Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse

Størrelse: px
Starte visningen fra side:

Download "Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse"


1 Danish Consortium for Neuromuscular Diseases Genomsekventering klinisk anvendelse Odense, 2. september, 2013 Jens Michael Hertz, MD, DMSc Professor, consultant Phone: (dir.), or (mob.) Department of Clinical Genetics Odense University Hospital Sdr. Boulevard 29 DK-5000 Odense C, Denmark

2 NGS presents a paradigm shift for medicine, and the main change will be in the approach to diagnosis, and a more tailored (personal) medical care based on individual risk From low-throughput and expensive molecular tests to high-throughput and in-expensive From a pre-test differential diagnosis generation mode to a post-test diagnostic assessment mode Jens Michael Hertz 2

3 Molekylærgenetisk diagnostik I alt gener Man kender den genetiske baggrund for ca arvelige sygdomme Jens Michael Hertz 3

4 Sekventeringsteknologier Sanger sekventering af udvalgte gener ét exon ad gangen Jens Michael Hertz 4

5 Sekventeringsteknologier Next generation sequencing (NGS) = massively parallel sequencing = deep sequencing Jens Michael Hertz 5

6 Sekventeringsteknologier Next generation sequencing Whole genome sequencing (3 Gb) Whole exome sequencing (60 Mb) Targeteret sekventering fx af alle gener relateret til: - Kongenit muskeldystrofi - Limb-Girdle muskeldystrofi - Charcot-Marie-Tooths sygdom Jens Michael Hertz 6

7 Platforme System Producent Read lenght HiSeq Illumina 2x100/ 2x150 SOLiD Life Tech 2x Roche 900 Pacific Biosciences MiSeq Illumina 2x250 Ion Torrent Life Tech 100 GS Junior Roche 900

8 Library preparation NGS Workflow Jens Michael Hertz 8

9 Library preparation NGS Workflow Jens Michael Hertz 9

10 Target enrichment NGS Workflow

11 Sequencing NGS Workflow Illumina HiSeq Jens Michael Hertz 11

12 NGS Workflow Dataanalyse Alignment Variant calling Bioinformatisk filtrering af data Jens Michael Hertz 12

13 Alignment and variant calling Reference genome ATCAGAGTGAGATTGATTTATCTGGTGGTGGTGATCAGAGTGAGATTG GGTGGTGATCA GGAGATCAGAG GTGGTGGTGA Interpretation: 3 reads coverage of nucleotide position (all unique) 1 variant read 2 reference reads 33% variation reads Very low coverage, No reliable call

14 Alignment and variant calling Reference genome ATCAGAGTGAGATTGATTTATCTGGTGGTGGTGATCAGAGTGAGATTG GGTGGTGATCA GGAGATCAGAG Interpretation: 8 reads coverage 4 variant read 4 reference reads 50% variation reads GTGGTGGTGA Low coverage, GTGGTGATCAGA More reliable call Heterozygous variant? AGATCAGAGTGA TGGAGATCAGAG GAGATCAGAGTGAGTGAGATTT GGTGATCAGAGTGAGAT

15 Coverage Gap in coverage Coverage (can be determined per nucleotide position) Individual sequence reads

16 NGS: Dataanalyse Bioinformatisk filtrering af data: Whole genome sequencing: Whole exome sequencing: sekvensvarianter sekvensvarianter Finding a needle in a needle-stack Jens Michael Hertz 16

17 NGS: Dataanalyse Bioinformatisk filtrering af data: Whole genome sequencing: Whole exome sequencing: sekvensvarianter sekvensvarianter Filtering Private Non-synonymous eller splice variants Jens Michael Hertz 17

18 Anvendelse af NGS Undersøgelse for mutation i kendte gener (targeteret NGS) ( gen-pakker ) Identifikation af nye sygdomsgener (exomsekventering) Jens Michael Hertz 18

19 CMD phenotype Gene Inheritance Merosin-deficient CMD type 1A LAMA2 Autosomal recessive Ulrich CMD Bethlem myopathy Walker-Warburg syndrom Walker-Warburg syndrom Muscle-eye-brain disease-like CMD Fukuyama CMD Limb-girdle MD type 2M Kongenit muskeldystrofi type 1C Walker-Warburg syndrom Muscle-eye-brain disease-like CMD Walker-Warburg syndrom Kongenit muskeldystrofi type 1D Muscle-eye-brain disease Limb-girdle muskeldystrofi COL6A1 COL6A2 COL6A3 POMT1 POMT2 FKTN FKRP LARGE POMGNT1 Autosomal recessive/ autosomal dominant Autosomal recessive Autosomal recessive Autosomal recessive Autosomal recessive Autosomal recessive Autosomal recessive Rigid spine syndrome SEPN1 Autosomal recessive LMNA-relateret CMD Emery-Dreifuss muskeldystrofi LMNA Autosomal dominant Jens Michael Hertz 19

20 Anvendelse af NGS Undersøgelse for mutation i kendte gener (targeteret NGS) ( gen-pakker ) Identifikation af nye sygdomsgener (exomsekventering) Jens Michael Hertz 20

21 Multiple afficerede i én enkelt familie Antager fuld penetrans og at variant segregerer med sygdom Flere individer kan sekventeres for at begrænse antal kandidater Nære slægtninge har mange private varianter fælles C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 21

22 Multiple afficerede med en dominant arvelig sygdom Sygdommen skal være monogen og uden locusheterogenitet Kun få patienter nødvendige Afhængig af grundig klinisk undersøgelse (samme fænotype) C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 22

23 Én enkelt afficeret med konsangvine forældre Homozygot variant i et område med homozygoti Det er nok med bare én patient Der kan være flere varianter i homozygot form i områder med homozygoti C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 23

24 Én afficeret med recessiv sygdom Én sjælden variant i homozygot form eller to sjældne varianter i compound heterozygot form Det er nok med bare én patient Anlægsbærerhyppigheden i befolkningen af stor betydning Nødvendigt med etnisk matchede kontroller C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 24

25 Én enkelt afficeret med dominant sygdom Variant/gen relateret til kendt gen Kun én patient nødvendig Forudsætter biologisk viden om den pågældende sygdom C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 25

26 Én afficeret (sporadisk) Mutationen er opstået de novo Kun én patient nødvendig Afhængig af sikker sekventering C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 26

27 NGS: Tilfældige fund Tilfældige fund Uventede fund Variants of unknown significance (VUS) Secondary variants Jens Michael Hertz 27

28 NGS: Tilfældige fund Sygdomsdisponerende mutationer med mulighed for intervention Arvelig cancer (surveillance, profylaktisk kirurgi) Arvelige hjertesygdomme (implantable cardioverterdefribrillator; ICD) Sygdomsdisponerende mutationer uden mulighed for intervention Sent debuterende neurodegenerative sygdomme Jens Michael Hertz 28

29 NGS: Tilfældige fund 1000 Genomes Project Consortium : variants in disease associated genes Exome sequencing of 572 patients with atherosclerosis revealed 8 mutations in 37 genes for inherited cance (1.4 %) Am. J. Hum. Genet., 2012; 91: ).

30 NGS: Perspektiver Undersøgelse for mutation i kendte gener (targeteret NGS) ( gen-pakker ) Undersøgelse for mutation i kendte gener, men for sygdomme der ikke tidligere har været forbundet med det pågældende gen (exomsekventering) Identifikation af nye sygdomsgener (exomsekventering) Paradigmeskift i den diagnostiske proces Jens Michael Hertz 30

31 NGS: Perspektiver Non-invasiv prænatal diagnostik af monogent arvelige sygdomme baseret på undersøgelse af frit føtalt DNA i maternelt plasma Individualiseret behandling (pharmacogenomics) Behandlingsstrategi/-valg baseret på tilgrundliggende mutation i sygdomsgen Valg af farmakologisk behandling baseret på genotypning i andre loci Jens Michael Hertz 31

32 NGS presents a paradigm shift for medicine, and the main change will be in the approach to diagnosis, and a more tailored (personal) medical care based on individual risk From low-throughput and expensive molecular tests to high-throughput and in-expensive From a pre-test differential diagnosis generation mode to a post-test diagnostic assessment mode Jens Michael Hertz 32

33 NGS Mutation i genet for Lamin A/C (LMNA):

Bedre diagnostik flere tilfældighedsfund Dilemmaer ved genom-undersøgelser i diagnostik

Bedre diagnostik flere tilfældighedsfund Dilemmaer ved genom-undersøgelser i diagnostik Bedre diagnostik flere tilfældighedsfund Dilemmaer ved genom-undersøgelser i diagnostik Anne-Marie Gerdes Klinisk Genetisk Afdeling Rigshospitalet Hvad kan man bruge gendiagnostik til? Reducere sygdomshyppighed

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

Personlig medicin i genetisk rådgivning og udredning

Personlig medicin i genetisk rådgivning og udredning Personlig medicin i genetisk rådgivning og udredning Elsebet Østergaard Overlæge, Klinisk Genetisk Klinik, Rigshospitalet Formand, Dansk Selskab for Medicinsk Genetik Genetisk rådgivning og udredning før

Læs mere

Lille mand stor biobank big data

Lille mand stor biobank big data Personlig medicin: styr på teknologien og de kloge hoveder Lille mand stor biobank big data Anne-Marie Gerdes Klinikchef, professor Klinisk Genetisk Klinik, RH Medlem af Etisk Råd Disclosure: Advisory

Læs mere

Anlægsbærerundersøgelse ved autosomal recessive sygdomme

Anlægsbærerundersøgelse ved autosomal recessive sygdomme Holdningspapir Dansk Selskab for Medicinsk Genetik Anlægsbærerundersøgelse ved autosomal recessive sygdomme Holdningspapiret er udarbejdet i 2015 af en arbejdsgruppe nedsat af Dansk Selskab for medicinsk

Læs mere

Esben N. Flindt, platformskoordinator Danske Regioner Personlig Medicin 10. december 2014. Danske Regioner - Personlig Medicin 10/12-2014

Esben N. Flindt, platformskoordinator Danske Regioner Personlig Medicin 10. december 2014. Danske Regioner - Personlig Medicin 10/12-2014 Esben N. Flindt, platformskoordinator Danske Regioner Personlig Medicin 10. december 2014 Danske Regioner - Personlig Medicin 10/12-2014 GenomeDenmark Platformen En national platform for stor-skala sekventering

Læs mere

for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af den menneskelige arvemasse

for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af den menneskelige arvemasse Version 3 RETNINGSLINJER for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af den menneskelige arvemasse Holbergsgade 6 DK-1057 København K Tel +45

Læs mere

Arvelig brystkræft hvilke gener kender vi og hvad er den kliniske betydning

Arvelig brystkræft hvilke gener kender vi og hvad er den kliniske betydning Arvelig brystkræft hvilke gener kender vi og hvad er den kliniske betydning Anne-Marie Gerdes DBCG s Genetiske udvalg Arvelig mammacancer Tidlig debut Flere afficerede familiemedlemmer Bilateral mammacancer

Læs mere

Status for udvikling af molekylær medicin ved Molekylær Medicinsk Afdeling, Aarhus Universitetshospital.

Status for udvikling af molekylær medicin ved Molekylær Medicinsk Afdeling, Aarhus Universitetshospital. Regionshuset Viborg Sundhedsplanlægning Skottenborg 26 DK-8800 Viborg Tel. +45 87 28 5000 www.regionmidtjylland.dk Status for udvikling af molekylær medicin ved Molekylær Medicinsk Afdeling, Aarhus Universitetshospital.

Læs mere

Genomisk medicin- nyt paradigme i sundhedsvæsenet. Nye etiske, juridiske og samfundsmæssige udfordringer i hel-genom-analyse-æraen

Genomisk medicin- nyt paradigme i sundhedsvæsenet. Nye etiske, juridiske og samfundsmæssige udfordringer i hel-genom-analyse-æraen Genomisk medicin- nyt paradigme i sundhedsvæsenet Nye etiske, juridiske og samfundsmæssige udfordringer i hel-genom-analyse-æraen Gregor Mendel, grundlægger af genetik som videnskab W. Johannsen, fader

Læs mere

1. Undersøgelsesmetoder, der hører under begrebet omfattende kortlægning

1. Undersøgelsesmetoder, der hører under begrebet omfattende kortlægning Version 5 RETNINGSLINJER for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af individets arvemasse Holbergsgade 6 DK-1057 København K Tel +45 7226

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Vejledning om genomforsøg

Vejledning om genomforsøg Vejledning om genomforsøg Holbergsgade 6 1057 København K T: +45 72 26 93 70 M: kontakt@nvk.dk W: www.nvk.dk Indhold: 1. Undersøgelsesmetoder, der hører under begrebet omfattende kortlægning af individets

Læs mere

Erfaringer fra det første nationale genomprojekt

Erfaringer fra det første nationale genomprojekt Erfaringer fra det første nationale genomprojekt Karsten Kristiansen Laboratory of Genomics and Molecular Biomedicine Biologisk Institut Københavns Universitet og BGI-Shenzhen Kina Personlig medicin, Århus

Læs mere

Cellens livscyklus GAP2. Celledeling

Cellens livscyklus GAP2. Celledeling Cellens livscyklus Cellens livscyklus inddeles i to faser, interfase og mitose. GAP1 (G1). Tiden lige efter mitosen hvor der syntetiseres RNA og protein. Syntese fasen. Tidsrummet hvor DNAet duplikeres

Læs mere

Genetisk disposition til gynækologisk cancer. Anne-Marie Gerdes Klinisk Genetisk Klinik

Genetisk disposition til gynækologisk cancer. Anne-Marie Gerdes Klinisk Genetisk Klinik Genetisk disposition til gynækologisk cancer Anne-Marie Gerdes Klinisk Genetisk Klinik Arvelig cancer Modelsystem for cancerudvikling Identifikation af høj-risiko grupper Arvelige cancersyndromer Autosomal

Læs mere

Gældende fra: April 2014 (Hold SB512) Version: Endelig Side 1 af 5

Gældende fra: April 2014 (Hold SB512) Version: Endelig Side 1 af 5 Molekylærbiologiske analyser og teknikker har viden om teorien og principperne bag udvalgte molekylærbiologiske analyser og teknikker Analyser og analyseprincipper på biomolekylært, celle- og vævs- samt

Læs mere

Guidelines vedr. prædiktiv gentest ved sent debuterende neurodegenerative sygdomme

Guidelines vedr. prædiktiv gentest ved sent debuterende neurodegenerative sygdomme Guidelines vedr. prædiktiv gentest ved sent debuterende neurodegenerative sygdomme Godkendt : 08.11.2014 Arbejdsgruppens medlemmer: Medlemmer udpeget af DSMG: Susanne Eriksen Boonen (Klinisk Genetisk Afdeling,

Læs mere

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle?

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Estrid Høgdall Regionernes Biobank Sekretariat Patologiafdelingen, Herlev Hospital Biobank har en rolle

Læs mere

Introduktion til mikrobiel genomsekventering. mikrobiologer

Introduktion til mikrobiel genomsekventering. mikrobiologer Introduktion til mikrobiel genomsekventering (NGS) for kliniske mikrobiologer Mette Voldby Larsen DTU Center for biologisk sekvensanalyse Henrik Hasman DTU - Fødevareinstituttet Presentation Henrik Hasman

Læs mere

Recessiv (vigende) arvegang

Recessiv (vigende) arvegang 10 Recessiv (vigende) arvegang Anja Lisbeth Frederiksen, reservelæge, ph.d., Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet af Guy s and St Thomas Hospital, London, Storbritanien;

Læs mere

Hereditær Hæmokromatose Rustsygdommen. Hyppighed Klinisk præsentation Diagnostik Behandling Nils Milman, M.D. KPLL

Hereditær Hæmokromatose Rustsygdommen. Hyppighed Klinisk præsentation Diagnostik Behandling Nils Milman, M.D. KPLL Hereditær Hæmokromatose Rustsygdommen Hyppighed Klinisk præsentation Diagnostik Behandling Nils Milman, M.D. KPLL 1 Årsager til Hæmokromatose Primær, hereditær, genetisk HFE hæmokromatose (HH) Sekundær

Læs mere

Det bliver lettere at se forskel på syge og raske gener i Danmark

Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at diagnosticere genetisk betingede sygdomme i Danmark, efter at forskere har nået første milepæl i kortlægningen af

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

X bundet arvegang. Information til patienter og familier

X bundet arvegang. Information til patienter og familier X bundet arvegang Information til patienter og familier 2 X bundet arvegang Følgende er en beskrivelse af, hvad X bundet arvegang betyder og hvorledes X bundne sygdomme nedarves. For at forstå den X bundne

Læs mere

X bundet arvegang. Information til patienter og familier. 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55

X bundet arvegang. Information til patienter og familier. 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 X bundet arvegang Århus Sygehus, Bygn. 12 Århus Universitetshospital Nørrebrogade 44 8000 Århus C Tlf: 89 49 43 63

Læs mere

03-12-2013. Præsentation. Hvad er muskelsvind? Præsentation. Funktion. Muskelsvindsygdomme

03-12-2013. Præsentation. Hvad er muskelsvind? Præsentation. Funktion. Muskelsvindsygdomme Præsentation Hvordan og på hvilket niveau måler vi fysisk funktion og rehabilitering? Og hvordan sikrer vi, at vores metoder afspejler det er der vigtigt for brugeren? Hvem er jeg? Hvad er RehabiliteringsCenter

Læs mere

Personlig medicin: Styr på teknologien og de kloge hoveder

Personlig medicin: Styr på teknologien og de kloge hoveder Personlig medicin: Styr på teknologien og de kloge hoveder Onsdag den 26. oktober kl. 13:00 17:30 i Aulaen på Aarhus Universitet Hvordan sikrer vi os de kloge hoveder, vi skal bruge? Anders Børglum Professor

Læs mere

MiSeq i den daglige rutine. MRSA og VRE Isolater.

MiSeq i den daglige rutine. MRSA og VRE Isolater. MiSeq i den daglige rutine. MRSA og VRE Isolater. 4. juni 2014 DTU Peder Worning, KMA Hvidovre Hvorfor Genomsekventere i Rutinen? Hvad bruger vi DNA-sekvenser til? Typning og bestemmelse af MRSA PCR baserede

Læs mere

Alfa-1-antitrysin mangel hos børn. Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH

Alfa-1-antitrysin mangel hos børn. Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH Alfa-1-antitrysin mangel hos børn Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH Hvad er det? Alfa-1-antitrypsin Proteinstof Produceres i leveren Fungerer i lungerne Regulerer neutrofil elastase balancen

Læs mere

Oliver Hendricks Overlæge, ph.-d. Klinisk lektor Syddansk Universitet

Oliver Hendricks Overlæge, ph.-d. Klinisk lektor Syddansk Universitet Oliver Hendricks Overlæge, ph.-d. Klinisk lektor Syddansk Universitet Compounds which are chemically foreign or hostile to a biological system Eukaryotic drugs Other chemical compounds Drugs Eukaryotedirected

Læs mere

Klinisk genetik og genomet VIDENSKAB 2155

Klinisk genetik og genomet VIDENSKAB 2155 VIDENSKAB 2155 [16]. Dette har givet anledning til debat [17], idet Wolf et al påpegede, at det stred mod den centrale regel om informeret samtykke som forudsætning for både undersøgelse og tilbagemelding,

Læs mere

Eva Køhler. Cand. scient. i biologi. Medlem af Felis Danicas Avlsråd. Ejer og udstiller af maine coon gennem 10 år

Eva Køhler. Cand. scient. i biologi. Medlem af Felis Danicas Avlsråd. Ejer og udstiller af maine coon gennem 10 år Eva Køhler Cand. scient. i biologi Speciale om indavl hos racekatte Medlem af Felis Danicas Avlsråd Ejer og udstiller af maine coon gennem 10 år Administrerer pawpeds for europé og norsk skovkat De generelle

Læs mere

Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse

Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse Side 1 af 5 Procedure/vejledning Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse Udarbejdet af Lægerne, Kennedy Centret 1 Hvad er kromosom mikroarray analyse? Kromosom mikroarray

Læs mere

Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Den basale genetik

Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Den basale genetik Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Intermediate alleler

Læs mere

Personlig medicin og psykisk sygdom. Henrik Rasmussen, Institut for Biologisk Psykiatri, PCSH

Personlig medicin og psykisk sygdom. Henrik Rasmussen, Institut for Biologisk Psykiatri, PCSH Personlig medicin og psykisk sygdom Henrik Rasmussen, Institut for Biologisk Psykiatri, PCSH Institut for Biologisk Psykiatri, Psykiatrisk Center Sct. Hans Genetiske baggrund for opståen af psykiske lidelser

Læs mere

Biobankernes rolle i personlig medicin

Biobankernes rolle i personlig medicin Biobankernes rolle i personlig medicin Henrik Ullum, Biobanksenheden, Rigshospitalet Biobank Mit erfaringsgrundlag Det Danske Bloddonorstudie Foløbig 120.000 deltage følges prospektivt Region Hovedstadens

Læs mere

Patterns of Single-Gene Inheritance

Patterns of Single-Gene Inheritance Patterns of Single-Gene Inheritance Mendels 1. lov: hvis en mand er heterozygot, Aa, vil halvdelen af sædcellerne indeholde A, halvdelen a. hvis en kvinde er heterozygot, vil halvdelen af ægcellerne ligeledes

Læs mere

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Exiqons cloud-løsning hjælper forskere med at analysere og forstå genomics og big data Hvad er genomics? Genomics er

Læs mere

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner Generne bestemmer Niveau: 8. klasse Varighed: 12 lektioner Præsentation: Generne bestemmer er et forløb om genernes indflydelse på individet. I forløbet kommer vi omkring den eukaryote celle, celledeling,

Læs mere

Noninvasiv prænatal test er et gennembrud inden for prænatal screening

Noninvasiv prænatal test er et gennembrud inden for prænatal screening 2 Noninvasiv prænatal test er et gennembrud inden for prænatal screening Louise Stig Hornstrup 1, Louise Ambye 2, Steen Sørensen 2 & Finn Stener Jørgensen 1 Statusartikel 1) Ultralydklinikken, Gynækologisk

Læs mere

Hjertesygdomme - perspektiver med personlig medicin. Henning Bundgaard Professor

Hjertesygdomme - perspektiver med personlig medicin. Henning Bundgaard Professor Hjertesygdomme - perspektiver med personlig medicin Henning Bundgaard Professor Personalised medicine (precision) Personalised medicine s mål er a) at stratificere og b) at time - diagnostik og behandling

Læs mere


www.printo.it/pediatric-rheumatology/dk/intro www.printo.it/pediatric-rheumatology/dk/intro PAPA syndromet Version af 2016 1. HVAD ER PAPA 1.1 Hvad er det? PAPA er en forkortelse for Pyogen Artritis, Pyoderma gangrenosum og Akne. Det er en genetisk

Læs mere

NIPT og prænatal screening

NIPT og prænatal screening NIPT og prænatal screening Møderække med SST: DFMS, DSMG, DSOG, (DSKB) 13. Januar, 24. Februar, 31. Marts, 15. Maj 2014 Off. Sygehuse: Roskilde Ålborg Alle? Private klinikker: Mange! 2 1 Abnorme karyotyper

Læs mere

Mermaid III. Udfordringen i æggestokkræft: Screening, tidlig diagnose og identifikation af kvinder med høj risiko

Mermaid III. Udfordringen i æggestokkræft: Screening, tidlig diagnose og identifikation af kvinder med høj risiko Mermaid III Udfordringen i æggestokkræft: Screening, tidlig diagnose og identifikation af kvinder med høj risiko 1 MERMAID Projektet Ideen til Mermaid projektet opstod i år 2000. Visionen var at sikre

Læs mere


HVAD KAN LÆGEMIDDELINDUSTRIEN OPNÅ VED EN DANSK SATSNING PÅ PERSONLIG MEDICIN? Anders Gersel Pedersen, 10 december 2014 HVAD KAN LÆGEMIDDELINDUSTRIEN OPNÅ VED EN DANSK SATSNING PÅ PERSONLIG MEDICIN? Anders Gersel Pedersen, 10 december 2014 Agenda Forskning og Udvikling hos H. Lundbeck A/S Udvikling af personspecifik medicin

Læs mere

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview World Health Organization 2010 All rights reserved. Based on the Composite International

Læs mere

INFORMATIONSBROCHURE Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede

INFORMATIONSBROCHURE Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede INFORMATIONSBROCHURE Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede Siden 1. januar 2006 har Hovedstadens Sygehusfælleskab tilbudt genetisk udredning af hørenedsættelse.

Læs mere

Dansk Cardiologisk Selskab

Dansk Cardiologisk Selskab Dansk Cardiologisk Selskab www.cardio.dk Arvelige hjertesygdomme DCS Vejledning 2013. Nr. 1 Arvelige Hjertesygdomme DCS vejledning 2013 nr. 1 Udgivet juni 2013 af: Dansk Cardiologisk Selskab Dansk Cardiologisk

Læs mere

Arvelige sygdomme i etniske minoritetsfamilier

Arvelige sygdomme i etniske minoritetsfamilier 469 Arvelige sygdomme i etniske minoritetsfamilier Flemming Skovby Børn af beslægtede forældre, fx fætre og kusiner, har en øget forekomst af genetisk betingede sygdomme. I Danmark er ægteskab mellem beslægtede

Læs mere

Healthcare Apps. OUH Odense University Hospital & Svendborg Hospital. Kiel, Germany, November 2013 1 05/12/13

Healthcare Apps. OUH Odense University Hospital & Svendborg Hospital. Kiel, Germany, November 2013 1 05/12/13 Healthcare Apps OUH Odense University Hospital & Svendborg Hospital Kiel, Germany, November 2013 1 05/12/13 Jesper Lakman Senior Consultant Digital InnovaGon (4 employees) IT Department (140 employees)

Læs mere

Nye retningslinjer under udarbejdelse aktuelt. Behov for nye retningslinjer pga nye metoder i den prænatale diagnostik.

Nye retningslinjer under udarbejdelse aktuelt. Behov for nye retningslinjer pga nye metoder i den prænatale diagnostik. Prænatal Diagnostik Overlæge Christina Fagerberg, Molekylærbiolog Charlotte Brasch Andersen, PhD, Klinisk Genetisk Afdeling, OUH Afdelingslæge Geske Bak, Føtalmedicinsk Klinik, Gynækologisk-Obstestrisk

Læs mere

Non-invasive prænatale screeninger er et felt i

Non-invasive prænatale screeninger er et felt i Non-invasiv prænatal test for føtale trisomier Non-invasive prænatale screeninger er et felt i rivende udvikling. Screeningen mindsker brugen af moderkagebiopsier og fostervandsprøver og derved den medfølgende

Læs mere


VEJLEDNING I DIAGNOSTIK AF TYPE 2 DIABETES DES, DSKB OG DSAM Blodglukoserapportkbjo Page 1 23.08.2002. VEJLEDNING I DIAGNOSTIK AF TYPE 2 DIABETES DES, DSKB OG DSAM Baggrund: Type 2 diabetes er en folkesygdom i betydelig vækst, og der er i dag mere end 200.000 danskere

Læs mere

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview World Health Organization 2010 All rights reserved. Based on the Composite International

Læs mere

Undersøgelse af arvelige faktorer ved autisme

Undersøgelse af arvelige faktorer ved autisme Undersøgelse af arvelige faktorer ved autisme Nyhedsbrev nr. 3, februar 2006 Introduktion Det er med glæde, at vi her kan præsentere vores tredje nyhedsbrev til alle familierne, som deltager i projektet

Læs mere

Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn

Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn Disposition: Flere fødselskomplikationer hos kvinder der har anvendt

Læs mere

Using sequence analysis to assess labor market participation following intervention for patients with low back pain preliminary results

Using sequence analysis to assess labor market participation following intervention for patients with low back pain preliminary results Using sequence analysis to assess labor market participation following intervention for patients with low back pain preliminary results Louise Lindholdt 1,2, Merete Labriola 1,2, Claus Vinther Nielsen

Læs mere

Gensekventering. - og de etiske overvejelser. Naturvidenskabelig Bachelor Hus 14.1. Vejleder: Jesper Olsen

Gensekventering. - og de etiske overvejelser. Naturvidenskabelig Bachelor Hus 14.1. Vejleder: Jesper Olsen Gensekventering - og de etiske overvejelser Camilla Hansen, Kiwi Kjøller, Nina Haxgart, Julie Schnipper, Victoria Fagerholt og Sandra Bredgaard Gruppe 2 Naturvidenskabelig Bachelor Hus 14.1 Vejleder: Jesper

Læs mere

Handlingsplan for Personlig Medicin

Handlingsplan for Personlig Medicin Handlingsplan for Personlig Medicin PIXI-UDGAVEN SIDE 1 HANDLINGSPLAN FOR PERSONLIG MEDICIN Peter får taget en blodprøve - så man kan undersøge hans DNA Peter Alle andre Peters DNA sammenlignes med resten

Læs mere

Revideret specialevejledning for klinisk genetik (version til ansøgning)

Revideret specialevejledning for klinisk genetik (version til ansøgning) Revideret specialevejledning for klinisk genetik (version til ansøgning) Specialevejledningen er udarbejdet som led i Sundhedsstyrelsens specialeplanlægning, jf. sundhedslovens 208, som omhandler organiseringen

Læs mere

ASTRAZENECA ONCOLOGY EDUCATION. Invitation Nordic - Baltic Masterclass. BRCA tumor testing

ASTRAZENECA ONCOLOGY EDUCATION. Invitation Nordic - Baltic Masterclass. BRCA tumor testing ASTRAZENECA ONCOLOGY EDUCATION Invitation Nordic - Baltic Masterclass BRCA tumor testing February, 28 th 2017 In co-operation with: Estrid Høgdall, Professor, Dr. Sc., Ph.d., Head of Molecular Unit, Herlev

Læs mere

CF neonatal screening (logistik og praktiske forhold)

CF neonatal screening (logistik og praktiske forhold) CF neonatal screening (logistik og praktiske forhold) Information fra Sundhedsstyrelsen https://sundhedsstyrelsen.dk/da/sundhed-og-livsstil/graviditet-ogfoedsel/screening-af-nyfoedte Information til forældre

Læs mere

Hvad ved vi om HC i Kina?

Hvad ved vi om HC i Kina? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Kinesisk Huntingtons Chorea-netværk lanceret Kinesisk HC-netværk er blevet lanceret. En god nyhed

Læs mere


ODONTOLOGISK EMBEDSEKSAMEN ODONTOLOGISK EMBEDSEKSAMEN MEDICINSK GENETIK Mandag den 19. oktober 2009 kl. 9.00-12.00 Indhold: Opgaverne 1-3 side 2-8 Vægtningsliste side 9 Vejledning: Besvarelserne af opgaverne skrives med kuglepen

Læs mere

Deltagere udpeget af: Dansk Cardiologisk Selskab: Henrik Kjærulf Jensen, overlæge, klinisk lektor, ph.d.,dr. med., Kardiologisk Afdeling, AUH.

Deltagere udpeget af: Dansk Cardiologisk Selskab: Henrik Kjærulf Jensen, overlæge, klinisk lektor, ph.d.,dr. med., Kardiologisk Afdeling, AUH. Guideline vedrørende prædiktiv gentest 2015 DSMG Dansk Selskab for Medicinsk Genetik Godkendt: 01.02.2016 Arbejdsgruppens medlemmer: Deltagere udpeget af DSMG: Ida Vogel, ledende overlæge, ph.d., dr. med.,

Læs mere

Elektronisk kvalitetsredskab, forskningsdatabase og patientjournal.

Elektronisk kvalitetsredskab, forskningsdatabase og patientjournal. Elektronisk kvalitetsredskab, forskningsdatabase og patientjournal. Udfordringer og muligheder. Erfaringer fra DANBIO Dansk Reumatologisk Database Merete Lund Hetland, MD, PHD, DMSc, ass. professor The

Læs mere

ALS FORSKNING: GENER OG PIPELINE MEDICIN. Páll Karlsson. Ph.d. Med. Danish Pain Research Center Dept. of Neurology Aarhus University Hospital

ALS FORSKNING: GENER OG PIPELINE MEDICIN. Páll Karlsson. Ph.d. Med. Danish Pain Research Center Dept. of Neurology Aarhus University Hospital : GENER OG PIPELINE MEDICIN Ph.d. Med. Danish Pain Research Center Dept. of Neurology Aarhus University Hospital OSLO, 24 OKTOBER 2015 1 AARHUS M.Sc. i neuro-biologi (2009) fra Aarhus Ph.d. i medicin (2013)

Læs mere

A-kursus Middelfart 2014

A-kursus Middelfart 2014 A-kursus Middelfart 2014 Lumbal prolaps Jesper Lundberg, neurokirurg Videncenter for Rheumatologi og Rygsygdomme Glostrup Hospital A-kursus i Middelfart: Opgave! Da vi gerne vil ruste vores kursister bedst

Læs mere

Takkeforelæsning i forbindelse med overrækkelse af videnskabsetisk hæderspris d 18. september 2014

Takkeforelæsning i forbindelse med overrækkelse af videnskabsetisk hæderspris d 18. september 2014 Takkeforelæsning i forbindelse med overrækkelse af videnskabsetisk hæderspris d 18. september 2014 Intro Det er en stor glæde og ære at modtage den videnskabsetiske hæderspris på vegne af Kennedy centret.

Læs mere

Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008

Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008 Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008 Susanne Kjærgaard Overlæge, dr.med. Klinisk Genetisk Afdeling Udredning af det syge foster Anamnese Familieanamnese Klinisk undersøgelse

Læs mere

Projekt DiaNerve Tidlig Opsporing af Nerveskade giver ny Viden og forebygger Amputationer

Projekt DiaNerve Tidlig Opsporing af Nerveskade giver ny Viden og forebygger Amputationer Velfærdsløftet er lige om hjørnet København den 23. oktober 2013 Projekt DiaNerve Tidlig Opsporing af Nerveskade giver ny Viden og forebygger Amputationer PLATFORM Fondsgiver UNIK Partnerskabet Teknologi

Læs mere

Stepped care. Allan Jones - PSYDOC

Stepped care. Allan Jones - PSYDOC Stepped care Allan Jones Cand. Psych., PhD., CPsychol. Lektor I klinisk psykologi og Forskningsleder PSYDOC. Syddansk Universitet E-mail: ajones@health.sdu.dk Stepped-care Der er en fortsat stigning i

Læs mere

Dandy Walker Like Malformation

Dandy Walker Like Malformation Dandy Walker Like Malformation Speciale af Hedvig Christiansson and Evelina Kling Vegeby Præsenteret af Helle Friis Proschowsky Dyrlæge, Phd., Specialkonsulent hos DKK DWLM projektet 1. Hvad er DWLM 2.

Læs mere



Læs mere

Syndromiske medfødte muskeldystrofier

Syndromiske medfødte muskeldystrofier Syndromiske medfødte muskeldystrofier Beskrivelse Mere faglig viden Betydningen af en god udredning Støttemuligheder Andre med samme diagnose? Links A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Læs mere

Bakterier Venner eller fjender?

Bakterier Venner eller fjender? Akademiet for Talentfulde Unge 2013: Bakterier Venner eller fjender? Ole Skovgaard olesk@ruc.dk Ole Skovgaard, 2013 Bakterier: Er en ur-gammel livsform! Indeholder langt større variationer end de store

Læs mere

Title Mevalonat Kinase Defekt (MKD) (eller HYper IgD syndrome)

Title Mevalonat Kinase Defekt (MKD) (eller HYper IgD syndrome) www.printo.it/pediatric-rheumatology/dk/intro Title Mevalonat Kinase Defekt (MKD) (eller HYper IgD syndrome) Version af 2016 1. HVAD ER MKD 1.1 Hvad er det? Mevalonat kinase mangel er en genetisk sygdom.

Læs mere

Afgørelse vedr. KO-2016-1089 reklamemateriale vedr. Aubagio (teriflunomid).

Afgørelse vedr. KO-2016-1089 reklamemateriale vedr. Aubagio (teriflunomid). København, den 23. marts 2016 AFGØRELSE Afgørelse vedr. KO-2016-1089 reklamemateriale vedr. Aubagio (teriflunomid). Granskningsmandspanelet har dags dato truffet følgende afgørelse i klagesagen imellem

Læs mere

KROMOSOMER... 7 Hovedtræk ved kromosomer... 7 Kønskromosomer... 7 Ikke kønskromosomer... 7 CELLEDELINGEN... 7 Mitose... 8 Meiose...


Læs mere

Genetisk rådgivning for arvelig brystkræft, HBC

Genetisk rådgivning for arvelig brystkræft, HBC Patientinformation Genetisk rådgivning for arvelig brystkræft, HBC Klinisk Genetisk Afdeling (KGA) Introduktion: Denne informationspjece omhandler genetisk udredning og rådgivning samt testning for arvelig

Læs mere

Nøjagtig modsat virkning opnåes ved krydsning, hvor heterozygoti på sådanne loci kan medføre krydsningsfrodighed.

Nøjagtig modsat virkning opnåes ved krydsning, hvor heterozygoti på sådanne loci kan medføre krydsningsfrodighed. Lidt om avl og indavl (4) Indavl anvender vi for hos afkommet, for at få de ønskede egenskaber fastlagt genetisk. Dette kan ikke forhindre, at der også forekommer en fordobling af de uønskede egenskaber.

Læs mere

Kjers. sygdom. Nyt fra forskningsfronten. Et studie der søger at påvise årsager til og behandling af denne hidtil uhelbredelige øjensygdom

Kjers. sygdom. Nyt fra forskningsfronten. Et studie der søger at påvise årsager til og behandling af denne hidtil uhelbredelige øjensygdom Kjers Nyt fra forskningsfronten sygdom Gitte Juul Almind Reservelæge, ph.d.-stud. Kennedy Centret Illustrationer: Mediafarm arvelig synsnerveskrumpning (ADOA - Autosomal Dominant Opticus Atrofi) Et studie

Læs mere

Perspektiver på fysisk aktivitet

Perspektiver på fysisk aktivitet Perspektiver på fysisk aktivitet V/Tue Kristensen, Projektleder Sundhedsstyrelsen, Center for Forebyggelse Kontakt: tuk@sst.dk Disposition Hvor meget? - Tal på fysisk aktivitet/inaktivitet - Reviderede

Læs mere

Eksamen: Biologi C-niveau 2a bi

Eksamen: Biologi C-niveau 2a bi Eksamen: Biologi C-niveau 2a bi Dato: 3.6.2015 Eksaminator: Carsten Sejer Christiansen Censor: Hans Christian Ihler Hold: 2a bi Elever: 8 Eksamensform: - Trækning af eksamensspørgsmål inkl. bilag - 24

Læs mere

Genetisk udredning af det syge foster

Genetisk udredning af det syge foster Genetisk udredning af det syge foster Kursus i Føtal Medicin 2014 Susanne Kjærgaard Overlæge, dr.med. Kromosomlaboratoriet Klinisk Genetisk Afdeling Udredning af det syge foster Anamnese Familieanamnese

Læs mere

Populationsgenetik og - genomics: Værktøjer til forståelse og overvågning af biodiversitet

Populationsgenetik og - genomics: Værktøjer til forståelse og overvågning af biodiversitet Populationsgenetik og - genomics: Værktøjer til forståelse og overvågning af biodiversitet Michael M. Hansen Institut for Bioscience, Aarhus Universitet Biodiversitet Convention on Biological Diversity

Læs mere

Genom-undersøgelser. Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren. Baggrundsrapport

Genom-undersøgelser. Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren. Baggrundsrapport Genom-undersøgelser Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren Baggrundsrapport Genom-undersøgelser Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren Baggrundsrapport

Læs mere

Behandling af akne i graviditeten Hedegaard, U., Larsen, J. & Damkier, P. 2008 I : Syddanske Læger. 1, s. 20 1 s.

Behandling af akne i graviditeten Hedegaard, U., Larsen, J. & Damkier, P. 2008 I : Syddanske Læger. 1, s. 20 1 s. Ulla Hedegaard Klinisk farmaceut, Ph.d.-studerende Klinisk Farmakologi Afd. for Klinisk Biokemi og Farmakologi Postaddresse: J. B. Winsløws Vej 19, 2. 5000 Odense C Danmark Postaddresse: J. B. Winsløws

Læs mere

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt.

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt. Deltagerinformation Projekttitel: DD2 - Dansk center for strategisk forskning i type 2 diabetes Godkendt af Den Videnskabsetiske Komité for Region Syddanmark, journal nr. S-201000082. Søger personer med

Læs mere

DD2 Status. Henning Beck-Nielsen Diabetes UpDate Nyborg, 14. november 2011

DD2 Status. Henning Beck-Nielsen Diabetes UpDate Nyborg, 14. november 2011 DD2 Status Henning Beck-Nielsen Diabetes UpDate Nyborg, 14. november 2011 > Hvorfor DD2? 250.000 patienter med type 2 diabetes (T2D) i Danmark 65 nye tilfælde hver dag i Danmark Forkorter livet med omkring

Læs mere

Nøjagtig modsat virkning opnåes ved krydsning, hvor heterozygoti på sådanne loci kan medføre krydsningsfrodighed.

Nøjagtig modsat virkning opnåes ved krydsning, hvor heterozygoti på sådanne loci kan medføre krydsningsfrodighed. Friis Lara Indavl anvender vi for hos afkommet, for at få de ønskede egenskaber fastlagt genetisk. Dette kan ikke forhindre, at der også forekommer en fordobling af de uønskede egenskaber. Der optræder

Læs mere

ORDINÆR EKSAMEN I SKRIFTLIG MEDICINSK GENETIK Medicin, 2. semester Odontologi, 2. semester Molekylær Biomedicin, 3. semester 27. maj 2011 (2 timer)

ORDINÆR EKSAMEN I SKRIFTLIG MEDICINSK GENETIK Medicin, 2. semester Odontologi, 2. semester Molekylær Biomedicin, 3. semester 27. maj 2011 (2 timer) D E T S U N D H E D S V I D E N S K A B E L I G E F A K U L T E T K Ø B E N H A V N S U N I V E R S I T E T B l e g d a m s v e j 3 B 2 2 0 0 K ø b e n h a v n N ORDINÆR EKSAMEN I SKRIFTLIG MEDICINSK GENETIK

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin December 2015 Institution Vestegnen HF & VUC Uddannelse Fag og niveau Lærer Hold Hfe Biologi C, jf. bekendtgørelse

Læs mere

Det Medicinske Selskab i København. > Efterår 2014

Det Medicinske Selskab i København. > Efterår 2014 Det Medicinske Selskab i København > Efterår 2014 > Sæsonprogram for efterår 2014 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 23. september kl. 20.00: Tirsdag den 7. oktober kl. 20.00:

Læs mere

Arvelige hjertesygdomme

Arvelige hjertesygdomme Dansk Cardiologisk Selskab www.cardio.dk Arvelige hjertesygdomme DCS vejledning 2006 Nr. 1 Arvelige hjertesygdomme DCS vejledning 2006 Nr. 1 Copyright Dansk Cardiologisk Selskab. Udgivet august 2006 af:

Læs mere

PPV skemaer (udskriftsvenlig)

PPV skemaer (udskriftsvenlig) Introduktion til PPV-skema i almen praksis Et PPV(positiv prædiktiv værdi)-skema for en specifik kræftsygdom omhandler sandsynligheden for, at patienten har sygdommen, når patienten præsenterer symptomet

Læs mere

Kromosomforandringer. Information til patienter og familier

Kromosomforandringer. Information til patienter og familier Kromosomforandringer Information til patienter og familier 2 Kromosomforandringer Den følgende information er en beskrivelse af kromosomforandringer, hvorledes de nedarves og hvornår dette kan medføre

Læs mere

PAUSE. Hvor stort er problemet? 10-12.000 i behandling/år. Storforbrug 860.000 20% af 16+ årige. Skadeligt forbrug 585.000 13% af 16+ årige

PAUSE. Hvor stort er problemet? 10-12.000 i behandling/år. Storforbrug 860.000 20% af 16+ årige. Skadeligt forbrug 585.000 13% af 16+ årige PAUSE Phenotypes in Alcohol Use Disorders A multidisciplinary approach to improve understanding, diagnosis, and treatment of patients with Alco-hol Use Disorders (AUD) Hvor stort er problemet? Storforbrug

Læs mere

Tidlig palliativ indsats - overvejelser ift. klinik og forskning

Tidlig palliativ indsats - overvejelser ift. klinik og forskning Tidlig palliativ indsats - overvejelser ift. klinik og forskning Forskerdag i palliationsnetværket 5. november, 2014 Karen Marie Dalgaard, spl., cand. scient. soc., ph.d. Forsker PAVI -Videncenter for

Læs mere