at samle en tavle af DNA med dimensioner på 70 nm x 100 nm. Tavlen dannes af et langt enkeltstrenget DNA molekyle, der

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Navn: Forsøgsvejledning Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA sekvens,

Læs mere

Studienummer: MeDIS Exam 2015. Husk at opgive studienummer ikke navn og cpr.nr. på alle ark, der skal medtages i bedømmelsen

Studienummer: MeDIS Exam 2015. Husk at opgive studienummer ikke navn og cpr.nr. på alle ark, der skal medtages i bedømmelsen MeDIS Exam 2015 Titel på kursus: Uddannelse: Semester: Videregående biokemi og medicinudvikling Bachelor i Medis 5. semester Eksamensdato: 26-01-2015 Tid: kl. 09.00-11.00 Bedømmelsesform 7-trin Vigtige

Læs mere

BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER

BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER FAGLIG BAGGRUND Det forudsættes, at den grundlæggende teori bag rekombinant protein ekspression og proteinopresning er bekendt. For dette henvises til undervisningsmateriale

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

PCR (Polymerase Chain Reaction): Opkopiering af DNA

PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR til at opkopiere bestemte DNA-sekvenser i en prøve er nu en af genteknologiens absolut vigtigste værktøjer. Peter Rugbjerg, Biotech Academy PCR (Polymerase

Læs mere

Regnskovens hemmeligheder

Regnskovens hemmeligheder Center for Undervisningsmidler, afdeling København Regnskovens hemmeligheder Øvelsesvejledning Formål Et gen for et kræfthelbredende protein er blevet fundet i nogle mystiske blade i regnskoven. Forskere

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Oprensning af genomisk DNA fra plantemateriale Manual Katalog nr. 166-5005EDU explorer.bio-rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, februar 2009

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

GAPDH PCR modul Manual

GAPDH PCR modul Manual GAPDH PCR modul Manual Katalog nr. 166-5010EDU explorer.bio-rad.com Kopiering kun tilladt til undervisningsbrug Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende

Læs mere

Protokol for genetisk bestemmelse af ABO blodtyper

Protokol for genetisk bestemmelse af ABO blodtyper Page1 Udarbejdet i samarbejde mellem: Kåre Lehmann, Annabeth Høgh Petersen, Anne Rusborg Nygaard og Jørn M. Clausen Page2 VIGTIGT: SKIFT PIPETTE SPIDSER/TIPS EFTER HVER GANG!! Så undgår du at forurene

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

Det innate virusforsvar. TLR7, TLR8, TLR9, MDA5, RIG I og type I interferoner

Det innate virusforsvar. TLR7, TLR8, TLR9, MDA5, RIG I og type I interferoner Det innate virusforsvar. TLR7, TLR8, TLR9, MDA5, RIG I og type I interferoner A kursus i teoretisk og immunologi TLR3 og LGP 2 Odense, 13. april 2015 Søren T. Lillevang Klinisk Immunologisk Afdeling Odense

Læs mere

Dette er en kladde til et genoptryk af Eksperimentel Genteknologi fra 1991. Ideer, rettelser og forslag modtages gerne. Kh Claudia.

Dette er en kladde til et genoptryk af Eksperimentel Genteknologi fra 1991. Ideer, rettelser og forslag modtages gerne. Kh Claudia. Transformation af E.coli K 12 Version 3. marts 2009 (C) Claudia Girnth-Diamba og Bjørn Fahnøe Dette er en kladde til et genoptryk af Eksperimentel Genteknologi fra 1991. Ideer, rettelser og forslag modtages

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Green Fluorescent Protein (GFP) Oprensnignskit Katalognummer 166-0005-EDU www.bio-rad.com For teknisk service bedes du ringe til dit lokale Bio-Rad kontor Office or in the U.S. Call

Læs mere

Spm. 1.: Hvis den totale koncentration af monomer betegnes med CT hvad er så sammenhængen mellem CT, [D] og [M]?

Spm. 1.: Hvis den totale koncentration af monomer betegnes med CT hvad er så sammenhængen mellem CT, [D] og [M]? DNA-smeltetemperaturbestemmelse KemiF2-2008 DNA-smeltetemperaturbestemmelse Introduktion Oligonucleotider er ofte benyttet til at holde nanopartikler sammen med hinanden. Den ene enkeltstreng er kovalent

Læs mere

Kapitel 1 Genteknologi (1/6)

Kapitel 1 Genteknologi (1/6) Kapitel 1 Genteknologi (1/6) Transformation FOTO: SØREN LUNDBERG FORMÅL At isolere plasmider fra plasmidbærende bakterier og overføre dem til andre bakterier. TEORI Transformation er den teknik, hvor generne

Læs mere

Analyse af proteiner Øvelsesvejledning

Analyse af proteiner Øvelsesvejledning Center for Undervisningsmidler, afdeling København Analyse af proteiner Øvelsesvejledning Formål At separere og analysere proteiner i almindelige fødevarer ved brug af gelelektroforese. Teori Alle dele

Læs mere

Green Fluorescent Protein (GFP) Oprensning af GFP

Green Fluorescent Protein (GFP) Oprensning af GFP 1 Green Fluorescent Protein (GFP) Oprensning af GFP Katalognummer 166-0005EDU www.biorad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium Revideret februar 2010. Kontakt: Birgitjustesen@gmail.com

Læs mere

Laboratorieprotokol for manuel isolering af DNA fra 0,5 ml prøve

Laboratorieprotokol for manuel isolering af DNA fra 0,5 ml prøve Laboratorieprotokol for manuel isolering af DNA fra 0,5 ml prøve Til isolering af genomisk DNA fra indsamlingssætserierne Oragene - og ORAcollect. Du kan finde flere sprog og protokoller på vores webside

Læs mere

Biotechnology Explorer. Regnskovens hemmelighed

Biotechnology Explorer. Regnskovens hemmelighed Biotechnology Explorer Regnskovens hemmelighed Katalognummer 166-0006-EDU explorer.bio-rad.com For teknisk service bedes du ringe til dit lokale Bio-Rad kontor Office or in the U.S. Call 1-800-4BIORAD

Læs mere

BIOTEKNOLOGI HØJT NIVEAU

BIOTEKNOLOGI HØJT NIVEAU STUDENTEREKSAMEN 2007 2007-BT-1 BITEKNLGI HØJT NIVEAU Torsdag den 31. maj 2007 kl. 9.00 14.00 Sættet består af 1 stor og 2 små opgaver samt 1 bilag i 2 eksemplarer. Det ene eksemplar af bilaget afleveres

Læs mere

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm)

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm) Opgave 1 Leveren spiller en central rolle i lipid metabolismen og i opretholdelse af lipid homeostasen i hele kroppen. Lipidmetabolismen er fejlreguleret hos blandt andet svært overvægtige personer samt

Læs mere

Øvelse med tarmkræftceller i kultur.

Øvelse med tarmkræftceller i kultur. Øvelse med tarmkræftceller i kultur. Baggrund Hver 3. dansker bliver ramt af kræft, inden de er blevet 75 år. Tyktarmskræft er den 3. hyppigste kræftform hos både mænd og kvinder, hvor henholdsvis 7.3

Læs mere

Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP

Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP August 2015 QIAsymphony SPprotokolark Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP Dette dokument er Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP QIAsymphony SPprotokolark, R2, til kitversion 1. QIAsymphony

Læs mere

Find enzymer til miljøvenligt vaskepulver

Find enzymer til miljøvenligt vaskepulver Find enzymer til miljøvenligt vaskepulver Enzymer, der er aktive under kolde forhold, har adskillige bioteknologiske anvendelsesmuligheder. Nye smarte og bæredygtige produkter kan nemlig blive udviklet

Læs mere

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares.

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. Bioteknologi A Studentereksamen Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. frs111-btk/a-31052011 Tirsdag den 31. maj 2011 kl. 9.00-14.00

Læs mere

Eksamen i. Cellebiologi (kandidatdelen): Cellebiologi - Cellers struktur og funktion - Membranbiokemi - Cellulær signaltransduktion

Eksamen i. Cellebiologi (kandidatdelen): Cellebiologi - Cellers struktur og funktion - Membranbiokemi - Cellulær signaltransduktion Eksamen i Cellebiologi (kandidatdelen): Cellebiologi - Cellers struktur og funktion - Membranbiokemi - Cellulær signaltransduktion Opgavesættet består af 5 sider inklusive denne forside. Sættet består

Læs mere

Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid)

Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid) Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid) (Denne del tager ca. 3 timer, max 14 prøver) ELEVVEJLEDNING forsøgskasse nr. 1 AAU Oprensning af DNA-prøven foregår gennem fem trin, se figur 1:

Læs mere

1. Lactase tilhører enzymklassen hydrolase

1. Lactase tilhører enzymklassen hydrolase Arvelig immundefekt a. Immundefekt skyldes en arvelig gendefekt eller mutation i generne. Det kan ramme begge køn, som et slags usynligt handicap, og kan, hvis det ikke bliver behandlet, være dødeligt.

Læs mere

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side 1 af 14 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

STUDERENDES ØVELSESARK TIL EKSPERIMENT A: NATURLIGE NANOMATERIALER

STUDERENDES ØVELSESARK TIL EKSPERIMENT A: NATURLIGE NANOMATERIALER STUDERENDES ØVELSESARK TIL EKSPERIMENT A: NATURLIGE NANOMATERIALER Navn: Dato:.. MÅL: - Lær om eksistensen af naturlige nanomaterialer - Lysets interaktion med kolloider - Gelatine og mælk som eksempler

Læs mere

Elevvejledning pglo transformation

Elevvejledning pglo transformation Introduktion til transformation Elevvejledning pglo transformation I denne øvelse skal du lære fremgangsmåden ved genetisk transformation. Husk på, at et gen er et stykke DNA, der indeholder informationer

Læs mere

Syv transmembrane receptorer

Syv transmembrane receptorer Syv transmembrane receptorer Receptoren som kommunikationscentral Cellemembranen definerer grænsen mellem en celles indre og ydre miljø, der er meget forskelligt. Det er essentielt for cellens funktion

Læs mere

Det sure, det salte, det basiske Ny Prisma Fysik og kemi 9 - kapitel 1 Skole: Navn: Klasse:

Det sure, det salte, det basiske Ny Prisma Fysik og kemi 9 - kapitel 1 Skole: Navn: Klasse: Det sure, det salte, det basiske Ny Prisma Fysik og kemi 9 - kapitel 1 Skole: Navn: Klasse: Opgave 1 Den kemiske formel for køkkensalt er NaCl. Her er en række udsagn om køkkensalt. Sæt kryds ved sandt

Læs mere

datp, dctp, dgtp, dttp, [α 32 P]-dCTP urinstofholdig polyacrylamid gel røntgen film

datp, dctp, dgtp, dttp, [α 32 P]-dCTP urinstofholdig polyacrylamid gel røntgen film Opgave 1 Denne opgave omhandler osteoblast differentiering. Osteoblast celler er involveret i opbygning af knoglevæv. Osteoblast celler dannes ud fra såkaldte calvarial celler. For at forstå det molekylære

Læs mere

Materialeliste: Ready-to-loadTM DNA prøver til elektroforese. Medfølgende reagenser og tilbehør. Egne materialer

Materialeliste: Ready-to-loadTM DNA prøver til elektroforese. Medfølgende reagenser og tilbehør. Egne materialer Elevvejledning 1 Materialeliste: Ready-to-loadTM DNA prøver til elektroforese A B C D E F Plasmid DNA (uskåret) Plasmid skåret med Bgl I Plasmid skåret med Eco RI Lambda DNA (uskåret) Lambda DNA skåret

Læs mere

pglo-transformationskit

pglo-transformationskit Katalog nummer 166-0003-EDU pglo-transformationskit arac ori pglo bla GFP Oversat og bearbejdet af Birgit Sandermann Justesen og Lars Moeslund, 2004 Brugen af dette kit til undervisningsbrug skal varetages

Læs mere

Jernindhold i fødevarer bestemt ved spektrofotometri

Jernindhold i fødevarer bestemt ved spektrofotometri Bioteknologi 4, Tema 8 Forsøg www.nucleus.dk Linkadresserne fungerer pr. 1.7.2011. Forlaget tager forbehold for evt. ændringer i adresserne. Jernindhold i fødevarer bestemt ved spektrofotometri Formål

Læs mere

Isolering af DNA fra løg

Isolering af DNA fra løg Isolering af DNA fra løg Formål: At afprøve en metode til isolering af DNA fra et levende væv. At anvende enzymer.. Indledning: Isolering af DNA fra celler er første trin i mange molekylærbiologiske undersøgelser.

Læs mere

[BESØGSSERVICE INSTITUT FOR MOLEKYLÆRBIOLOGI OG GENETIK, AU]

[BESØGSSERVICE INSTITUT FOR MOLEKYLÆRBIOLOGI OG GENETIK, AU] Enzymkinetik INTRODUKTION Enzymer er biologiske katalysatorer i alle levende organismer som er essentielle for liv. Selektivt og effektivt katalyserer enzymerne kemiske reaktioner som ellers ikke ville

Læs mere

DNA smeltepunktsbestemmelse

DNA smeltepunktsbestemmelse DNA smeltepunktsbestemmelse Troels Linnet Christine Hartmann Mads Topp 29. november 2006 Resumé DNA smeltepunktet bestemmes teoretisk og praktisk til sammenligning. Ved opvarmning forventes et højere smeltepunkt

Læs mere

VINTERTILBUD TILBUDDENE GÆLDER HELT FREM TIL 15.02.16

VINTERTILBUD TILBUDDENE GÆLDER HELT FREM TIL 15.02.16 VINTERTILBUD TILBUDDENE GÆLDER HELT FREM TIL 15.02.16 LABORATORIEUDSTYR Binder BD inkubatorer Elektronisk controller APT.line Temperatur område stuetemp. +5⁰C op til 100⁰C Indvendig glasdør Binder BD 53

Læs mere

Optimering af faseadskillelse og CIP processer SEMINAR TI-11

Optimering af faseadskillelse og CIP processer SEMINAR TI-11 Optimering af faseadskillelse og CIP processer SEMINAR TI-11 Agenda Hvad er CIP? CIP faser CIP anlæggets funktion Hvad vil man opnå? Hvad sker der mellem faserne? Faseadskillelse / koncentration med in-line

Læs mere

Hvilket af efterfølgende udsagn er forkert? a) Golgi-proteiner syntetiseres i ER b) mitochondriale proteiner syntetiseres i cytosol c)

Hvilket af efterfølgende udsagn er forkert? a) Golgi-proteiner syntetiseres i ER b) mitochondriale proteiner syntetiseres i cytosol c) Test 3 Hvilket af efterfølgende udsagn er forkert? a) Golgi-proteiner syntetiseres i ER b) mitochondriale proteiner syntetiseres i cytosol c) plasmamembran-proteiner syntetiseres i cytosol d) lysosomale

Læs mere

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Formål: at undersøge udviklingen i mængden af tilsatte patogene bakterier til hønsegødning.

Læs mere

Formål At analysere for myosin i muskelvæv fra fisk ved brug af western blotting

Formål At analysere for myosin i muskelvæv fra fisk ved brug af western blotting Center for Undervisningsmidler, afdeling København Western blotting Øvelsesvejledning Formål At analysere for myosin i muskelvæv fra fisk ved brug af western blotting Teori Proteomik er studiet af celleproteiners

Læs mere

Androstenon-indol-skatol-protokol.

Androstenon-indol-skatol-protokol. Androstenon-indol-skatol-protokol. Indholdsfortegnelse: 1. Formål side 2 2. Teori side 2 2. Prøvebehandling side 2 3. Materialer side 2 3.1 Apparatur side 2 3.2 Kemikalier side 3 3.3 Reagenser side 3 4.

Læs mere

FORSØG ØL verdens første svar på anvendt

FORSØG ØL verdens første svar på anvendt FORSØG ØL verdens første svar på anvendt bioteknologi Biotech Academy BioCentrum-DTU Søltofts Plads DTU - Bygning 221 2800 Kgs. Lyngby www.biotechacademy.dk bioteket@biocentrum.dtu.dk INDHOLDSFORTEGNELSE

Læs mere

Dødelighed i ét tal giver det mening?

Dødelighed i ét tal giver det mening? Dødelighed i ét tal giver det mening? Jacob Anhøj Diagnostisk Center, Rigshospitalet 2014 Hospitalsstandardiseret mortalitetsrate, HSMR Definition HSMR = antal d/odsfald forventet antal d/odsfald 100 Antal

Læs mere

Faktor V Leiden mutation

Faktor V Leiden mutation Faktor V Leiden mutation Formål: finde ud af om individ har mutation i faktor V Leiden gen (missense: arginin glutamin) Materiale: oprens DNA fra leukocytter Metode: PCR med specifikke primere, oprens,

Læs mere

ELISA Immuno Explorer TM Kit

ELISA Immuno Explorer TM Kit - 1 - ELISA Immuno Explorer TM Kit Katalog nummer 166-2400EDU Til læreren Dette kit er lavet for at lette og illustrere immunologiundervisningen og kan give en øget forståelse af antigen-antistof interaktionen,

Læs mere

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse www.volvoxdk.dk C. Girnth-Diamba og B. Fahnøe, 2010 Claudia Girnth-Diamba og Bjørn Fahnøe Solrød Gymnasium, Solrød Center 2 DK 2680 Solrød Strand, Denmark E: sgcg@solgym.dk og sgbf@solgym.dk Plasmidoprensning

Læs mere

DNA-smykke Simpel ekstraktion af DNA fra kindceller fra mennesket, som er velegnet til at bruge i et halssmykke

DNA-smykke Simpel ekstraktion af DNA fra kindceller fra mennesket, som er velegnet til at bruge i et halssmykke 145678 John Schollar and Dean Madden National Centre for Biotechnology Education, University of Reading Science and Technology Centre, Earley Gate, Reading RG6 6BZ UK E: J.W.Schollar@reading.ac.uk Simpel

Læs mere

Godkendelse produktionslokale genetisk modificerede Escherichia coli

Godkendelse produktionslokale genetisk modificerede Escherichia coli Immunitrack ApS Københavns Biocenter Ole Maaløes Vej 5 2200 København N Pesticider og Genteknologi J.nr. MST-6840-00021 Ref. johpe Den 04. august 2015 Godkendelse af produktionslokale og genetisk modificerede

Læs mere

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler DNA-profil analyse Indledning DNA-profil analyser eller i daglig tale DNA-fingeraftryk er en metode, der bruges, når man skal finde ud af, hvem der er far et barn, hvis der altså er flere muligheder. Det

Læs mere

Besvarelse til opgave 1 januar 1999 Spm. A: Spm. B:

Besvarelse til opgave 1 januar 1999 Spm. A: Spm. B: Besvarelse til opgave 1 januar 1999 Spm. A: Vi må lave et genomisk bibliotek i en lambdafag, cosmid, BAC eller YAC plasmid. Til dette vil vi skære det genomiske DNA partielt med Sau3A, så vi får stykker

Læs mere

Viden SIDE 1. Grundskole. Viden om appelsiner. Et kig indenfor

Viden SIDE 1. Grundskole. Viden om appelsiner. Et kig indenfor om appelsiner Et kig indenfor Rent basalt så består en appelsin af juice vesikler 1 som er omringet af en voksagtig hud, nemlig skrællen. Skrællen omfatter et tyndt og farvet yderlag som kaldes flavedoen,

Læs mere

Mælkesyrebakterier og holdbarhed

Mælkesyrebakterier og holdbarhed Mælkesyrebakterier og holdbarhed Formål Formålet med denne øvelse er at undersøge mælkesyrebakteriers og probiotikas evne til at øge holdbarheden af kød ved at: 1. Undersøge forskellen på bakterieantal

Læs mere

Projekt Vandløb 1p uge 43 og 44, 2012. Projekt Vandløb

Projekt Vandløb 1p uge 43 og 44, 2012. Projekt Vandløb Projekt Vandløb Denne projektopgave markerer afslutningen på det fællesfaglige emne Vand. I skal enten individuelt eller i mindre grupper (max fire personer pr gruppe) skrive en rapport, som sammenfatter

Læs mere

Analyse af benzoxazinoider i brød

Analyse af benzoxazinoider i brød Analyse af benzoxazinoider i brød Øvelsesvejledning til kemi-delen af øvelsen. Af Stine Krogh Steffensen, Institut for Agroøkologi, AU Eleven har forberedt før øvelsen: 1. Eleven har udfyldt skemaet herunder

Læs mere

Biotechnology Explorer ELISA Immuno Explorer Kit. Instruktionsmanual

Biotechnology Explorer ELISA Immuno Explorer Kit. Instruktionsmanual Biotechnology Explorer ELISA Immuno Explorer Kit Instruktionsmanual Katalognummer 166-2400EDU explorer.bio-rad.com Delene i dette kit er sendt i separate æsker. Opbevar posen med reagenser i køleskab indefor

Læs mere

B i o k e m i ø v e l s e 1 Regulatoriske mekanismer i det intermediære stoftskifte Udarbejdet af: Matilda Lantz og Elif Bayram

B i o k e m i ø v e l s e 1 Regulatoriske mekanismer i det intermediære stoftskifte Udarbejdet af: Matilda Lantz og Elif Bayram Regulatoriske mekanismer i det intermediære stoftskifte Udarbejdet af: Matilda Lantz og Elif Bayram Dato: 20. November 2011 Underskrifter: Godkendt: Dato Regulatoriske mekanismer i det intermediære stofskifte

Læs mere

Test Canvas: Eksamen i BMB502 Januar 2012

Test Canvas: Eksamen i BMB502 Januar 2012 BMB502, Enzymer og membraner, efterår 11. f Tests, Surveys and Pools Tests Test Canvas : Eksamen i BMB502 Januar 2012 Edit Mode is: Test Canvas: Eksamen i BMB502 Januar 2012 Create Reuse Upload s Settings

Læs mere

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve Vejledende opgavesæt 1 Bioteknologi A Gymnasiale uddannelser 5 timers skriftlig prøve Vejledende opgavesæt 1 Mandag den 31. maj 2010 kl. 9.40-14.40 Side 1 af 8 sider pgave 1. Genmodificeret ris Vitamin

Læs mere

Ligerings- og transformationsmodul inklusiv plasmidoprensning og restriktionsanalyse

Ligerings- og transformationsmodul inklusiv plasmidoprensning og restriktionsanalyse Biotechnology Explorer Ligerings- og transformationsmodul inklusiv plasmidoprensning og restriktionsanalyse Katalog nr. 166-5015EDU explorer.bio-rad.com Kopiering kun tilladt til undervisningsbrug Bemærk:

Læs mere

KRIMINALDETEKTIVEN GERNINGSSTEDETS GÅDE PCR

KRIMINALDETEKTIVEN GERNINGSSTEDETS GÅDE PCR KRIMINALDETEKTIVEN GERNINGSSTEDETS GÅDE Elevvejledning PCR PCR trin for trin PCR involverer en række gentagne cykler, der hver består af følgende tre trin: Denaturering, primer påsætning og forlængelse

Læs mere

Sommereksamen 2012 Med korte, vejledende svar

Sommereksamen 2012 Med korte, vejledende svar 1 Sommereksamen 2012 Med korte, vejledende svar Titel på kursus: Uddannelse: Semester: ksamensdato: Tid: Bedømmelsesform Det hæmatologiske system og immunsystemet Bacheloruddannelsen i Medicin/Medicin

Læs mere

Mælkesyrebakterier og holdbarhed

Mælkesyrebakterier og holdbarhed Mælkesyrebakterier og holdbarhed Navn: Forsøgsvejledning Mælkesyrebakterier og holdbarhed Formål med forsøget Formålet med denne øvelse er at undersøge mælkesyrebakteriers og probiotikas evne til at øge

Læs mere

Undersøgelse af forskellige probiotiske stammer

Undersøgelse af forskellige probiotiske stammer Undersøgelse af forskellige probiotiske stammer Formål Formålet med denne øvelse er: 1. At undersøge om varer med probiotika indeholder et tilstrækkeligt antal probiotiske bakterier, dvs. om antallet svarer

Læs mere

ELISA metoden, til bestemmelse af den genetiske profil i høns.

ELISA metoden, til bestemmelse af den genetiske profil i høns. ELISA metoden, til bestemmelse af den genetiske profil i høns. 1 Formål: Formålet med denne øvelse er at demonstrere brugen af antistoffer i diagnostisk eller forskningsøjemed. Dvs. til at undersøge om

Læs mere

Bilag til Kvantitativ bestemmelse af glucose

Bilag til Kvantitativ bestemmelse af glucose Bilag til Kvantitativ bestemmelse af glucose Det synlige formål med øvelsen er at lære, hvorledes man helt præcist kan bestemme små mængder af glucose i en vandig opløsning ved hjælp af målepipetter, spektrofotometer

Læs mere

Som substrat i forsøgene anvender vi para nitrophenylfosfat, der vha. enzymet omdannes til paranitrofenol

Som substrat i forsøgene anvender vi para nitrophenylfosfat, der vha. enzymet omdannes til paranitrofenol Enzymkinetik Introduktion I disse forsøg skal I arbejde med enzymet alkalisk fosfatase. Fosfataser er meget almindelige i levende organismer og er enzymer med relativt bred substrat specificitet. De katalyserer

Læs mere

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det.

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Samarbejde mellem gymnasier og Aarhus Universitet Bioteknologiske eksperimenter Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Denne øvelse er baseret på øvelseskittet:

Læs mere

Kemiøvelse 2 1. Puffere

Kemiøvelse 2 1. Puffere Kemiøvelse 2 1 Puffere Øvelsens pædagogiske rammer Sammenhæng Denne øvelse er tilpasset kemiundervisningen på modul 3 ved bioanalytikeruddannelsen. Kemiundervisningen i dette modul indeholder blandt andet

Læs mere

Udfordringen. Nikotin i kroppen hvad sker der?

Udfordringen. Nikotin i kroppen hvad sker der? Gå op i røg For eller imod tobak? Udfordringen Denne udfordring handler om nikotin og beskriver nikotinens kemi og den biologiske påvirkning af vores nerveceller og hjerne. Du får et uddybende svar på,

Læs mere

Produktion af biodiesel fra rapsolie ved en enzymatisk reaktion

Produktion af biodiesel fra rapsolie ved en enzymatisk reaktion Produktion af biodiesel fra rapsolie ved en enzymatisk reaktion produceres fra rapsolie som består af 95% triglycerider (TG), samt diglycerider (DG), monoglycerider (MG) og frie fedtsyrer (FA). Under reaktionen

Læs mere

Konjugering af Alexa Fluor 488 til Insulin

Konjugering af Alexa Fluor 488 til Insulin Konjugering af Alexa Fluor 488 til Insulin Modul 2 Projekt i Kemi Institut for Natur, Systemer og Modeller Roskilde Universitetscenter Juni 2007 Skrevet af: Simon Hockenhull Vejleder: Søren Hvidt Abstract

Læs mere

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

BIOZYMER ØVELSE 3 BEKÆMP DIN β-lactamase - TEST DIN EGEN MEDICIN!

BIOZYMER ØVELSE 3 BEKÆMP DIN β-lactamase - TEST DIN EGEN MEDICIN! BIZYMER ØVELSE 3 BEKÆMP DIN β-lactamase - TEST DIN EGEN MEDICIN! FAGLIG BAGGRUND For at få det maksimale udbytte af denne øvelse er det en forudsætning, at teorien bag enzymer, enzymkinetik og resistensmekanismer

Læs mere

Alfa-1-antitrysin mangel hos børn. Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH

Alfa-1-antitrysin mangel hos børn. Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH Alfa-1-antitrysin mangel hos børn Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH Hvad er det? Alfa-1-antitrypsin Proteinstof Produceres i leveren Fungerer i lungerne Regulerer neutrofil elastase balancen

Læs mere

Salte, Syre og Baser

Salte, Syre og Baser Salte, Syre og Baser Fysik/Kemi Rapport 4/10 2011 MO Af Lukas Rønnow Klarlund 9.y Indholdsfortegnelse: Formål s. 2 Salte og Ioner s. 3 Syrer og Baser s. 5 phværdi s. 5 Neutralisation s. 6 Kunklusion s.

Læs mere

Biotechnology Explorer. Protein Fingerprinting

Biotechnology Explorer. Protein Fingerprinting Biotechnology Explorer Protein Fingerprinting Instruktionsmanual Katalognummer 166-0100EDU explorer.bio-rad.com Delene i dette kit er sendt i seperate æsker. Opbevar proteinstandarderne i fryseren, ved

Læs mere

Brugsvejledning for 7827.10 dialyseslange

Brugsvejledning for 7827.10 dialyseslange Brugsvejledning for 7827.10 dialyseslange 14.06.07 Aa 7827.10 1. Præsentation Dialyseslangen er 10 m lang og skal klippes i passende stykker og blødgøres med vand for at udføre forsøgene med osmose og

Læs mere

BIOTEKNOLOGI HØJT NIVEAU

BIOTEKNOLOGI HØJT NIVEAU STUDETEREKSAME 2006 2006-BT-2 BIOTEKOLOGI HØJT IVEAU Onsdag den 16. august 2006 kl. 9.00 14.00 Sættet består af 1 stor og 2 små opgaver. Alle hjælpemidler tilladt. STOR OPGAVE 1. Myoglobin A. Den røde

Læs mere

Kontrol af anlæg. Lektionens formål: At forstå de forhold, der er vigtige, når det handler om kontrol af CIP-anlæg

Kontrol af anlæg. Lektionens formål: At forstå de forhold, der er vigtige, når det handler om kontrol af CIP-anlæg Kontrol af anlæg Lektionens formål: At forstå de forhold, der er vigtige, når det handler om kontrol af CIP-anlæg Kontrol - Overvågning De 4 faktorer Koncentration Titrering, Konduktivitet Datalogning

Læs mere

Svarark for (navn) Skole: Opgave 22 besvares DIREKTE her i opgaven.

Svarark for (navn) Skole: Opgave 22 besvares DIREKTE her i opgaven. Opgave 22 besvares DIREKTE her i opgaven. 22. Den røde farve i kød skyldes myoglobin som er et globulært protein. Myoglobin indeholder ligesom hæmoglobin en organisk gruppe (hæm) med en tilknyttet jern(ii)-ion

Læs mere

0 Indhold. Titel: Klorofyl a koncentration. Dokumenttype: Teknisk anvisning. Version: 1

0 Indhold. Titel: Klorofyl a koncentration. Dokumenttype: Teknisk anvisning. Version: 1 Titel: Klorofyl a koncentration Dokumenttype: Teknisk anvisning Forfattere: Stiig Markager og Henrik Fossing TA henvisninger TA. nr.: M07 Version: 1 Oprettet: 20.12.2013 Gyldig fra: 20.12.2013 Sider: 10

Læs mere

Atomic force mikroskopi på blodceller

Atomic force mikroskopi på blodceller 1 Atomic force mikroskopi på blodceller Problemstilling: Problemstillingen eleven bliver sat overfor er: Hvad er atomic force mikroskopi, og hvordan kan det bruges til at studere blodceller på nanometerskala?

Læs mere

Measuring the Impact of Bicycle Marketing Messages. Thomas Krag Mobility Advice Trafikdage i Aalborg, 27.08.2013

Measuring the Impact of Bicycle Marketing Messages. Thomas Krag Mobility Advice Trafikdage i Aalborg, 27.08.2013 Measuring the Impact of Bicycle Marketing Messages Thomas Krag Mobility Advice Trafikdage i Aalborg, 27.08.2013 The challenge Compare The pilot pictures The choice The survey technique Only one picture

Læs mere

PRRS - kan vi sanere os ud af problemet lokalt/regionalt?

PRRS - kan vi sanere os ud af problemet lokalt/regionalt? PRRS - kan vi sanere os ud af problemet lokalt/regionalt? PH Rathkjen Sr. Global Teknisk Chef for PRRS, Boehringer Ingelheim De 5 trin til PRRS kontrol 1. Enighed om målet (kontrol eller elimination) 2.

Læs mere

Menneskets væskefaser

Menneskets væskefaser Menneskets væskefaser Mennesket består af ca. 60% væske (vand) Overordnet opdelt i to: Ekstracellulærvæske og intracellulærvæske Ekstracellulærvæske udgør ca. 1/3 Interstitielvæske: Væske der ligger mellem

Læs mere

Kædens længde kan ligger mellem 10 og 14 carbonatomer; det mest almindelige er 12.

Kædens længde kan ligger mellem 10 og 14 carbonatomer; det mest almindelige er 12. Kemi laboratorieforsøg 9.2 Anioniske surfaktanter Anioniske surfaktanter er vaskeaktive stoffer, der har en hydrofob ende og en hydrofil ende. Den hydrofile ende er negativt ladet, dvs. en anion. Da der

Læs mere

Aminosyrer. Ionstyrke. Bufferkapacitet.

Aminosyrer. Ionstyrke. Bufferkapacitet. Aminosyrer. onstyrke. Bufferkapacitet. Biologisk vigtige aminosyrer er af formen H 2 N CH(R) COOH, hvor sidekæden R f. eks. kan indeholde alifatiske grupper som methyl eller ethyl, eller den kan indeholde

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Genes in a Bottle Kit DNA Extraction Module Lav et halssmykke med dit eget DNA Katalognr.: 166-2000EDU Dertil kan man købe ekstradele, hvis der skal laves halskæder til eleverne.

Læs mere