Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse

Størrelse: px
Starte visningen fra side:

Download "Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse"

Transkript

1 Danish Consortium for Neuromuscular Diseases Genomsekventering klinisk anvendelse Odense, 2. september, 2013 Jens Michael Hertz, MD, DMSc Professor, consultant Phone: (dir.), or (mob.) Department of Clinical Genetics Odense University Hospital Sdr. Boulevard 29 DK-5000 Odense C, Denmark

2 NGS presents a paradigm shift for medicine, and the main change will be in the approach to diagnosis, and a more tailored (personal) medical care based on individual risk From low-throughput and expensive molecular tests to high-throughput and in-expensive From a pre-test differential diagnosis generation mode to a post-test diagnostic assessment mode Jens Michael Hertz 2

3 Molekylærgenetisk diagnostik I alt gener Man kender den genetiske baggrund for ca arvelige sygdomme Jens Michael Hertz 3

4 Sekventeringsteknologier Sanger sekventering af udvalgte gener ét exon ad gangen Jens Michael Hertz 4

5 Sekventeringsteknologier Next generation sequencing (NGS) = massively parallel sequencing = deep sequencing Jens Michael Hertz 5

6 Sekventeringsteknologier Next generation sequencing Whole genome sequencing (3 Gb) Whole exome sequencing (60 Mb) Targeteret sekventering fx af alle gener relateret til: - Kongenit muskeldystrofi - Limb-Girdle muskeldystrofi - Charcot-Marie-Tooths sygdom Jens Michael Hertz 6

7 Platforme System Producent Read lenght HiSeq Illumina 2x100/ 2x150 SOLiD Life Tech 2x Roche 900 Pacific Biosciences MiSeq Illumina 2x250 Ion Torrent Life Tech 100 GS Junior Roche 900

8 Library preparation NGS Workflow Jens Michael Hertz 8

9 Library preparation NGS Workflow Jens Michael Hertz 9

10 Target enrichment NGS Workflow

11 Sequencing NGS Workflow Illumina HiSeq Jens Michael Hertz 11

12 NGS Workflow Dataanalyse Alignment Variant calling Bioinformatisk filtrering af data Jens Michael Hertz 12

13 Alignment and variant calling Reference genome ATCAGAGTGAGATTGATTTATCTGGTGGTGGTGATCAGAGTGAGATTG GGTGGTGATCA GGAGATCAGAG GTGGTGGTGA Interpretation: 3 reads coverage of nucleotide position (all unique) 1 variant read 2 reference reads 33% variation reads Very low coverage, No reliable call

14 Alignment and variant calling Reference genome ATCAGAGTGAGATTGATTTATCTGGTGGTGGTGATCAGAGTGAGATTG GGTGGTGATCA GGAGATCAGAG Interpretation: 8 reads coverage 4 variant read 4 reference reads 50% variation reads GTGGTGGTGA Low coverage, GTGGTGATCAGA More reliable call Heterozygous variant? AGATCAGAGTGA TGGAGATCAGAG GAGATCAGAGTGAGTGAGATTT GGTGATCAGAGTGAGAT

15 Coverage Gap in coverage Coverage (can be determined per nucleotide position) Individual sequence reads

16 NGS: Dataanalyse Bioinformatisk filtrering af data: Whole genome sequencing: Whole exome sequencing: sekvensvarianter sekvensvarianter Finding a needle in a needle-stack Jens Michael Hertz 16

17 NGS: Dataanalyse Bioinformatisk filtrering af data: Whole genome sequencing: Whole exome sequencing: sekvensvarianter sekvensvarianter Filtering Private Non-synonymous eller splice variants Jens Michael Hertz 17

18 Anvendelse af NGS Undersøgelse for mutation i kendte gener (targeteret NGS) ( gen-pakker ) Identifikation af nye sygdomsgener (exomsekventering) Jens Michael Hertz 18

19 CMD phenotype Gene Inheritance Merosin-deficient CMD type 1A LAMA2 Autosomal recessive Ulrich CMD Bethlem myopathy Walker-Warburg syndrom Walker-Warburg syndrom Muscle-eye-brain disease-like CMD Fukuyama CMD Limb-girdle MD type 2M Kongenit muskeldystrofi type 1C Walker-Warburg syndrom Muscle-eye-brain disease-like CMD Walker-Warburg syndrom Kongenit muskeldystrofi type 1D Muscle-eye-brain disease Limb-girdle muskeldystrofi COL6A1 COL6A2 COL6A3 POMT1 POMT2 FKTN FKRP LARGE POMGNT1 Autosomal recessive/ autosomal dominant Autosomal recessive Autosomal recessive Autosomal recessive Autosomal recessive Autosomal recessive Autosomal recessive Rigid spine syndrome SEPN1 Autosomal recessive LMNA-relateret CMD Emery-Dreifuss muskeldystrofi LMNA Autosomal dominant Jens Michael Hertz 19

20 Anvendelse af NGS Undersøgelse for mutation i kendte gener (targeteret NGS) ( gen-pakker ) Identifikation af nye sygdomsgener (exomsekventering) Jens Michael Hertz 20

21 Multiple afficerede i én enkelt familie Antager fuld penetrans og at variant segregerer med sygdom Flere individer kan sekventeres for at begrænse antal kandidater Nære slægtninge har mange private varianter fælles C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 21

22 Multiple afficerede med en dominant arvelig sygdom Sygdommen skal være monogen og uden locusheterogenitet Kun få patienter nødvendige Afhængig af grundig klinisk undersøgelse (samme fænotype) C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 22

23 Én enkelt afficeret med konsangvine forældre Homozygot variant i et område med homozygoti Det er nok med bare én patient Der kan være flere varianter i homozygot form i områder med homozygoti C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 23

24 Én afficeret med recessiv sygdom Én sjælden variant i homozygot form eller to sjældne varianter i compound heterozygot form Det er nok med bare én patient Anlægsbærerhyppigheden i befolkningen af stor betydning Nødvendigt med etnisk matchede kontroller C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 24

25 Én enkelt afficeret med dominant sygdom Variant/gen relateret til kendt gen Kun én patient nødvendig Forudsætter biologisk viden om den pågældende sygdom C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 25

26 Én afficeret (sporadisk) Mutationen er opstået de novo Kun én patient nødvendig Afhængig af sikker sekventering C. Gilissen et al., 2012, EJHG; 20: Jens Michael Hertz 26

27 NGS: Tilfældige fund Tilfældige fund Uventede fund Variants of unknown significance (VUS) Secondary variants Jens Michael Hertz 27

28 NGS: Tilfældige fund Sygdomsdisponerende mutationer med mulighed for intervention Arvelig cancer (surveillance, profylaktisk kirurgi) Arvelige hjertesygdomme (implantable cardioverterdefribrillator; ICD) Sygdomsdisponerende mutationer uden mulighed for intervention Sent debuterende neurodegenerative sygdomme Jens Michael Hertz 28

29 NGS: Tilfældige fund 1000 Genomes Project Consortium : variants in disease associated genes Exome sequencing of 572 patients with atherosclerosis revealed 8 mutations in 37 genes for inherited cance (1.4 %) Am. J. Hum. Genet., 2012; 91: ).

30 NGS: Perspektiver Undersøgelse for mutation i kendte gener (targeteret NGS) ( gen-pakker ) Undersøgelse for mutation i kendte gener, men for sygdomme der ikke tidligere har været forbundet med det pågældende gen (exomsekventering) Identifikation af nye sygdomsgener (exomsekventering) Paradigmeskift i den diagnostiske proces Jens Michael Hertz 30

31 NGS: Perspektiver Non-invasiv prænatal diagnostik af monogent arvelige sygdomme baseret på undersøgelse af frit føtalt DNA i maternelt plasma Individualiseret behandling (pharmacogenomics) Behandlingsstrategi/-valg baseret på tilgrundliggende mutation i sygdomsgen Valg af farmakologisk behandling baseret på genotypning i andre loci Jens Michael Hertz 31

32 NGS presents a paradigm shift for medicine, and the main change will be in the approach to diagnosis, and a more tailored (personal) medical care based on individual risk From low-throughput and expensive molecular tests to high-throughput and in-expensive From a pre-test differential diagnosis generation mode to a post-test diagnostic assessment mode Jens Michael Hertz 32

33 NGS Mutation i genet for Lamin A/C (LMNA):

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Det bliver lettere at se forskel på syge og raske gener i Danmark

Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at diagnosticere genetisk betingede sygdomme i Danmark, efter at forskere har nået første milepæl i kortlægningen af

Læs mere

Hereditær Hæmokromatose Rustsygdommen. Hyppighed Klinisk præsentation Diagnostik Behandling Nils Milman, M.D. KPLL

Hereditær Hæmokromatose Rustsygdommen. Hyppighed Klinisk præsentation Diagnostik Behandling Nils Milman, M.D. KPLL Hereditær Hæmokromatose Rustsygdommen Hyppighed Klinisk præsentation Diagnostik Behandling Nils Milman, M.D. KPLL 1 Årsager til Hæmokromatose Primær, hereditær, genetisk HFE hæmokromatose (HH) Sekundær

Læs mere

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle?

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Estrid Høgdall Regionernes Biobank Sekretariat Patologiafdelingen, Herlev Hospital Biobank har en rolle

Læs mere

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Exiqons cloud-løsning hjælper forskere med at analysere og forstå genomics og big data Hvad er genomics? Genomics er

Læs mere

Klinisk genetik og genomet VIDENSKAB 2155

Klinisk genetik og genomet VIDENSKAB 2155 VIDENSKAB 2155 [16]. Dette har givet anledning til debat [17], idet Wolf et al påpegede, at det stred mod den centrale regel om informeret samtykke som forudsætning for både undersøgelse og tilbagemelding,

Læs mere

Patterns of Single-Gene Inheritance

Patterns of Single-Gene Inheritance Patterns of Single-Gene Inheritance Mendels 1. lov: hvis en mand er heterozygot, Aa, vil halvdelen af sædcellerne indeholde A, halvdelen a. hvis en kvinde er heterozygot, vil halvdelen af ægcellerne ligeledes

Læs mere

Noninvasiv prænatal test er et gennembrud inden for prænatal screening

Noninvasiv prænatal test er et gennembrud inden for prænatal screening 2 Noninvasiv prænatal test er et gennembrud inden for prænatal screening Louise Stig Hornstrup 1, Louise Ambye 2, Steen Sørensen 2 & Finn Stener Jørgensen 1 Statusartikel 1) Ultralydklinikken, Gynækologisk

Læs mere

INFORMATIONSBROCHURE Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede

INFORMATIONSBROCHURE Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede INFORMATIONSBROCHURE Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede Siden 1. januar 2006 har Hovedstadens Sygehusfælleskab tilbudt genetisk udredning af hørenedsættelse.

Læs mere

Undersøgelse af arvelige faktorer ved autisme

Undersøgelse af arvelige faktorer ved autisme Undersøgelse af arvelige faktorer ved autisme Nyhedsbrev nr. 3, februar 2006 Introduktion Det er med glæde, at vi her kan præsentere vores tredje nyhedsbrev til alle familierne, som deltager i projektet

Læs mere

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview World Health Organization 2010 All rights reserved. Based on the Composite International

Læs mere

Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn

Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn Disposition: Flere fødselskomplikationer hos kvinder der har anvendt

Læs mere

Gensekventering. - og de etiske overvejelser. Naturvidenskabelig Bachelor Hus 14.1. Vejleder: Jesper Olsen

Gensekventering. - og de etiske overvejelser. Naturvidenskabelig Bachelor Hus 14.1. Vejleder: Jesper Olsen Gensekventering - og de etiske overvejelser Camilla Hansen, Kiwi Kjøller, Nina Haxgart, Julie Schnipper, Victoria Fagerholt og Sandra Bredgaard Gruppe 2 Naturvidenskabelig Bachelor Hus 14.1 Vejleder: Jesper

Læs mere

Genom-undersøgelser. Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren. Baggrundsrapport

Genom-undersøgelser. Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren. Baggrundsrapport Genom-undersøgelser Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren Baggrundsrapport Genom-undersøgelser Etiske dilemmaer i diagnostik, i forskning og direkte til forbrugeren Baggrundsrapport

Læs mere

Bakterier Venner eller fjender?

Bakterier Venner eller fjender? Akademiet for Talentfulde Unge 2013: Bakterier Venner eller fjender? Ole Skovgaard olesk@ruc.dk Ole Skovgaard, 2013 Bakterier: Er en ur-gammel livsform! Indeholder langt større variationer end de store

Læs mere

Healthcare Apps. OUH Odense University Hospital & Svendborg Hospital. Kiel, Germany, November 2013 1 05/12/13

Healthcare Apps. OUH Odense University Hospital & Svendborg Hospital. Kiel, Germany, November 2013 1 05/12/13 Healthcare Apps OUH Odense University Hospital & Svendborg Hospital Kiel, Germany, November 2013 1 05/12/13 Jesper Lakman Senior Consultant Digital InnovaGon (4 employees) IT Department (140 employees)

Læs mere

ORDINÆR EKSAMEN I SKRIFTLIG MEDICINSK GENETIK Medicin, 2. semester Odontologi, 2. semester Molekylær Biomedicin, 3. semester 27. maj 2011 (2 timer)

ORDINÆR EKSAMEN I SKRIFTLIG MEDICINSK GENETIK Medicin, 2. semester Odontologi, 2. semester Molekylær Biomedicin, 3. semester 27. maj 2011 (2 timer) D E T S U N D H E D S V I D E N S K A B E L I G E F A K U L T E T K Ø B E N H A V N S U N I V E R S I T E T B l e g d a m s v e j 3 B 2 2 0 0 K ø b e n h a v n N ORDINÆR EKSAMEN I SKRIFTLIG MEDICINSK GENETIK

Læs mere

Det Medicinske Selskab i København. > Efterår 2014

Det Medicinske Selskab i København. > Efterår 2014 Det Medicinske Selskab i København > Efterår 2014 > Sæsonprogram for efterår 2014 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 23. september kl. 20.00: Tirsdag den 7. oktober kl. 20.00:

Læs mere

Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008

Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008 Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008 Susanne Kjærgaard Overlæge, dr.med. Klinisk Genetisk Afdeling Udredning af det syge foster Anamnese Familieanamnese Klinisk undersøgelse

Læs mere

Genetisk udredning af det syge foster

Genetisk udredning af det syge foster Genetisk udredning af det syge foster Kursus i Føtal Medicin 2014 Susanne Kjærgaard Overlæge, dr.med. Kromosomlaboratoriet Klinisk Genetisk Afdeling Udredning af det syge foster Anamnese Familieanamnese

Læs mere

Hvad ved vi om HC i Kina?

Hvad ved vi om HC i Kina? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Kinesisk Huntingtons Chorea-netværk lanceret Kinesisk HC-netværk er blevet lanceret. En god nyhed

Læs mere

Behandling af akne i graviditeten Hedegaard, U., Larsen, J. & Damkier, P. 2008 I : Syddanske Læger. 1, s. 20 1 s.

Behandling af akne i graviditeten Hedegaard, U., Larsen, J. & Damkier, P. 2008 I : Syddanske Læger. 1, s. 20 1 s. Ulla Hedegaard Klinisk farmaceut, Ph.d.-studerende Klinisk Farmakologi Afd. for Klinisk Biokemi og Farmakologi Postaddresse: J. B. Winsløws Vej 19, 2. 5000 Odense C Danmark Postaddresse: J. B. Winsløws

Læs mere

NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON

NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON De sidste 5 års store teknologiske gennembrud har gjort, at vi i dag nemt og økonomisk

Læs mere

MCAD defekt; en lang rejse

MCAD defekt; en lang rejse MCAD defekt; en lang rejse Niels Gregersen Molekylær Medicinsk Forskningsenhed Klinisk Institut, Aarhus Universitet og Århus Universitetshospital, Skejby VLCAD EH HDH KT TFP MCAD SCAD LCAD EH HDH KT MCAD

Læs mere

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt.

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt. Deltagerinformation Projekttitel: DD2 - Dansk center for strategisk forskning i type 2 diabetes Godkendt af Den Videnskabsetiske Komité for Region Syddanmark, journal nr. S-201000082. Søger personer med

Læs mere

Bedømmelse af kliniske retningslinjer

Bedømmelse af kliniske retningslinjer www.cfkr.dk Bedømmelse af kliniske retningslinjer - CLEARINGHOUSE Preben Ulrich Pedersen, professor, phd Center for kliniske retningslinjer er placeret ved. Institut for Sundhedsvidenskab og Teknologi,

Læs mere

Indholdsfortegnelse MONOGENE EGENSKABERS ARVEGANGE... 2 MUTATIONER... 8 MOLEKYLÆR GENETIK, NORMALE GENER, SYGDOMSGENER... 11 GENERS FUNKTION...

Indholdsfortegnelse MONOGENE EGENSKABERS ARVEGANGE... 2 MUTATIONER... 8 MOLEKYLÆR GENETIK, NORMALE GENER, SYGDOMSGENER... 11 GENERS FUNKTION... Opdateret: 30. April 2003 Indholdsfortegnelse MONOGENE EGENSKABERS ARVEGANGE... 2 MUTATIONER... 8 MOLEKYLÆR GENETIK, NORMALE GENER, SYGDOMSGENER... 11 GENERS FUNKTION... 15 GENETISK KOBLING OG GENKORTLÆGNING...

Læs mere

Social position og kirurgi for tidlig-stadie ikke-småcellet lungekræft: en registerbaseret undersøgelse

Social position og kirurgi for tidlig-stadie ikke-småcellet lungekræft: en registerbaseret undersøgelse Social position og kirurgi for tidlig-stadie ikke-småcellet lungekræft: en registerbaseret undersøgelse Susanne Dalton Survivorship Danish Cancer Society Research Center Copenhagen, Denmark Baggrund 3

Læs mere

Diagnostiske centre i Danmark - Behovet set fra almen praksis

Diagnostiske centre i Danmark - Behovet set fra almen praksis Diagnostiske centre i Danmark - Behovet set fra almen praksis Mads Lind Ingeman & Peter Vedsted Mads Lind Ingeman Speciallæge i Almen Medicin, Ph.D.-studerende Center for Cancerdiagnostik i Praksis CaP

Læs mere

Nyhedsbrev fra dchi. s. 6 kommende arrangementer. www.dchi.aau.dk

Nyhedsbrev fra dchi. s. 6 kommende arrangementer. www.dchi.aau.dk Nyhedsbrev fra dchi s. 2 Inflation i interessen for sundhedsøkonomi s. 3 workshop: Public health, healthcare evaluations and labor markets s. 4 DChi s ph.d projekter s. 5 DCHI medsponsor for minikonference

Læs mere

Patienten I eget hjem anno 2025 Er teknikeren vigtigere end klinikeren?

Patienten I eget hjem anno 2025 Er teknikeren vigtigere end klinikeren? Patienten I eget hjem anno 2025 Er teknikeren vigtigere end klinikeren? Jane Clemensen Lektor, CIMT, Odense University Hospital, SDU, University College Lillebælt Agenda Bevægelser i sundhedssektoren.

Læs mere

OPLÆG TIL KONSENSUSKONFERENCEN TEST AF VORES GENER

OPLÆG TIL KONSENSUSKONFERENCEN TEST AF VORES GENER OPLÆG TIL KONSENSUSKONFERENCEN TEST AF VORES GENER HVAD ER GENTESTNING OG HVOR ANVENDES DEN?... 3 Af Steen Kølvraa STATUS OG PERSPEKTIVER I GENFORSKNINGEN I FORBINDELSE MED GENTESTNING... 6 Af Anders D.

Læs mere

Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede

Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede Arvelig hørenedsættelse - Nye undersøgelsesmuligheder for døve og hørehæmmede Siden 1. januar 2006 har Hovedstadens Sygehusfælleskab tilbudt genetisk udredning af hørenedsættelse. Udredningen foregår på

Læs mere

Sygeplejerskeuddannelsen Aalborg EKSTERN TEORETISK PRØVE MODUL 3 S09S. Dato: 02.07.2010. Kl. 09.00 12.00

Sygeplejerskeuddannelsen Aalborg EKSTERN TEORETISK PRØVE MODUL 3 S09S. Dato: 02.07.2010. Kl. 09.00 12.00 Professionshøjskolen University College Nordjylland Sygeplejerskeuddannelsen Aalborg EKSTERN TEORETISK PRØVE MODUL 3 S09S Dato: 02.07.2010 Kl. 09.00 12.00 Case: Ane Andersen er 65 år. Hun har i 40 år været

Læs mere

CENTER FOR KLINISKE RETNINGSLINJER CLEARINGHOUSE

CENTER FOR KLINISKE RETNINGSLINJER CLEARINGHOUSE Kursus for bedømmere af kliniske retningslinjer ECTS: Kurset er postgraduat og ækvivalerer 5 ECTS point ved bestået eksamen. Der udstedes eksamensbevis. Formål: Kurset giver kompetence til at fungere som

Læs mere

Om HSP (Hereditær Spastisk Paraparese)

Om HSP (Hereditær Spastisk Paraparese) Om HSP (Hereditær Spastisk Paraparese) Nedenstående artikel er oversat og gengivet med tilladelse fra Spastic Paraplegia Foundation (www.spfoundation.org) med tilføjelser om danske forhold. Index: - Hvad

Læs mere

Tanker om Ph.d.-arbejdet

Tanker om Ph.d.-arbejdet Tanker om Ph.d.-arbejdet Forskerdag i Palliation 2009 Mette Asbjørn Neergaard Afdelingslæge, ph.d., speciallæge i almen medicin man@alm.au.dk Tanker om Ph.d.-arbejdet Gode råd Mixed methods design i ph.d.-forløb

Læs mere

LÆGEVIDENSKABELIG EMBEDSEKSAMEN FASE II

LÆGEVIDENSKABELIG EMBEDSEKSAMEN FASE II Side 1 af 6 LÆGEVIDENSKABELIG EMBEDSEKSAMEN FASE II Eksamen i Genetik I (4 timer) den 14. april 2004 Opgavesættet består af 1 forside og 5 sider (2-6) med i alt 5 opgaver. Det er forbudt at medbringe enhver

Læs mere

Anlægsbærerscreening for cystisk fibrose

Anlægsbærerscreening for cystisk fibrose 20 år efter at CF-genet blev fundet, er der i Danmark stadig ikke indført tilbud om Anlægsbærerscreening for cystisk fibrose AF ERIK WENDEL, CFF Allerede i 1981 hørte CF-familiene professor Marianne Schwartz,

Læs mere

SOM DEN STORE TRUSSEL MOD LØBEBØLGEN

SOM DEN STORE TRUSSEL MOD LØBEBØLGEN LØBESKADER SOM DEN STORE TRUSSEL MOD LØBEBØLGEN KAN SKADESMÆNGDEN REDUCERES? THE FOOT PRONATION GUY... RASMUS ØSTERGAARD NIELSEN Fysioterapeut, Sundhedsfaglig kandidat, Ph.D. Post Doc på Aarhus Universitet

Læs mere

CMT klinisk udredning og behandling. Henning Andersen

CMT klinisk udredning og behandling. Henning Andersen CMT klinisk udredning og behandling Henning Andersen 57 årig kvinde Henvist fra ortopædkirurgisk afdeling obs neuromuskulær sygdom Disp : fader havde hulfødder Haft hulfødder siden barndommen. Igennem

Læs mere

Hej jeg har nålen til dig 05/13. Kiestra i lyst og nød Efter besværlig indkøring, lysner det. New Generation Sequencing Nu også i rutinen

Hej jeg har nålen til dig 05/13. Kiestra i lyst og nød Efter besværlig indkøring, lysner det. New Generation Sequencing Nu også i rutinen 05/13 Hej jeg har nålen til dig Bioanalytikere vil køre ud til patienterne //side 17 Kiestra i lyst og nød Efter besværlig indkøring, lysner det //side 08 New Generation Sequencing Nu også i rutinen //side

Læs mere

Matematikken former morgendagens satellitter

Matematikken former morgendagens satellitter Matematikken former morgendagens satellitter Michael Lumholt Adm. Direktør ml@ticra.com "Fremtidens matematik" Maj 2014, KU/DTU Page 1 Agenda Kort introduktion til TICRA Eksempler på hvordan vi arbejder

Læs mere

Vind Seminar Fredericia 4. april 2013 JOB2SEA

Vind Seminar Fredericia 4. april 2013 JOB2SEA Vind Seminar Fredericia 4. april 2013 JOB2SEA Rekrutteringsstrategi i et svært marked. Helle Drachmann Baggrund Job- & CV database Outplacement & transition management Koncern HR Selvstændig virksomhed

Læs mere

Godkender modtagelse af donation. Kontoansvarlig hospitalsperson. Centerdirektør. Centerdirektør Johannes Jakobsen. Johannes Jakobsen.

Godkender modtagelse af donation. Kontoansvarlig hospitalsperson. Centerdirektør. Centerdirektør Johannes Jakobsen. Johannes Jakobsen. Aktivitet, projektnavn Fellow/Scolarship program hospital/ Projektansvarlig hospitalsperson Kontoansvarlig hospitalsperson Godkender modtagelse af donation Type af aktivitet/projekt/ udstyr/enhed Tidshorisont

Læs mere

Implementering og effekt af kliniske retningslinjer

Implementering og effekt af kliniske retningslinjer Implementering og effekt af kliniske retningslinjer INGE MADSEN, MI. Ekstern lektor, Centeret for Kliniske Retningslinjer og lektor, VIA. SUND, Aarhus N. CENTERET FOR KLINISKE RETNINGSLINJER, Institut

Læs mere

OSAS CPAP behandling Hvor meget er nok? Ole Hilberg Lungemedicinsk afdeling Århus Universitetshospital

OSAS CPAP behandling Hvor meget er nok? Ole Hilberg Lungemedicinsk afdeling Århus Universitetshospital OSAS CPAP behandling Hvor meget er nok? Ole Hilberg Lungemedicinsk afdeling Århus Universitetshospital Evolutionen Adherence - historie Hippokrates tid: Effekten af diverse miksturer bliver noteret! 1979:

Læs mere

E-sundhedskompetence - et redskab til at skabe bro mellem borgere, patienter og vores digitale sundhedstilbud

E-sundhedskompetence - et redskab til at skabe bro mellem borgere, patienter og vores digitale sundhedstilbud E-sundhedskompetence - et redskab til at skabe bro mellem borgere, patienter og vores digitale sundhedstilbud Lars Kayser Institut for Folkesundhedsvidenskab Københavns Universitet Andre Kushniruk, Richard

Læs mere

Sundhedsområdet i et systemskifte! - Rammesættende udviklingstrends

Sundhedsområdet i et systemskifte! - Rammesættende udviklingstrends Sundhedsområdet i et systemskifte! - Rammesættende udviklingstrends Region Midtjyllands Megasatsning på erhverv-sundhed Leif Jakobsen Drivkræfter og udviklingstendenser Forventninger Teknologi Sundhedssektoren

Læs mere

DEN GODE KONSULENTPROFIL

DEN GODE KONSULENTPROFIL DEN GODE KONSULENTPROFIL C O M P L I A N C E S E R V I C E S F O R L I F E S C I E N C E S COMPLIANCE SERVICES FOR LIFE SCIENCES Kort om Genau & More: Vi er en konsulentvirksomhed der yder højt specialiseret

Læs mere

Hvor er mine runde hjørner?

Hvor er mine runde hjørner? Hvor er mine runde hjørner? Ofte møder vi fortvivlelse blandt kunder, når de ser deres nye flotte site i deres browser og indser, at det ser anderledes ud, i forhold til det design, de godkendte i starten

Læs mere

Forum for Underernæring

Forum for Underernæring Forum for Underernæring Brugerundersøgelse Region Hovedstaden: Friske data Dansk Selskab for Klinisk Ernæring: målsætning Kendte løsninger Drivkræfter endnu uden synderlig effekt: Viden Kvalitetssikring

Læs mere

31-1-2011 A-kursus Århus 2011 3T

31-1-2011 A-kursus Århus 2011 3T Standard protocols University hospitals PACS Secondary health care PACS Primary health care Generic names as T1, PD and T2 weighted. Standard positioning Basic pulse sequences: Brain 0.2 Tesla 1.5 Tesla

Læs mere

Modediagnoser og indikationsskred. IRFs stormøde Michael Lange, Head Public Affairs Scandinavian København 5. februar 2013

Modediagnoser og indikationsskred. IRFs stormøde Michael Lange, Head Public Affairs Scandinavian København 5. februar 2013 Modediagnoser og indikationsskred IRFs stormøde Michael Lange, Head Public Affairs Scandinavian København 5. februar 2013 Hvad vil jeg sige noget om! Tænker industrien i modediagnoser? Har industrien legitimitet

Læs mere

CEO Lars Kongsbak, Oktober 2011. ProInvestor Life Science seminar

CEO Lars Kongsbak, Oktober 2011. ProInvestor Life Science seminar CEO Lars Kongsbak, Oktober 2011 ProInvestor Life Science seminar Agenda Kort oversigt Stigende sundhedsudgifter = nye forretningsmuligheder Markedet for Exiqons teknologi og produkter Investerings casen

Læs mere

DANBIO. Udfordringer og barrierer når en forskningsdatabase implementeres som dagligt redskab

DANBIO. Udfordringer og barrierer når en forskningsdatabase implementeres som dagligt redskab DANBIO Udfordringer og barrierer når en forskningsdatabase implementeres som dagligt redskab Berit Schiø+z- Christensen Speciallæge i reumatologi, PhD Reumatoid artri,s Leddegigt Ca. 35.000 danskere 2/3

Læs mere

Titel. Definition. a. Kort beskrivelse og ICD-10 kode. b. Forekomst. c. Ætiologi

Titel. Definition. a. Kort beskrivelse og ICD-10 kode. b. Forekomst. c. Ætiologi Titel Definition a. Kort beskrivelse og ICD-10 kode b. Forekomst c. Ætiologi d. Patogenese Diagnose a. Symptomer b. Kliniske fund c. Parakliniske fund d. Differential diagnoser Prognostiske faktorer Behandling

Læs mere

Hvordan kan registerdata supplere klinisk forskning for at sikre bedre patientbehandling.

Hvordan kan registerdata supplere klinisk forskning for at sikre bedre patientbehandling. Hvordan kan registerdata supplere klinisk forskning for at sikre bedre patientbehandling. Frederik Nielsen, Clinical Research Medical Advisor, Novartis Copenhagen May 7 th 2015 Fælles mål For patienterne

Læs mere

Behandling af Kongenit muskeldystrofi (CMD) En familieguide

Behandling af Kongenit muskeldystrofi (CMD) En familieguide Behandling af Kongenit muskeldystrofi (CMD) En familieguide FORORD Denne familieguide er en opsummering af det internationale konsensusprogram for Kongenit muskeldytrofi, som er blevet til med hjælp fra

Læs mere

Demensdiagnoser hos yngre: Lise Cronberg Salem

Demensdiagnoser hos yngre: Lise Cronberg Salem Demensdiagnoser hos yngre: Kan vi stole på registrene? Nationalt Videnscenter for Demens Rigshospitalet Disposition Definition af yngre demente Sygdomsfordeling Forskningsprojekt Demens hos yngre < 65

Læs mere

Tværfaglige konsultationer

Tværfaglige konsultationer Tværfaglige konsultationer Professor, overlæge, dr.med. John R. Østergaard Center for Sjældne Sygdomme Børneafdelingen Aarhus Universitetshospital, Skejby Baggrund Sjældne rapport 2001 Klinik for Sjældne

Læs mere

En temperaturmåling på dansk biotek. Martin Bonde Formand for Dansk Biotek

En temperaturmåling på dansk biotek. Martin Bonde Formand for Dansk Biotek En temperaturmåling på dansk biotek Martin Bonde Formand for Dansk Biotek Agenda Introduktion En status Udfordringer mod 2020 Konklusioner Dansk Biotek organisation for danske biotekvirksomheder Startet

Læs mere

Det Medicinske Selskab i København. > Forår 2015

Det Medicinske Selskab i København. > Forår 2015 Det Medicinske Selskab i København > Forår 2015 > Sæsonprogram for forår 2015 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 3. februar kl. 20.00: Tirsdag den 3. marts kl. 20.00: Tirsdag

Læs mere

Orphan drugs fordele og ulemper

Orphan drugs fordele og ulemper Orphan drugs fordele og ulemper Hvad er et orphan drug? Hvor mange sjældne sygdomme findes der, hvor mange patienter er involveret, og hvad er de overordnede samfundsmæssige effekter af netop denne voksende

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin maj-juni 2012 Institution VoksenUddannelsesCenter Frederiksberg (VUF) Uddannelse Fag og niveau Lærer(e) Hold

Læs mere

Danish Technology Center Denmark

Danish Technology Center Denmark Danish Technology Center Denmark INDUSTRIAL Wastewater Treatment Systems A B C FiltraCon Filtration Systems FiltraSep Separation Filtration Systems FiltraFlo Filtration Flotation Systems APPLICATION

Læs mere

Ictalcare A/S. Kim Gommesen, Business Manager. Fra ide til prototype - overvågning af epilepsi patienter ved hjælp af det elektroniske plaster

Ictalcare A/S. Kim Gommesen, Business Manager. Fra ide til prototype - overvågning af epilepsi patienter ved hjælp af det elektroniske plaster 1 Ictalcare A/S Kim Gommesen, Business Manager Fra ide til prototype - overvågning af epilepsi patienter ved hjælp af det elektroniske plaster 2 Ictalcare A/S epatch konsortiet frembragte kropsbåret 24/7

Læs mere

Patientvejledning. om Jernsygdommen ARVELIG HÆMOKROMATOSE. Overlæge Nils Milman Klinisk Biokemisk Afdeling Region Sjælland, Sygehus Syd, Næstved

Patientvejledning. om Jernsygdommen ARVELIG HÆMOKROMATOSE. Overlæge Nils Milman Klinisk Biokemisk Afdeling Region Sjælland, Sygehus Syd, Næstved Seneste revision 26.05.2010 Patientvejledning om Jernsygdommen ARVELIG HÆMOKROMATOSE Overlæge Nils Milman Klinisk Biokemisk Afdeling Region Sjælland, Sygehus Syd, Næstved 1 Hvad er arvelig hæmokromatose?

Læs mere

Hvordan går det danske patienter med testis cancer?

Hvordan går det danske patienter med testis cancer? Hvordan går det danske patienter med testis cancer? Landsdækkende database for patienter med germinalcelle tumorer (GCC) Databasen dækker patienter behandlet i perioden 1984-2007 Mere end 230 variable

Læs mere

19 Genetisk udredning, rådgivning og molekylærgenetisk analyse

19 Genetisk udredning, rådgivning og molekylærgenetisk analyse 19 Genetisk udredning, rådgivning og molekylærgenetisk analyse 19.1 Resume af DBCG s anbefalinger Formål At sikre alle familier med arvelig brystkræft (cancer mammae) og æggestokkræft (cancer ovarii) tilbud

Læs mere

Kromosomtranslokationer

Kromosomtranslokationer 12 Kromosomtranslokationer December 2009 Oversat af Anja Lisbeth Frederiksen, reservelæge, ph.d. Klinisk Genetisk Afdeling, Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet

Læs mere

Journalnotater i kliniske forsøg. Dansk Selskab for GCP, 19. juni 2014 Hanne Storgaard, Clinical Quality Manager, MSD

Journalnotater i kliniske forsøg. Dansk Selskab for GCP, 19. juni 2014 Hanne Storgaard, Clinical Quality Manager, MSD Journalnotater i kliniske forsøg Dansk Selskab for GCP, 19. juni 2014 Hanne Storgaard, Clinical Quality Manager, MSD 1 Kildedata i journaler- og anvendelse i praksis MSDs retningslinjer: Krav til journaler

Læs mere

Erhvervslivets mediationsdag Siemens A/S 2015 siemens.com/answers

Erhvervslivets mediationsdag Siemens A/S 2015 siemens.com/answers Siemens tilgang til tvistløsning siemens.com/answers En af Danmarks største teknologivirksomheder Etableret i Danmark i 1893 Ansatte 2014: ca. 7.200 Heraf ~1.500 ingeniører & R&D Omsætning 2014: DKK 26,1

Læs mere

Gener, biologiske markører og valg af den rigtige behandling

Gener, biologiske markører og valg af den rigtige behandling Gener, biologiske markører og valg af den rigtige behandling Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt Vi oplever i disse år en sand revolution i udviklingen af nye teknologier

Læs mere

Totally Integrated Automation. Totally Integrated Automation sætter standarden for produktivitet.

Totally Integrated Automation. Totally Integrated Automation sætter standarden for produktivitet. Totally Integrated Automation Totally Integrated Automation sætter standarden for produktivitet. Bæredygtighed sikrer konkurrenceevnen på markedet og udnytter potentialerne optimalt. Totally Integrated

Læs mere

Gener, biologiske markører og valg af den rigtige behandling. Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt

Gener, biologiske markører og valg af den rigtige behandling. Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt Gener, biologiske markører og valg af den rigtige behandling Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt Vi oplever i disse år en sand revolution i udviklingen af nye teknologier

Læs mere

Information Systems ICT. Welcome to. Autumn Meeting Oct 2013, Copenhagen(DK)

Information Systems ICT. Welcome to. Autumn Meeting Oct 2013, Copenhagen(DK) Information Systems ICT Welcome to Autumn Meeting Oct 2013, Copenhagen(DK) Agenda Autumn Meeting 2013 Thursday 24:th of October 10:00 Velkomst. Status fra formanden og gennemgang af program for høstmødet

Læs mere

Svine-MRSA i RegionHovedstaden MRSA Knowledge Center Department of Clinical Microbiology Hvidovre Hospital University of Copenhagen Denmark

Svine-MRSA i RegionHovedstaden MRSA Knowledge Center Department of Clinical Microbiology Hvidovre Hospital University of Copenhagen Denmark Svine-MRSA i RegionHovedstaden MRSA Knowledge Center Department of Clinical Microbiology Hvidovre Hospital University of Copenhagen Denmark Helle Neustrup, Heidi Meiniche, Ulla Kehlet, Mette Bartels, Henrik

Læs mere

Copenhagen, Copenhagen, Denmark; Clinical Biomechanics, University of Southern Denmark, Odense, Denmark. Frederiksberg, Copenhagen, Denmark.

Copenhagen, Copenhagen, Denmark; Clinical Biomechanics, University of Southern Denmark, Odense, Denmark. Frederiksberg, Copenhagen, Denmark. The Copenhagen Hip and Groin Outcome Score (HAGOS): development and validation according to the COSMIN checklist K Thorborg, 1 P Hölmich, 1 R Christensen, 2,3 J Petersen, 1 EM Roos, 2 1 Arthroscopic Centre

Læs mere

Userguide. NN Markedsdata. for. Microsoft Dynamics CRM 2011. v. 1.0

Userguide. NN Markedsdata. for. Microsoft Dynamics CRM 2011. v. 1.0 Userguide NN Markedsdata for Microsoft Dynamics CRM 2011 v. 1.0 NN Markedsdata www. Introduction Navne & Numre Web Services for Microsoft Dynamics CRM hereafter termed NN-DynCRM enable integration to Microsoft

Læs mere

ALPE Essential - Mermaid Care A/S

ALPE Essential - Mermaid Care A/S Tænk hvis Tænk hvis du selv kunne udføre lungefunktionsundersøgelser målrettet anæstesiens udfordringer og problemstillinger omkring patientens præoperative oxygeneringsevne? Traditionelle lungefunktionsundersøgelser

Læs mere

BEHANDLINGS- VEJLEDNING VED SOCIAL FOBI I COLLABRI

BEHANDLINGS- VEJLEDNING VED SOCIAL FOBI I COLLABRI BEHANDLINGS- VEJLEDNING VED SOCIAL FOBI I COLLABRI Behandlingsvejledning ved depression i Collabri Denne behandlingsvejledning vedr. social fobi i Collabri er udarbejdet med baggrund i Sundhedsstyrelsens

Læs mere

Anvendelse af genetiske algoritmer til simulering af biologiske systemer

Anvendelse af genetiske algoritmer til simulering af biologiske systemer Anvendelse af genetiske algoritmer til simulering af biologiske systemer Projekt udarbejdet af: Glennie Helles Datalogisk vejleder: Peter Johansen Biologisk assistance: Leif Søndergaard Indholdsfortegnelse

Læs mere

AM:2014 Mellem forskningsformidling og facilitering - et indblik i rejseholdets metode

AM:2014 Mellem forskningsformidling og facilitering - et indblik i rejseholdets metode AM:2014 Mellem forskningsformidling og facilitering - et indblik i rejseholdets metode Inge Larsen, VFAs rejsehold Det sagde deltagerne på WAW Det har en kæmpe betydning hvordan viden bliver formidlet

Læs mere

DLCG/DLCR Årsmøde 2013

DLCG/DLCR Årsmøde 2013 DLCG/DLCR Årsmøde 2013 DLCG/DLCR Årsmøde 2013 Torben Riis Rasmussen Siden sidste Årsmøde DLCG s mangeårige formand, Torben Palshof, måtte fratræde af helbredsmæssige årsager. Siden sidste Årsmøde DLCG

Læs mere

Gonadebeskyttelse og valg af projektion

Gonadebeskyttelse og valg af projektion Gonadebeskyttelse og valg af projektion som dosisreducerende metoder til ovarierne ved konventionel røntgen af columna lumbalis. Benjamin Gjerrild Nielsen, radiograf Radiologisk Afd. - Regionshospitalet

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

KPMG Global Healthcare. KPMG Healthcare. "A perfect storm in global healthcare" 3 Thought leadership - veje til successfuld implementering af ehealth

KPMG Global Healthcare. KPMG Healthcare. A perfect storm in global healthcare 3 Thought leadership - veje til successfuld implementering af ehealth KPMG Global Healthcare 1 2 KPMG Healthcare "A perfect storm in global healthcare" 3 Thought leadership - veje til successfuld implementering af ehealth 1 KPMG's globale healthcare team Global 1. Global

Læs mere

Introduktion til NNIT

Introduktion til NNIT Introduktion til NNIT IT-kontraktsnetværk 18. august 2014 PUBLIC Kort fortalt En af Danmarks fire største leverandører af itservices Vi leverer udvikling, implementering og drift til life sciences, finanssektoren,

Læs mere

Medicinske komplikationer efter hofte- og knæalloplastik (THA and KA) med fokus på trombosekomplikationer. Alma B. Pedersen

Medicinske komplikationer efter hofte- og knæalloplastik (THA and KA) med fokus på trombosekomplikationer. Alma B. Pedersen Medicinske komplikationer efter hofte- og knæalloplastik (THA and KA) med fokus på trombosekomplikationer Alma B. Pedersen Outline Introduction to epidemiology of THA and KA Epidemiology of medical complications:

Læs mere

To set new standards of lifting and transportation equipment for wind turbine components. Our product groups

To set new standards of lifting and transportation equipment for wind turbine components. Our product groups To set new standards of lifting and transportation equipment for wind turbine components. Our product groups Embracing the full life cycle of the wind turbine Liftra develops and supplies services to

Læs mere

BEHANDLINGS- VEJLEDNING VED PANIKANGST I COLLABRI

BEHANDLINGS- VEJLEDNING VED PANIKANGST I COLLABRI BEHANDLINGS- VEJLEDNING VED PANIKANGST I COLLABRI Behandlingsvejledning ved panikangst i Collabri Denne behandlingsvejledning vedr. panikangst i Collabri er udarbejdet med baggrund i Sundhedsstyrelsens

Læs mere

Håndhygiejne: Nye løsninger på et gammelt problem?

Håndhygiejne: Nye løsninger på et gammelt problem? Håndhygiejne: Nye løsninger på et gammelt problem? v/ Professor, overlæge dr.med. Jens Kjølseth Møller Klinisk mikrobiologisk afdeling, Sygehus Lillebælt, Vejle Sygehus Hvad ved vi om Håndhygiejne og Adfærd?

Læs mere

Komorbiditet og kræftoverlevelse: En litteraturgennemgang

Komorbiditet og kræftoverlevelse: En litteraturgennemgang Komorbiditet og kræftoverlevelse: En litteraturgennemgang Mette Søgaard, Klinisk Epidemiologisk Afdeling Aarhus Universitetshospital Danmark E-mail: mette.soegaard@ki.au.dk 65+ årige runder 1 million i

Læs mere

HIMSS EMRAM Healthcare Information and Management Systems Society Electronic Medical Record Adoption Model Claus Ehlers, CPHIMS, CISA, CIPP

HIMSS EMRAM Healthcare Information and Management Systems Society Electronic Medical Record Adoption Model Claus Ehlers, CPHIMS, CISA, CIPP HIMSS EMRAM Healthcare Information and Management Systems Society Electronic Medical Record Adoption Model Claus Ehlers, CPHIMS, CISA, CIPP C O N N E C T I N G B U S I N E S S & T E C H N O L O G Y Måling

Læs mere

7 Marts 2011 Branding af din by og din kommune

7 Marts 2011 Branding af din by og din kommune 7 Marts 2011 Branding af din by og din kommune Professor Majken Schultz Copenhagen Business School Hvad er et Brand? The American Marketing Association definerer et brand som Et navn, et udtryk, et symbol,

Læs mere

Rettelse nr. / Correction no. 153-166

Rettelse nr. / Correction no. 153-166 20. marts 2015 27. årgang SØKORTRETTELSER 11 DANISH CHART CORRECTIONS 2015 Rettelse nr. / Correction no. 153-166 Kort / Chart Rettelse nr. / Correction no. Kort / Chart Rettelse nr. / Correction no. 103

Læs mere

Erfaringer med GUDP ansøgninger og projekter - hvad skal der til?

Erfaringer med GUDP ansøgninger og projekter - hvad skal der til? CENTRE OF EXPERTISE FOR FOOD MICROBIOLOGY Erfaringer med GUDP ansøgninger og projekter - hvad skal der til? Anne Elsser-Gravesen ISI Protection Januar 2015 follow us on w w w. i s i f o o d p r o t e c

Læs mere

Rettelse nr. / Correction no. 351-364

Rettelse nr. / Correction no. 351-364 26. juni 2015 27. årgang SØKORTRETTELSER 25 DANISH CHART CORRECTIONS 2015 Rettelse nr. / Correction no. 351-364 Kort / Chart Rettelse nr. / Correction no. Kort / Chart Rettelse nr. / Correction no. 93

Læs mere