Ny fauna fundet i dansk grundvand og i danske drikkevandsanlæg

Størrelse: px
Starte visningen fra side:

Download "Ny fauna fundet i dansk grundvand og i danske drikkevandsanlæg"

Transkript

1 D A N M A R K S O G G R Ø N L A N D S G E O L O G I S K E U N D E R S Ø G E L S E R A P P O R T / 50 Ny fauna fundet i dansk grundvand og i danske drikkevandsanlæg Beskrivelse af faunaen og DNA karakterisering af rentvands-, overfladevands- og grundvandsdyr Walter Brüsch, Line Volkers Fredslund, Tina Bundgaard Bech & Carsten Suhr Jacobsen DE N A T I O N A L E G E O L O G I S K E U N D E R S Ø G E L S E R F O R D A N M A R K O G G R Ø N L A N D, K L I M A -, E N E R G I - O G B Y G N I N G S M I N I S T E R I ET

2 2 Indholdsfortegnelse Konklusion 5 Diskussion og sammendrag 6 Smådyr/fauna i vandforsyningsanlæg... 6 Bakterielle undersøgelser og protozoer... 8 DNA-analyser... 8 DNA i sedimentprøver fra vandindvindingsanlæg... 8 DNA i prøver fra boringer Kan eller skal man fjerne krebsdyrene? Indledning 12 Dyr i grund- og drikkevand 13 Geokemiske forhold i drikke- og grundvand 16 Iltindhold i grundvand fra grundvandsovervågningen Indhold af organisk stof i drikkevand Organisk stof i grundvand Mulig udfyldning af porøsitet i grundvandsmagasiner med organisk stof Indsamling af dyr og pellets og sedimentprøver 23 Beskrivelse af tankanlæg København Odense Asserbo Bakterielle undersøgelser og tælling af Protozoer i vandtankens biofilm 26 Baggrund Bakterielle undersøgelser Metode til tælling af protozoer og resultater Sediment og pellets i tankanlæg Fordeling af pellets Krybe og hvilespor Kalkflager Makrofauna 40 Asellus aquaticus Kan man fjerne krebsdyrene? Størrelsesfordeling Asellus aquaticus Asellus aquaticus, indsamlet andre steder i landet Andre dyr DNA fra Asellus aquaticus 56 DNA-analyser Prøvetagning G E U S 2

3 3 DNA-ekstraktion Analyse af Asellus aquaticus ribosomale 18S DNA-sekvenser Analyse af dyrenes mitochondrielle CO1-sekvenser Sedimentprøver fra vandindvindingsanlæg 62 Prøver fra Fyn Prøver fra Sjælland DNA i sedimentprøver udtaget fra boringer ved Marbjerg, Strø og Attemose 65 Prøvetagning i boringer ved Marbjerg Resultater, Marbjerg Prøvetagning i boringer ved Strø og Attemose Resultater Strø og Attemose Konklusion, sedimentprøver fra boringer Udvikling af analysemetode for DNA i sedimentprøver 69 Udvikling af ny analysemetode Udvikling af Asellus aquaticus specifikke primere Principperne bag kvantitativ PCR (qpcr) Udvikling af DNA standardkurve qpcr opformering af DNA fra sedimentprøver med SYBR Green fluorescens.. 73 Resultat af qpcr opformering af DNA fra sediment prøver (SYBR Green) qpcr opformering af DNA fra sediment prøver med Asellus-probe fluorescens 77 Konklusion for udviklingen af assay til qpcr opformering- og detektion af Asellus aquaticus DNA fra sediment prøver (SYBR Green og Probe qpcr) Referencer 81 Bilag 1: Projektbeskrivelse 84 Bilag 2: Vejledning i udtagning af sediment. 85 Bilag 3: Sedimentprøver fra vandindvindingsanlæg 86 Vandcenter Syd, Fyn Udtagning af sedimentprøver Hovedværk, Odense Lindved værket Lundeværket Delkonklusion, sediment fra klaringstanke på vandforsyningsanlæg på Fyn HOFOR. Sedimentprøver udtaget af Hovedstadsområdets Forsyningsselskab SØSØ EF Æbelholt vakuum Attemose st Strø vakuum beholder Slangerup Filtersediment SØSØ EF SØSØ EF Attemose vakuum G E U S 3

4 4 Bogøgård vakuum SØSØ EF SØSØ EF Delkonklusion, sedimentprøver i vandindvindingsanlæg, HOFOR Bilag 4: Fund af grundvandsdyr DGUnr , TREFOR Vand 95 G E U S 4

5 5 Konklusion Denne rapport beskriver eksistensen af en ny rentvandsfauna i København og Odense, HOFOR og Vandcenter Syd vandforsyninger. Udbredelsen af faunaens største dyr, Asellus aquaticus, er kortlagt og en ny metode til detektion af DNA fra dette dyr er udviklet med succes. Bakterielle undersøgelser viser, at der ikke i forbindelse med de undersøgte sediment- og faunaprøver er fundet kendte sundhedsskadelige bakterier, og at faunaen tilsyneladende er i stand til at omsætte det organiske materiale, der findes i rentvandssystemerne. Faunaen lever under helt ekstreme forhold i et miljø med meget lav næringsstof tilførsel, i totalt mørke og ved temperaturer på ca º C året rundt. Disse forhold svarer til de vilkår tilsvarende dyr lever under i grundvandsmiljøer i både Danmark og Europa, hvor disse dyr overlever i vand med et meget lavt iltindhold. De største dyr, Asellus aquaticus, afgræsser den naturlige biofilm af bakterier, svampe og protozoer, der udvikles på indersiden af rør og i tanksystemerne, og dyrene er på denne måde med til at renholde drikkevandssystemerne. Faunaen har formodentlig tidligt etableret sig i drikkevandssystemerne på Sjælland og i Odense samt formodentlig andre steder i landet. I Odense har eksistensen af faunaen været kendt i ca. 30 år, uden der er opstået kvalitetsmæssige eller bakterielle problemer, ligesom der ikke er konstateret bakterielle problemer i forbindelse med erkendelsen af faunaen i København. Efter aftale med HOFOR og Vandcenter Syd har GEUS udviklet en metode til detektion af DNA fra Asellus aquaticus i sedimentprøver fra rørsystemer/hydroforer, fra klaringstanke, fra jernfiltrene på vandværkerne og fra sediment fra bunden af boringer. DNA metoden kan detektere DNA-spor fra dyrene i de sedimentprøver der udtages, selv om der ikke er fysiske spor, såsom afrevne kropsdele eller fecal pellets til stede. Metoden er særdeles følsom og har påvist DNA spor i næsten alle sedimentprøver, hvor der er tilstrækkeligt sedimentmateriale. Der er fundet spor af DNA i boringer, i hydroforer mellem boringerne og vandværkerne og i vandværkerne. DNA bestemmelse af sediment prøver fra bunden af boringer tilhørende HOFOR på Sjælland viste, at dyrene lever i grundvandsmagasinerne, og at dyrene i vandforsyningsanlæggene formodentlig stammer fra de magasiner, hvorfra grundvandet indvindes. DNA fra Asellus aquaticus forekommer i alle dele af vandforsyningssystemerne: fra grundvandsmagasiner via sandfiltre, højdebeholdere og til andre dele af vandforsyningsanlæggene. En sammenligning af DNA fra de forskellige undersøgte populationer der er indsamlet i København, Odense, Århus, Tølløse kalkkilde og fra overfladevand viste, at populationerne på baggrund af små forskelle i deres DNA kunne skelnes fra hinanden. I Vandcenter Syds vandforsyning og i en enkelt lokalitet med overfladevand, levede flere forskellige populationer, der formodentlig har forskellig oprindelse. G E U S 5

6 6 Diskussion og sammendrag Smådyr/fauna i vandforsyningsanlæg Denne rapport beskriver eksistensen af en fauna i drikkevand fra HOFOR, Vandcenter Syd og andre vandforsyninger. Oprindelsen af de største krebsdyr i denne drikkevandsfauna, Asellus aquaticus, er forsøgt vurderet vha. analyser af DNA fra de indsamlede dyr. Fauna består af små krebsdyr tilpasset de helt specielle og ekstreme forhold der findes i vandforsyningernes ledningsnet og vandbeholdere. Her overlever dyrene i vand med et ganske lille næringsindhold, i totalt mørke og i 8-10 º C koldt vand. Figur 1 viser, hvor i et skematisk vandværkssystem disse dyr kan findes, og hvor der pt er fundet DNA fra Asellus aquaticus. Figur 1. Forekomst og fund af Asellus aquaticus og Asellus aquaticus DNA i et vandværkssystem. Krebsdyret er fundet i højdebeholdere, i ledningssystemer, i skyllevand fra det biologisk aktive jernfiler og i højtliggende grundvand. Asellus aquaticus DNA (røde pile) er fundet i sediment fra klaringstanke for skyllevand, i filtre, i vakuumbeholdere placeret mellem boringer og vandværk og i højdebeholdere. Asellus aquaticus er fundet i gravede brønde i højtliggende grundvandsmagasiner, og der er fundet DNA fra Asellus i boringer. Vandværksfigur fra Asellus aquaticus, bedre kendt som vandbænkebider, er almindelige i dansk og europæisk overfladevand (såsom vandløb og søer), men Asellus aquaticus er også fundet i dansk og europæisk grundvand. I overfladevand kan krebsdyrene blive op til ca mm lange, og dyrene har oftest en kraftig mørkebrun pigmentering. I modsætning hertil er Asellus aquaticus fra grundvand og ledningssystemerne i eksempelvis København uden eller næsten uden pigment, og dyrene bliver sjældent større end 10 mm. Nogle af de indsamlede Asellus aquaticus fra vandforsyningssystemet holdes i et akvarium med rigelig næringstilførsel, varmt vand og masser af ilt. Efter ca. 1,5 år er Asellus aquaticus stadig af samme størrelse og har ikke dannet yderligere pigmentering. GEUS har tidligere gennemført et projekt, hvor de første danske grundvandsdyr, herunder Asellus aquaticus blev indsamlet i højtliggende grundvand (Brüsch 2003). Grundvandsdyr er generelt tilpasset et miljø, der minder om det miljø, der findes i højdebeholdere og i ledningssystemet for drikkevand: stabil vand temperatur på 8 10 o C, fuldstændigt mørke, næsten ingen næring og få dyr. Ægte stygobionter/grundvandsdyr er hvide, blinde, uden pigmenter og ofte med en lille tynd langstrakt krop der er tilpasset dyrenes levesteder. G E U S 6

7 7 Grundvandsdyr har generelt et lavt stofskifte og lever længere end tilsvarende arter i vandløb. Asellus aquaticus er i stand til at leve i vand med ekstremt lave ilt koncentrationer uden at tage varig skade. Dette betyder, at arten vil kunne overleve i både højtliggende og dybtliggende grundvandsmagasiner. I overfladevand spiser Asellus aquaticus stort set alle typer organisk materiale. De fundne Asellus aquaticus i vandforsyningerne afgræsser biofilm på vanddækkede flader i tankanlæg og på indersiden af vandrør. De græssende Asellus aquaticus og den øvrige fauna omsætter det organiske stof, der findes i højdebeholderne. Faunaen har derfor formodentlig stor betydning ved nedbrydning og omsætning af organisk stof, mulige skadelige stoffer, samt ved deres græsning af bakterier og andre organismer i vandforsyningernes biofilm. Faunaen er mere righoldig omkring tilløbene i højdebeholderne. Her lever en særlig fauna i og på det materiale og sediment der aflejres, når indløbsvandet fra rørsystemet med høj fart ledes ind i en stor beholder med næsten stillestående vand. Indsamles det bundfældede materiale, findes en righoldig fauna, bla. bestående af juvenile Asellus aquaticus, men også af mange øvrige arter. I den tyske vandforsyning anvendes både grund- og overfladevand, og en opgørelse af antal organismer viser, at vand ved afgang fra vandværk indeholder et medianantal på ca dyr/m3, hvis vandværkets råprodukt er infiltreret og renset/behandlet overfladevand. Anvendes grund- eller kildevand til vandværkets drikkevandsproduktion findes ved afgang fra vandværk et medianantal på ca. 41 til 195 dyr/m3, altså mindre end 10% af antallet i drikkevand, indvundet fra overfladevand (Limno-Plan, 2001). I Danmark er der ikke lavet tilsvarende dækkende opgørelser over antallet af dyr i vandforsyningerne. I de undersøgte Københavnske tankanlæg er alle synlige små flokke Asellus aquaticus indsamlet, samt en del løsgående i pytter. I den tank, hvor der blev samlet flest Asellus aquaticus blev der indsamlet omkring levende Asellus aquaticus, men vi vurderer, at der kan have været mindst fire gange flere dyr i småpytter på tankbunden. Da en tank rummer ca m 3 vand, vil et tilsvarende dansk tal for tætheden af dyr lande omkring 0,1 dyr/m 3, altså meget lavere end de tyske tal. Det meget lavere tal kan skyldes, at nogle dyr bliver skyllet ud, når det sidste vand bliver ledt ud af tanken gennem en bundventil. Den mest plausible forklaring er dog, at indholdet af organisk stof i vandet er lille, og at der derfor kun er ganske lidt næring tilstede i form af biofilm bevoksede overflader. Det må derfor forventes, at antallet af Asellus aquaticus i forhold til vandmængden er ganske lille i de fleste vandværkers ledningssystemer i Danmark, også selv om Asellus aquaticus tilsyneladende er i stand til at klare sig under helt ekstreme forhold. Asellus aquaticus i Københavnsområdets drikkevand er som nævnt gennemsigtige eller kun svagt pigmenterede. Da krebsdyrene ydermere er immobile i tømte højdebeholdere kræves nogen øvelse i at få øje på dyrene. Det mest iøjnefaldende træk, er en række lyse pletter under dyrenes gennemsigtige ryg og haleplader, der reflekterer lys. Når vandet tømmes ud af et tanksystem, vil de bundlevende dyr søge hen mod småpytter eller områder, hvor der strømmer lidt vand fra utætte ventiler. Dette betyder, at Asellus aquaticus kan findes i små klynger ved tilløbsventilerne (figur 1). Omkring tilløbene findes mange dyr, mens antallet af dyr falder des længere man bevæger sig ned mod beholdernes fraløb. Dette hænger sammen med, at biofilmen på tankens overflader er mere veludviklet tæt ved tilløbet. Da Asellus aquaticus producerer karakteristiske stribede pellets, er det alene ved hjælp af disse let vurdere, om dyrene har været til stede i et rørsystem. En anden enkel metode til er, at lede efter de flugtspor dyrene efterlader i sedimentet, når tanken tømmes for vand. G E U S 7

8 8 Bakterielle undersøgelser og protozoer Der blev ikke konstateret patogene bakterier i indsamlede Asellus aquaticus eller i det organiske materiale fra de københavnske højdebeholdere, der blev testet, og tilsvarende blev der ikke fundet bakterier i to Asellus aquaticus fra TREFOR Vand. Biofilm prøver fra tankanlægget viste, at antallet af dyrkbare bakterier faldt gennem tanken fra ca. 26 millioner/gram biofilm ved tilløbet/indløbet over fire millioner i midten af tanken og til to millioner/gram biofilm ved tankens fraløb. Der er således en indikation af, at koncentrationen af næringsstoffer til at understøtte vækst af bakterier er højest ved tankens tilløb. Protozotællingerne viste, at der fandtes protozoer i et antal > pr. g. biofilm. I højest antal fandtes små heterotrofe flagellater og små nøgne amøber, hvilket svarer overens med andre undersøgelser af biofilm. I alle biofilm observerede vi protozoer tilhørende de fire overordnede grupper af protozoer: flagellater, nøgne amøber, skalbærende amøber og ciliater hvilket beviser tilstedeværelsen af et veludviklet mikrobielt samfund. Når antallet af protozoer er så højt, sammenlignet med antallet af dyrkbare bakterier, tyder det på en meget hurtig stof-omsætning i biofilmen. Samtidig vil der være en del bakterier tilstede, der ikke er dyrkbare på en næringsrig agar plade, og som derfor ikke tælles med i vores analyser. DNA-analyser Asellus aquaticus fra forsyningssystemer i København, Odense og Århus, fra en kilde i Tølløse og fra en fynsk dam blev anvendt til at udvikle en robust metode til DNA baseret karakterisering af individuelle populationer. Dernæst udviklede vi en analysemetode, der ved hjælp af tre genetiske markører, kan bruges til sikker påvisning af DNA fra Asellus aquaticus i sediment fra filtre eller rørsystemer. DNA undersøgelsen viste, at der i de københavnske højdebeholdere er tale om én enkelt population, hvor dyrene har ens arvemateriale. Dyrene fra Odense kan opdeles i to individuelle populationer, der formentlig har forskellige oprindelser, fx fra to forskellige lokaliteter, hvor dyrene er indvandret i drikkevandssystemet ved to uafhængige hændelser. Hos Vandcenter Syd har dyrene været kendt i ledningssystemet i mindst 30 år. Dammen på Fyn indeholder tre forskellige populationer. Dette er interessant, fordi der er tale om en gravet dam, hvor Asellus aquaticus hurtigt indvandrede. Da dyrene kan stamme fra tre indvandringshændelser/lokaliteter, kan det ikke udelukkes at en hændelse (måske den første) stammer fra Asellus aquaticus, der har levet i højtliggende grundvand omkring dammen, mens de andre indvandringer kan skyldes indslæbning fx via fugle. Der kan skelnes detaljeret mellem de forskellige populationer ved hjælp af vores DNA analyser, men de kan ikke anvendes til at fastslå oprindelsen af en population i et vandforsyningssystem (eks. overfladevand vs. grundvand). Sammenligningen af DNA fra dyr indsamlet i overfladevand, kilder/grundvand samt fra vandforsyningerne viser, at alle dyrene er nært beslægtede, idet de kun adskilles af få enkeltmutationer i arvematerialet. Såfremt de forskellige slægtskaber ønskes vurderet nærmere, bør der gennemføres yderligere undersøgelser, hvor der fokuseres på andre dele af dyrenes arvemateriale, samt udføres en udvidet indsamling af dyr fra mulige oprindelses-lokaliteter. Kun derigennem kan populationernes oprindelse sandsynliggøres. DNA i sedimentprøver fra vandindvindingsanlæg Der blev indsamlet sedimentprøver på 11 lokaliteter i HOFOR s indvindingssystem og tre prøver i fynske klaringstanke (se tabel 1). Prøverne blev anvendt til at ekstrahere total DNA fra sedimentet, med henblik på at påvise tilstedeværelse af Asellus aquaticus DNA. G E U S 8

9 9 Analyserne viste, at alle prøver indeholdt DNA fra Asellus aquaticus. De fleste dog i små mængder, svarende til DNA fra under eller omtrent ét dyr pr. kg filtersediment. Undtaget herfra er tilbageskylssediment fra et vandværk tilhørende Vandcenter Syd på Fyn, der indeholdt DNA svarende til op til 32 dyr pr kg sediment. Udviklingen af den ny metode har været en succes, idet det er lykkedes at udvikle et nyt assay med høj specificitet og høj sensitivitet. Assayet kan detektere DNA ned til en mængde svarende til et dyr pr. 100 kg sediment. Da det formentlig i høj grad er DNA fra dyrenes tarmkanal som udtrækkes (epitelceller), er metoden langt mere sikker, end hvis metoden alene byggede på DNA fra kropsdele. Dette skyldes, at et levende dyr producerer pellets gennem et helt livsforløb. DNA i disse pellets nedbrydes langsomt på grund af den lave temperatur på ca o C i vandværksledninger og grundvand. Et enkelt dyr vil derfor kunne efterlade sig mange DNA spor, der vil kunne findes i sediment selv i meget fortyndet form. Lokalitet DNA svarende til antal Asellus pr kg* Asellus hel /fragment Prøve beskrivelse Asellus pellets Slangerup filtersediment Sjælland 0,16 nej muligvis ja Strø Vakuum beholder Sjælland 0,03 nej nej nej Attemose St. 1 Sjælland 0,1 nej nej ja Andre pellets Æbelholt Vak-beh Sjælland 0,12 muligvis muligvis ja SØSØ EF 2 Sjælland 1,42 nej nej Slidte pellets SØSØ EF 3 Sjælland 0,38 nej nej muligvis SØSØ EF 5 Sjælland 0,42 nej nej nej SØSØ EF 7 Sjælland 2,08 nej muligvis ja SØSØ EF 8 Sjælland 0,84 muligvis en del nedbrudte? ja Bogøgård Vakuum beh Sjælland 0 Attemose Vakuum beh Sjælland 0 rent vand Lindved værket relativt nyt Fyn 32,35 nej nej ja, få Lunde værket, nyt Fyn 0,31 muligvis nej få Odense Hovedværk gammelt Fyn 0,32 ja muligvis ja Tabel sedimentprøver indsamlet fra vakuum beholdere mellem råvandsboringer og vandværker, jernfiltre og klaringstanke. * DNA fra Asellus i sedimentprøver, omregnet til gennemsnitlig antal dyr pr kg sediment. De tre prøver fra Fyn er samlet i klaringstanke, hvor jern fra jernfiltrene bundfældes før restvandet bortledes. 6 af de undersøgte prøver indeholder ikke filter grus og stammer fra vakuum beholdere med bundfaldet materiale. Se også bilag 3. Tabel 1 viser, at der er fundet DNA i alle udtagne prøver, med tilstrækkeligt materiale til at foretage en DNA ekstraktion. DNA blev også fundet i de prøver, hvor det ikke var muligt visuelt at finde levende dyr, fragmenter fra disse eller Asellus aquaticus pellets. Faktisk blev der kun fundet fragmenter fra Asellus aquaticus i én prøve, mens der i fire prøver blev fundet nedbrudte rester eller slidte pellets muligvis produceret af Asellus aquaticus. G E U S 9

10 10 De undersøgte prøver er udtaget på selve vandværkerne, og i beholdere før vandværkernes filtre (vakuum beholdere). Dette viser, at DNA kan stamme fra dyr der lever i de øvre dele af de grundvandsmagasiner, hvorfra værkernes via deres indvindingsboringer pumper råvand op. Man kan forestille sig, at Asellus aquaticus søger hen mod de boringer, hvor der er en smule ilt øverst i indtaget, for der at afgræsse biofilmen i boringens indre del. Da dyrene og særligt de juvenile kan overleve næsten anaerobe forhold vil dyrene lejlighedsvis kunne transporteres fra boringerne til vandværkernes beluftningsanlæg og derfra vandre videre ud i ledningssystemerne. DNA i prøver fra boringer Der blev udtaget sediment prøver fra bunden af en række boringer på Sjælland ved tre forskellige lokaliteter, hvorfra der blev ekstraheret DNA. Da Asellus aquaticus formodentlig forekommer meget spredt i grundvandsmagasinerne, var det ikke muligt at kvantificere antal dyr pr gram sediment opsamlet fra bunden af boringerne i de undersøgte sedimentprøver udtaget fra bunden af boringer ved Marbjerg, Strø og Attemose, da detektionsgrænsen var for høj. Der blev dog påvist DNA fra Asellus aquaticus i to boringer beliggende i Strø og Attemose, men det var ikke muligt at kvantificere antallet per gram sediment. Asellus aquaticus kan derfor forekomme i boringer, hvor dyrene lever i det grundvand som boringernes indtag er sat i. Der blev således fundet DNA i både boringer samt fra vakuumbeholdere efter boringerne i både Strø og Attemose (tabel1). Kan eller skal man fjerne krebsdyrene? En undersøgelse af både tilløbsrør og afløbsrør i højdebeholderne viser, at krebsdyrene findes begge steder. Dette betyder, at det ikke er muligt at fjerne disse dyr fra vandforsyningssystemet, selvom man har haft held til at fjerne dyrene i selve tanken. Det vil ikke kunne lades sig gøre at fjerne bestanden fra ledningsnettet, med mindre man behandler vandet i ledningsnettet med insektgifte eller med CO 2 (Limno-Plan, 2001, GWF-Wasser, 2009). Behandling med klor eller ozon har ingen effekt på disse dyr, med mindre der anvendes endog meget høje koncentrationer, mens fysiske indgreb som rørspulinger ikke har blivende effekt. I Tyskland arbejdes der også med at fjerne fødegrundlaget, dvs indholdet af organisk stof i drikkevandet, der kan være indvundet fra overfladevand (Limno-Plan, 2001). I Tyskland er der beskrevet voldsom opblomstring af faunaer i ledningsnettet, som skaber både bakteriologiske og æstetiske problemer. Det er ikke en farbar vej i Danmark at nedsætte indholdet af organisk stof i drikkevand, da der normalt kun indvindes grundvand med et lille indhold af opløst organisk stof. En anden metode som nævnes I de tyske undersøgelser, er at udskifte gamle rørsystemer med glatte rør, der ikke danner samme grobund for biofilm. Den mindre mængde biofilm betyder, at antallet af dyr bliver mindre, men dyrene forsvinder ikke fra rørsystemerne. I Tyskland er der firmaer, der har specialiseret sig i at fjerne Asellus aquaticus fra tankanlæg og ledningssystemer ved hjælp at CO 2, der paralyserer dyrene (GWF-Wasser, 2009). Efter tilsætning af kulsyren kan Asellus aquaticus skylles ud af rørsystemerne. Dette er formodentlig heller ikke en farbar vej for de danske vandværker, fordi mange værker stadig har jernrør I ledningssystemet, der vil angribes af kulsyren. Jernrørene er normalt beskyttet mod gennemtæring af den biofilm, der dækker de indre dele af rørsystemerne. Fjernede man fødegrundlaget (biofilmen), ville rørsystemerne hurtigt blive gennemtæret af drikkevandets høje iltindhold. G E U S 10

11 11 Ifølge Limno-Plan (2001) har forekomsten af Asellus har været kendt helt fra 1850 erne i Tyskland, og man har gennem lang tid undersøgt både grundvands- og drikkevandsfaunaer (Bork und Hahn, 200?, Stein et al, 2009, Griebler et al, 2010). Nogle mener, at grundvandsdyrene som kan findes i ledningsnettet i Tyskland, er en fordel for vandkvaliteten (GWF-Wasser, 2009) og at dyrene kan anvendes som en bioindikator for rent vand. Argumentet er, at denne fauna altid har eksisteret i grundvandsmagasinerne, og at vandet siver ned gennem biologisk aktive jordlag, hvor bakterier og fauna fjerner opløste stoffer, patogene bakterier samt vira. Grundvandfaunaen sikrer derfor muligheden for at indvinde rent grundvand hvor uønskede stoffer er fjernet, og det er ganske ufarligt at denne bemærkelsesværdige fauna findes i moderate mængder i vandforsyningssystemerne, hvor faunaen snarere er et sundhedstegn. G E U S 11

12 12 Indledning Hovedstadsområdets Forsyningsselskab, HOFOR, tidligere Københavns Energi, KE, kontaktede i marts 2009 GEUS for at diskutere et fund af krebsdyr i én af HOFOR s højdebeholdere. En opmærksom og observant medarbejder havde observeret en klynge små krebsdyr på bunden af en højdebeholder i forbindelse med rengøring og renovation af tanken. HOFOR kontaktede GEUS, fordi GEUS gennem 10 år har undersøgt og fundet grundvandsdyr i højtliggende grundvand på Sjælland og ofte holdt foredrag om bl.a. grundvandsdyr. HOFOR og GEUS indledte efterfølgende et samarbejde om at undersøge denne ny fauna og konsekvenserne af dennes tilstedeværelse i tanksystemet. I løbet af få dage blev de bakterielle og andre forhold undersøgt, mens HOFOR kontrollerede vandkvalitet uden at finde unormale forhold. I takt med at HOFOR tømte en række højdebeholdere i forbindelse med en større renovering af beholder anlægget blev disse anlæg og den ny drikkevandsfauna kortlagt. Under dette forløb blev GEUS opmærksom på at Sarah Christensen fra DTU, var i gang med at kortlægge en tilsvarende fauna i vandledningssystemerne i og omkring Odense for Vandcenter Syd (tidligere Odense Vandselskab). Sarah Christensen deltog i nogle af indsamlingerne på Sjælland og på Fyn og var behjælpelig med at GEUS kunne anvende nogle indsamlede dyr fra Odense og Århus til en DNA bestemmelse. Ligeledes var Peter Wiberg-Larsen, DMU, meget hjælpsom med at undersøge nogle af de indsamlede dyr og med at indsamle nogle Asellus aquaticus fra en dam på Fyn til en DNA undersøgelse. For at udveksle erfaringer om faunaen arrangerede HOFOR et miniseminar med deltagelse fra HOFOR, Vandcenter Syd, GEUS og DTU. En af konklusionerne på dette seminar var, at oprindelsen af disse dyr skulle undersøges nærmere ved hjælp af DNA teknologi og GEUS blev bedt om at lave en undersøgelse af Asellus aquaticus DNA, samt af andre forhold herunder muligheden for at udvikle en ny analysemetode, hvor der udtrækkes DNA fra sedimentprøver og testes for arts-specifikke DNA-markører som indikation for denne fauna. Efterfølgende udarbejdede GEUS en samarbejdsaftale med HOFOR og Vandcenter Syd (se bilag 1). Denne rapport er en sammenstilling af de indsamlede oplysninger fra tanksystemerne, og af DNA undersøgelsen. G E U S 12

13 13 Dyr i grund- og drikkevand En ny drikkevandsfauna er fundet i det Københavnske drikkevand. Drikkevandsfaunaen består af dyr tilpasset ekstreme forhold: en ganske lille næringstilstrømning, totalt mørke og 8 º C koldt vand. Faunaens største dyr, Asellus aquaticus, er i København fundet i højdebeholdere og i det ledningsnet, der leder drikkevand ud til forbrugerne. I København har faunaens tilstedeværelse kun været kendt i kort tid, men en tilsvarende fauna har været kendt i Odense i mange år. Faunaen i København består især af små krebsdyr, der afgræsser en biofilm der vokser i tankanlæg og vandrør. I København omsætter faunaen det organiske stof der ledes med drikkevandet ind i højdebeholderne, og faunaen kan derfor have stor betydning ved nedbrydning af skadelige stoffer og græsning af bakterier og andre mulige patogene organismer. Faunaen er righoldig omkring tilløbene i højdebeholderne, hvor der lever en særlig fauna i og på det materiale og sediment der aflejres, når vandet med høj fart ledes ind i en stor beholder med næsten stillestående vand. Oprindelsen af faunaen kendes ikke, men der er fundet tilsvarende dyr i overfladevand og højtliggende grundvand på Sjælland. Mulig oprindelseskilder til dyrene i ledningsnettet er derfor faunaer, der stammer fra højtliggende iltholdigt grundvand, eller tilpassede dyr fra overfladevand. I Danmark stammer 99 % af vores drikkevand fra urenset grundvand, der kun gennemgår en simpel vandbehandling bestående af luftning og filtrering. Andre steder i Europa gennemgår drikkevand, der baseres på overfladevand, en avanceret rensning. Det er derfor vigtigt at undersøge den ny faunas mulige effekter på drikkevandets kvalitet og at optimere eventuelle gavnlige effekter af dens tilstedeværelse. I Tyskland, samt andre steder i Europa og de øvrige verdensdele har det længe været kendt, at der findes stygoide/stygobionte grundvandsfaunaer - komplekse økosystemer bestående af mange arter dyr, som lever i det øvre iltholdige grundvand. Antallet af stygoide grundvandsdyr aftager med stigende dybde. I Danmark har der ikke tidligere været særlig opmærksomhed omkring tilstedeværelsen af en eventuel grundvandsfauna. Dette skyldes en formodning om, at den sidste glaciale nedisning har forhindret, at en sådan fauna har overlevet eller efterfølgende kunnet nå at indvandre sydfra. Imidlertid er der i Nordtyskland fundet grundvandsdyr, og det er derfor logisk at antage, at denne faunatype også kan forekomme i Danmark. GEUS har tidligere gennemført et pilotprojekt, Brüsch 2003, hvor de første danske grundvandsdyr er indsamlet (figur 2). En unik fauna bestående at 100 % tilpassede grundvandskrebsdyr er for nyligt fundet og beskrevet på Island, Svavarsson et al, Faunaen må være opstået på Island, da de fundne arter ikke hidtil er genfundet i andre dele af verden, og krebsdyrene der er fundet antages at have tilpasset sig grundvandsmiljøet før sidste istid. Island har som bekendt mange varme kilder, og det er muligt at krebsdyrene har kunnet overleve en nedisning i disse kilder. G E U S 13

14 14 Figur 2. Foto til venstre: 5-6 mm lang hvid isopod fanget i et højtliggende grovkornet grundvandsmagasin ved Fårdrup på Sjælland, tre meter under terræn. Magasin-materialet består af grus og sten. Der er tale om en isopod, Asellus aquaticus, bedre kendt som vandloppe. Krebsdyret har små øjenanlæg, og der kan derfor være tale om en såkaldt gæst i grundvandet, en ikke fuldt tilpasset art, eller en art der kan overleve både i grundvand og i overfladevand. Endeligt kan nogle arter måske også have en del af deres livscyklus i grundvandet og resten i overfladevand. Foto til højre: Cyklopodia, en mm lang, hun med æg sæk. Dyret er frit svømmende og er fanget i højtliggende grundvand samme sted hvor isopoden er fanget. Grundvandsdyr er tilpasset et miljø med meget stabile forhold, (stabil temperatur/mørke), er ofte hvide, uden pigmenter og uden øjne. Grundvandsdyr har generelt et længere liv, hvor alle livsstadier er forlængede, og 100% tilpassede grundvandsdyr udvikler ofte kun få og store æg i løbet af deres livstid. Dyrene har en nedsat stofomsætning, og kan i udlandet findes i meget store dybder i grundvandsmagasiner, også når der kun er små koncentrationer af ilt tilstede. Der eksisterer så vidt vides kun den information, som GEUS har indsamlet om stygoide dyr i grundvand i Danmark. Få vandværker har hidtil været opmærksomme på denne utrolige vel tilpassede fauna. Dog er der under en renpumpning fotograferet et ukendt krebsdyr i bunden af en 79 meter dyb indvindingsboring tilhørende TREFOR Vand, Lysholt Vandværk, Vejle, se bilag 4. Hvis man antager, at der flere steder i de danske grundvandsmagasiner findes en stygoid fauna, må det siges, at den er relativt sjældent observeret af vandværksfolk. En årsag kan være den måde boringer i Danmark filtersættes på: I Danmark lægges normalt filtergrus omkring det indtag, hvorfra der skal indvindes grundvand. Dette filter grus er en usorteret sand/grus blanding. Da filtrene er sat i filtergrus vil porøsiteten i filtergruset som hovedregel vil være ganske lille. Det vil derfor være svært for større dyr at passere denne barriere, med mindre boringen er sat i fritstående kalk, hvor der normalt ikke filtersættes. I udlandet anvendes filtergrus ofte ikke omkring indvindingsboringernes indtag eller filtre, men der renpumpes, indtil den finkornede fraktion fra reservoir bjergarten er oppumpet. Der vil derfor være direkte adgang fra er magasin til boringen via slidserne i filtrene. Undersøgelser i overfladevand af det mest hyppigt fundne dyr i rentvandsfaunaen, Asellus aquaticus, viser, at dette dyr er ekstremt tolerant overfor selv ganske små ilt koncentrationer. Kristensen (2004) har gennemgået forekomsten af Asellus aquaticus og af Gammarus pulex i et Bornholmsk vandløb. Den sidstnævnte art er formodentlig fundet i Nordjylland, hvilket ikke er overraskende, da denne art er almindelig i områder med kilder og vandløb med udspring i kalk. Den efterfølgende tekst om Asellus er om bearbejdet fra Kristensen (2004): G E U S 14

15 15 Orden Isopoda, Asellus aquaticus, vandbænkebiderens foretrukne levested er langsomt flydende vandløb og søer, hvor den erstatter Gammarus pulex, der foretrækker de øvre, hurtigt strømmende vandløbsstrækninger (Graca et al., 1994). Asellus synes ikke at trives i vandløb, hvor der ofte forekommer store strømhastigheder. Asellus kan tolerere ret stor organisk forurening i både strømmende og stillestående vand, og den er således indikatororganisme for organisk forurening (fx Gledhill et al., 1993). I en sammenligning af Gammarus pulex og Asellus aquaticus, var sidstnævnte fem gange så resistent overfor hypoxi (iltmangel). Eksempelvis var mortaliteten af unge Gammarus 40 % efter 24 timers eksponering med et mg O2/l, mens overlevelsen ved samme iltmætning var 100 % for unge Asellus. Selv efter at være eksponeret for kun 0,25 mg O2/l i 24 timer var overlevelsen af unge Asellus 80 % (Maltby, 1995). Livscyklus i overfladevand viser, at hannerne vælger en hun, som de klamrer sig til i perioden op til et hud skifte, hvorunder parringen foregår. Britiske populationer har normalt to årlige generationer, hvor hovedreproduktionen foregår om foråret og i sensommeren. Den overvintrende generation af store individer (6-8 mm) yngler tidligt, i februar-marts, efterfulgt af mindre individer, der er født senere om efteråret det foregående år. Afkommet af disse fremkommer hovedsagelig i perioden april-juni og består følgelig af en serie overlappende kohorter, da de er født på forskellige tidspunkter og måske har forskellige vækstrater. De tidligste af forårsgeneration vokser til i løbet af sommeren og er i stand til at yngle ved en længde på kun 3-4 mm i juli-oktober, mens de langsomme individer, der er født lidt senere om foråret, ikke kan gennemføre en livscyklus samme år og derfor overvintrer (Gledhill et. al, 1993). Livslængden varierer således fra 3-6 måneder for den tidlige forårsgenerationen, der yngler samme år som de bliver født, og op til et år for de overvintrende individer. Antallet af kuld angives i litteraturen at være op til tre eller endog 4, men sandsynligvis dør hunnen normalt efter blot et enkelt kuld. Asellus er omnivor / altædende, men hovedernæringen består af detritus. Føden kan også omfatte levende planter (fx Elodea) og mosser, samt filamentøse alger. Specielt de små individer foretrækker pellets og detritus, der indeholder mange bakterier og svampe (Gledhill et al., 1993). Asellus skraber bladene rene for biofilmen af svampe og alger (Graca et al., 1993b). Bortset fra den Iberiske halvø og det nordligste af Skandinavien, er arten vidt udbredt i Europa (Henry & Magniez, 1978). På Bornholm er arten udbredt i grøfter, damme og søer over hele øen. I sprækkedalsvandløb og andre vandløb, hvor strømhastigheden jævnlig er meget stor, er den derimod sjælden, men den findes almindeligt i kilder, især sumpkilder (pers. obs.). Asellus aquaticus er med andre ord en udpræget afgræsser af biofilm på alle typer belægning, hvilket også ses i de undersøgte tankanlæg, hvor særligt de små juvenile Asellus har specialiseret sig i at leve i sedimenterne nær tilløbene. Arten er ved hjælp at en særlig god iltoptagelse, Maltby, 1995, i stand til at leve under ekstremt lave ilt koncentrationer uden at tage varig skade, hvilket tyder på at arten kan overleve selv i store dybder i grundvandet. G E U S 15

16 dybde til indtag i meter 16 Geokemiske forhold i drikke- og grundvand Iltindhold i grundvand fra grundvandsovervågningen. Figur 3 og 4 viser iltmålinger i grundvand fra det danske nationale grundvandsovervågningssystem i forhold til dybden af det analyserede grundvand. Da det kan være svært at lave korrekte iltmålinger, er der kun medtaget målinger gennemført i felten. Der optræder store variationer i iltindhold i de enkelte boringsindtag gennem tid, og derfor er det her valgt, at vise både de mindste ilt koncentrationer målt i de undersøgte prøveindtag (figur 3), samt de størst målte koncentrationer i de samme indtag. Figur 3 viser, at de fleste af de undersøgte vandprøver ofte indeholder iltkoncentrationer over et mg O 2 /l, hvor 100 % af Asellus overlever, mens mange prøver udtaget helt ned til 60 meter under terræn faktisk indeholder over 0,25 mg O 2 /l. Anvendes de maksimale målte koncentrationer (figur 4) ses, at der helt ned til 100 meter under terræn kan forekomme grundvand med mere end et mg O 2 /l. Der vil derfor være særdeles gode muligheder for at Asellus kan overleve en transport gennem et magasin, eksempelvis gennem sprækker eller ved en simpel vandring ned gennem magasinerne, hvis krebsdyret i øvrigt har grund til det under jagt på mad eller partnere. Figur 4 viser, at det ikke er ilt der vil begrænse udbredelsen af krebsdyret i grundvandsmagasinerne, men snarere mangel på fødeemner. mindste iltinhold målt i felt iltindhold i mg/l 0, Figur 3. Mindste iltindhold målt i indtag i grundvandsovervågningen. Bemærk at aksen for ilt koncentrationer er logaritmisk. G E U S 16

17 dybdeinterval dybde til top indtag i meter under terræn 17 største målte iltindhold målt i felt ilt i mg/l 0, Figur 4. Største målte iltindhold i vandprøver udtaget fra indtag i grundvandsovervågningen. Der er gennem moniteringsperioden udtaget prøver fra samme indtag gentagne gange. Figur 5 viser det gennemsnitlig iltindhold i fem meters dybdeintervaller fra terræn til 100 meter under terræn. Det fremgår af figuren, at den gennemsnitlige ilt koncentration overskrider et mg O 2 /l i hele intervallet fra 0 til 50 meter under terræn. Det største spring i iltindhold sker tilsyneladende ca. 20 meter under terræn, hvor det gennemsnitlige iltindhold falder fra mere end tre mg O 2 /l til omkring to mg O 2 /l. O2 konc i mg/l til 5 10 til til til til til til til til til 95 >=100mut grundvandsovervågning O2 i grundvand (avg indtag+avg pr interval) Figur 5. Gennemsnitligt iltindhold i fem meters dybdeintervaller fra terræn til 100meter under terræn. Baseret på vandprøver fra 1643 indtag i grundvandsovervågningen. Der er beregnet en middelværdi for iltindhold i det enkelt indtag, og dernæst beregnet en middel O 2 koncentration for de indtag, der ligger i fem meter intervallerne. G E U S 17

18 Andel værker, % 18 Da iltmålinger kan være vanskelige at gennemføre kan det slet ikke udelukkes, at nogle af de undersøgte vandprøver er blevet påvirket af ilt fra atmosfæren under prøveudtagning eller under iltmålingen. Selvom der er tale om små koncentrationer, viser figur 5, at der formodentlig kan forekomme ilt i magasiner mere end 100 meter under terræn. Det må dog anses for sandsynligt, at målte iltkoncentrationer over et mg/l kan anses for troværdige. Såfremt dette er korrekt, vil det ikke kunne udelukkes, at Asellus og andre organismer, der er tolerante overfor lave iltkoncentrationer i vand, udmærket kan overleve i dybder fra 0 til 40 meter under terræn. Indhold af organisk stof i drikkevand I Jupiter foreligger der analyser for forskellige organiske komponenter, fx TOC, TOC filtreret, NVOC, VOC. I denne sammenhæng er analyserne for NVOC (Non Volatile Organic Carbon - ikke flygtigt organisk kulstof) i drikkevand anvendt. TOC analyserne er ikke anvendt, da NVOC i dag er den mest anvendte metode, hvor afblæsning indgår i analysemetoden. NVOC i drikkevand fra ledningsnettet til 1 1 til 2 2 til 3 3 til 4 4 til 5 5 til 6 6 til 7 7 til 8 9 til 9 9 til 10 Koncentration i mg/l Figur 6. NVOC i drikkevandsprøver udtaget fra 4097 anlæg. Prøverne er udtaget fra ledningsnettet forskellige steder i Danmark. Koncentrationerne er beregnet som gennemsnitskoncentrationen for det enkelte anlæg. Da drikkevandet ofte er indvundet fra forskellige boringer, repræsenterer analyserne blandingsvand fra disse boringer. Der er gennemført en lang række analyser af NVOC analyser af vandprøver udtaget fra ledningssystemet og disse prøver ligger registreret under anlægsid. Databasen indeholder oplysninger om prøver udtaget fra 4097 anlæg gennem de sidste ca. 20 år (figur 6). Mere end 75% af drikkevandsprøverne indeholder under to mg NVOC/l, men der er også enkelte prøver der indeholder over fem mg/l. G E U S 18

19 19 Af tabel 2 fremgår, at rentvands/drikkevandsprøverne indeholdt en gennemsnitskoncentration på 1,6 mg NVOC /l, mens median koncentrationen var 1,3 mg /l for den gennemsnitlige koncentration for de enkelte anlæg. interval mg/l drikkevand Antal anlæg i interval i mg/l gennemsnit maksimum minimum 0 til til til til til til til til til til >=10 mg/l Middel mg/l 1,57 2,22 1,20 Median mg/l 1,3 1,8 1,0 Tabel 2. NVOC indhold i drikkevand fra 4097 anlæg. Antal anlæg er opdelt i forskellige koncentrationsintervaller hvor henholdsvis gennemsnits, maksimum og minimums koncentrationerne i de enkelte anlæg er vist. Desuden er middel og mediankoncentrationer for alle anlæggende vist. Organisk stof i grundvand Tabel 3 viser, at grundvandet i de øvre grundvandsmagasiner på landsplan indeholder ca. 5 til 10 gange mere NVOC end mere end 75% af de analyserede vandværksanlægs indhold i drikkevand. At der udvaskes store mængder organisk stof fra rodzonen er almindelig kendt, og det ses, at hovedparten af NVOC er omsat eller på anden vis bundet i en dybde på ca. 35 meter under terræn, hvorefter NVOC koncentrationerne er ret konstante mod dybden under terræn. Dette fremgår også af figur 7 og 8, der viser fordelingen af NVOC målinger mod dybde af boringerne under terræn. Meter Antal NVOC i mg/l gennemsnit Boringsdybde under boringer analyser maks min avg gennemsnit terræn i meter 0 til ,5 5,5 7,7 3,4 5 til ,1 3,2 4,4 7,5 10 til ,7 2,1 3,2 12,9 15 til ,2 2,2 3,0 18,1 20 til ,1 2,0 2,9 22,9 25 til ,2 1,7 2,3 28,1 30 til ,3 1,7 2,3 32,9 35 til ,7 1,5 1,9 38,0 40 til ,9 1,6 2,1 42,9 45 til ,7 1,6 2,0 48,2 50 til ,4 1,4 1,8 52,7 55 til ,7 1,6 2,1 58,3 60 til ,6 1,4 1,9 62,8 65 til ,6 1,5 1,9 68,2 70 til ,0 1,5 2,1 73,1 G E U S 19

20 dybde meter under terræn 20 Meter Antal NVOC i mg/l gennemsnit Boringsdybde under boringer analyser maks min avg gennemsnit terræn i meter 75 til ,6 1,5 1,9 78,2 80 til ,5 1,3 1,8 83,0 85 til ,8 1,5 1,9 88,2 90 til ,5 1,3 1,7 92,8 95 til ,4 1,6 1,9 98,5 >=100mut ,0 1,1 1,8 136,0 sum gennemsnit 3,5 1,9 2,5 54,6 median 2,8 1,6 2,0 52,7 Tabel 3. NVOC indhold i grundvand. Analyser stammer fra grundvand og råvandsprøver og er et samlet udtræk fra Jupiter. For at undgå enhedsfejl er alle koncentrationer over 100 mg/l er udeladt. Min minimum, maks maksimum, avg gennemsnit. For mange indtag/ boringer er der gennemført mange analyser og for hvert interval er gennemsnittet beregnet for henholdsvis minimumskoncentration målt i indtagene i intervallet såvel som maksimum og gennemsnitskoncentrationen i de enkelte indtag. Tabellen viser også median og gennemsnitsværdi for min, maks (Maksimum) og avg (gennemsnits) koncentrationer, samt den gennemsnitlige dybde i de enkelte indtag. Boringsdybde mod maks NVOC konc konc i mg/l Figur 7. Indhold af NVOC i grundvand. Koncentration mod dybde. Antal boringer analyseret for NVOC G E U S 20

21 dybdeintervaller dybde meter under terræn 21 Boringsdybde mod maks NVOC konc konc i mg/l 0, Figur 8. Som figur 7 blot med logaritmisk x-akse. NVOC gennemsnitskoncentration mod dybde 0 til 5 5 til til til til til til til til til til til til til til til til til til til 100 >=100mut koncentration i mg/l Figur 9. NVOC koncentration i mg/l mod dybdeintervaller. NVOC koncentration er beregnet som middelværdi af den gennemsnitlige koncentration i det enkelte indtag. Figur 9 viser fordelingen af det gennemsnitlige NVOC indhold i fem meters intervaller under terræn. Gennemsnittene er beregnet på den gennemsnitlige koncentrationer der er målt i boringerne, og tallene er de samme som kan findes i tabel 3. G E U S 21

22 22 Mulig udfyldning af porøsitet i grundvandsmagasiner med organisk stof Figur 7 og 9 viser, at der kan nedvaskes store mængder organisk materiale fra terræn, og at dette organiske stof for en stor dels vedkommende bliver omsat af bakterier i den øverste del at jordsøjlen. Da opbygning af humus i rodzonen er sket hurtigt efter sidste istid er denne udvaskning sket gennem et langt tidsrum. Her er forsøgt beregnet, hvor stor en del at porøsiteten i et højtliggende magasin der ville være blevet fyldt med organisk materiale, såfremt der ikke var sket en biologisk omsætning af det nedsivede organiske materiale siden sidste istid. Koncentrationerne i vand der forlader rodzonen er ret høje, og Vinther et al beskriver udvaskningen af organisk stof (som DOC) under marker til ca. 30 mg/l i nedsivningsvandet i 30 cm s dybde,. Men der nævnes også udvaskninger på kg C/ha/år hvilket svarer til at der udvaskes mg C/l. Allerede i 0,9 meters dybde er 2/3 dele omsat og der findes generelt koncentrationer omkring 10 mg DOC/l. Forudsætninger: For at underestimere påvirkningen sættes NVOC koncentrationen i det øverste grundvand lavt: 10 mg NVOC /l. Infiltration fra rodzonen sættes til 250 l/år pr m 2. Tidsperioden sættes til år. Porevolumen i sand sættes til 30 %, selvom der forekommer langt lavere sprækkeporøsiteter i opsprækket moræneler og kalk. Massefylden for organisk stof sættes mellem 0,8 til 1,1. 1,1 er den største massefylde, der er fundet for unge materialer. Det er usikkert, præcis hvor stor massefylden er for biofilm og andet levende eller dødt organiske materialer. Et gæt kan være 1. Flux af organisk stof fra overflade pr år/m 2 : 250x10 mg/l = 2,5 g/år I postglacial tid er der udvasket: 2,5 g/år/m år = 28,75 kg organisk stof pr m 2. Dette er faktisk ikke særligt meget, når man tænker på at en porøsitet på fx 30 % i en m 3 sand svarer til 300 liter, eller ca. 300 kg organisk stof, hvis hele porerummet skal fyldes op med stof der har en massefylde på ca. 1. På den anden side vil der i et geologisk stabilt område ikke skulle regnes i er af år, men i millioner af år, hvilket på en lang skala vil det betyde, at der fx på en mio. år samlet vil blive nedvasket ca kg/m 2 under danske forhold. Denne mængde ville stoppe alle porer fra terræn til 10 meters dybde. Er sprække porøsiteten kun et par %, som i moræneler, vil en nedvaskning af 28 kg/m 2 være rigeligt til at stoppe alle sprækker i lidt større dybde. Biologisk omsætning er med andre ord en forudsætning for at vedligeholde den hydrauliske ledningsevne i porøse medier, hvilket også nævnes af fx, Humpreys, G E U S 22

23 23 Indsamling af dyr og pellets og sedimentprøver Beskrivelse af tankanlæg København Det besøgte HOFOR tankanlæg ligger i København. Anlægget består af en række beholdere/tanke der er bygget med en fælles sidevæg. Der er opført to rækker tanke på terræn, og anlægget er dækket med 0,5 til 1 meter jord beplantet med græs (figur 10). De opførte opbevaringsbeholdere ligger på et af de højeste punkter i København. Da anlægget er bygget på terræn, er der ikke kontakt med det underliggende grundvand der i området ligger 23 til 25 meter under gulvene i anlægget. Såfremt der måtte opstå en utæthed, vil der derfor være en nedadrettet vandstrøm fra utætheden, og det er ikke sandsynligt, at der kan strømme vand ind i tankanlægget nedefra. Overskuds nedbør fra anlæggenes overflade løber til et opsamlingssystem, der leder vandet der opsamles mellem de enkelte sammenhængende beholdere til et ny renoveret system, der samler vandet fra ydersiden af beholderanlægget til det vejanlæg, der adskiller de to rækker beholdere. Figur 10. Oversigt over m 3 stort tankanlæg tilhørende HOFOR. Tanken er en af adskillige tanke beliggende på samme lokalitet. Tankene er opbygget af beton, og taget er båret af cementsøjler. Der er etableret 12 rækker søjler, hver med 22 søjler til at understøtte det overliggende tag. Nedgangen til tanken er kun mulig gennem en sikret indgang fra toppen af den enkelte tank. I bunden af tanken er der etableret en langsgående rende, hvor der er placeret en ventil, der anvendes når tanken skal tømmes for vand (figur 11). I tanken er der ligeledes overløbsrør, som bortleder eventuelt overskudsvand til nærliggende recipient. Tankanlægget bruges i dag som mellemlager af færdigbehandlet drikkevand. Drikkevandet ledes ind i tankene gennem to tilløb i G E U S 23

24 24 den ene ende (figur 10), og ud til forbrugerne gennem to fraløb i den anden ende. Den enkelte tank er endog meget stor og rummer omkring m 3 vand. Figur 11. Søjler og rende i tankanlæg. Figur 12. Renovering af anlæg. HOFOR indsamlede sedimentprøver fra en lang række lokaliteter i Nordsjælland se bilag 3 figur 7, som blev anvendt til DNA undersøgelsen. Odense I samarbejde med Vandcenter Syd blev der indsamlet sedimentprøver fra tre returskylletanke. Der blev ikke undersøgt tankanlæg i Odense, men som tidligere nævnt stillede Sarah Christensen, DTU, nogle dyr til rådighed for DNA undersøgelsen, der var indsamlet i ledningssystemerne i Odense. Se i øvrigt bilag 3. G E U S 24

25 25 Asserbo En højdebeholder, der netop er udtaget af drift, blev undersøgt, og der blev udtaget sedimentprøver, som efterfølgende blev undersøgt og fotograferet med et mikroskop med påfaldende lys. Tanken er ganske lille, 500 m 3, og placeret på en høj i Tisvilde Hegn. Den består af en cylinder med en central søjle, der understøtter taget. Adgangen til tanken sker gennem en sikret dobbeltluge. Ved tømning tappes vandet via et afløb ca. fem cm over gulv til nedsivning i dræn (figur 13). Figur 13. Nedgang til tank sker via stige. Læg mærke til at bundsedimentet bliver suspenderet ganske let. Foto: Hanne Rasmussen Brüsch. G E U S 25

26 26 Bakterielle undersøgelser og tælling af Protozoer i vandtankens biofilm Baggrund I vandtanken findes Asellus aquaticus i tilknytning til den brune biofilm i tankens bund og på tankens indersider, såvel som ved tilløb og afløb. Skrab af disse blev derfor analyseret for tilstedeværelse af patogene indikator-bakterier (E. coli og fækale enterokokker) for at undersøge, den umiddelbare smitte-risiko forbundet med tilstedeværelsen af dyrene. GEUS lavede endvidere total-tællinger af bakterier og protozoer i biofilm-skrabene, for at skabe en preliminær forståelse af det akvatiske samfund som Asellus aquaticus er en del af. Biofilmen i vandtanken (og i vandrør) dannes af bakterier, der er i stand til at sætte sig fast på overflader, hvor de lever af de mikro næringsstoffer og det organiske materiale, der flyder forbi. En biofilm består sædvanligvis af mange forskellige arter af bakterier, der kan leve på overflader. Her deler de sig, og skaber samtidig en matrix af polymere og andre stoffer, som de udskiller. Matrix en af celler og polymere danner en beskyttende hinde omkring det mikrobielle samfund, der langsomt vokser og kommer til at bestå af flere lag af celler. Figur 14. Eksempler på protozoer fundet i biofilm. Venstre foto Heteromita globosa, Midt foto- samme dyr i gruppebillede, til højre Cercomonas sp. Alle de viste protozoer er flagellater. Protozoer er små encellede dyr, der lever i alle akvatiske og terrestiske miljøer (figur 14). De udgør det trofiske niveau mellem bakterier, alger og svampe (som de lever af) og de større flercellede dyr i vand- og jordmiljøer (nematoder og mikro-arthropoder), som de bliver spist af. De mindste protozoer har samme størrelse som store bakterier (Ө 1-2 µm). Det er grupper af små heterotrofe flagellater, der bevæger sig ved hjælp af én eller flere svømme-flageller, og små nøgne amøber, der bevæger sig ved hjælp af pseudopodier. Både flagellater og amøber græsser på bakterier og svampe ved at omslutte byttet med deres cellemembran, som afsnøres og danner en intracellulær fødevakuole. Blandt flagellaterne findes større arter, der kan blive op til 200 µm og som kan svømme ganske hurtigt. Foruden flagellater og nøgne amøber, findes også større skalbærende amøber (testate amøber) i jord- og vandmiljøer. De største protozoer findes i gruppen af ciliater, som er meget store encellede dyr (op til flere mm). De har deres navn efter de små fimrehår, cilier, der sidder på celleoverfladen, og som bruges til bevægelse og fødeindtag. Der findes således fire overordnede grupper af protozoer: flagellater, nøgne amøber, skalbærende amøber og ciliater. De har alle behov for tilstrækkeligt med ilt, vand, og føde for at være aktive. Opstår der begrænsninger af disse faktorer i det omgivende miljø, f.eks. anaerobe forhold eller periodevis udtørring af levestedet, danner protozoer et inaktivt stadie i form af en cyste, der er resistent overfor disse forhold. Cyster kan spredes med jord, luft eller vand til nye miljøer, hvor protozoen ekscysterer og bliver aktiv påny. G E U S 26

27 27 Protozoer er en vigtig del af den mikrobielle fødekæde, fordi deres tilstedeværelse betyder meget for hastigheden af omsætningen af organisk materiale og næringsstoffer. Græsning på bakterier og svampe øger den mikrobielle aktivitet fordi der bliver en øget omsætning af organisk stof og mineraler (som protozoerne udskiller) i hele det mikrobielle samfund. Græsning frigiver organisk stof og næringsstof, der ellers ville være bundet i inaktiv mikrobiel biomasse, og dette tillader den resterende population af bakterier og svampe at vokse og dele sig hurtigere og således at opretholde et højere aktivitetsniveau. Bakterielle undersøgelser De indsamlede Asellus fra HOFOR s tanke blev testet for patogene bakterier efter følgende metode: Dyr og vand udtages fra akvariet Vandet fra akvariet testes ved at overføre en ml til petri film (selektivt for E. coli og coliforme bakterier) Dyret skylles tre gange i phosphat buffer Dyr og buffer kvases (i morter) To fortyndinger udplades på petrifilm Pladerne blev aflæst efter ca. 18 og 48 timer Der blev ikke konstateret patogene bakterier i Asellus eller i andre af de organiske materialer der blev testet. TREFOR Vand fik i december 2013 analyseret to Asellus aquaticus for coliforme bakterier og E. coli. hos Teknologisk Institut, (TREFOR Vand, 2014). Dyrene var fundet i TREFOR Vands ledningsnet. Prøven indeholdt, som i København, ikke coliforme bakterier eller E. coli. En udtagning af tre biofilm skrab fra tankanlægget (fra tilløbet til tanken, fra skylle renden midt i tanken og endelig fra området omkring afløbet) viste, at antallet af dyrkbare bakterier faldt gennem tanken fra ca. 26 millioner ved tilløbet over fire millioner i midten af tanken og endelig til to millioner ved fraløbet (tabel 4). Der er således en indikation af, at koncentrationen af næringsstoffer til at understøtte vækst af bakterier er højest ved tankens tilløb. En yderligere indikation på at omsætningen hovedsageligt foregår ved tilløbene findes ved, at der netop omkring tilløbene findes flere og gennemsnitligt større Asellus, end der findes i områderne omkring fraløbene. Bakterier i biofilm Skylle fra tank Enhed Afløb 1 rende Tilløb sediment Afvejet biofilm gram 0,47 0,42 0,51 opløst i P buffer Ml 4,5 4,5 4,5 Bakterier CFU/ml Bakterier CFU/gram biofilm 1, , , Protozoer i biofilm Skylle fra tank Enhed Afløb 1 rende Tilløb sediment Protozoer Antal pr gram >5, >5, >5, Tabel 4. Udtagning af prøver af biofilm fra forskellige steder i tanksystemet. Bakterierne er dyrket på et rigt medium (1/10 Tryptic Soy Broth agar) og inkuberet ved 10 C i 48 timer. G E U S 27

28 28 Metode til tælling af protozoer og resultater De tre biofilm skrab udrystes på rystebord i 10 fortynding (Fosfat-buffer) 30 min ved 150 rpm. Protozoer tælles i tre replikater vha. MPN-metode i microtiter-bakker med 96 brønde. Der laves 3-folds fortyndingsrækker (100 µl overføres fra 10-folds fortynding til 1. række; 50 µl fortyndes i 100 µl medie i de efterfølgende rækker). Der anvendes en modificeret udgave af Neff s Amøbe saline (Page, 1988) tilsat 0.1 g/l Tryptic Soy Broth som medie til inkubation af protozoerne. Inkubationstemperatur er 10 C. Protozoerne tælles i omvendt mikroskop efter hhv. en og tre uger. Resultater af protozotællingerne viste, at i alle biofilm skrab fandtes protozoer i et antal >5, pr. g. biofilm. Når antallet af protozoer er så højt, sammenlignet med antallet af dyrkbare bakterier, tyder det på en meget hurtig stof-omsætning i biofilmen. Samtidig vil der være en del bakterier tilstede, der ikke er dyrkbare på en næringsrig agarplade, og som derfor ikke tælles med. I højest antal fandtes små heterotrofe flagellater og små nøgne amøber, hvilket svarer overens med andre undersøgelser af biofilm og næringsfattige jorde. I alle biofilm observerede vi protozoer tilhørende de fire overordnede grupper af protozoer: flagellater, nøgne amøber, skalbærende amøber og ciliater. I biofilm-skrabene fra renden og afløbet, var der tendens til at antallet af amøber var højere, end i skrabet fra tilløbet. Sediment og pellets i tankanlæg Det aflejrede sediment i bunden af de undersøgte tankanlæg består af pellets fra Asellus aquaticus, mens den finkornede del af sedimentet mest bestående af jernoxider, finkornede og grovkornede kalkflager udfældet fra vandet samt en række andre mindre pellets at ukendt oprindelse, se bilag 3 om beskrivelse af sedimentprøver fra HOFOR og fra Vandcenter Syd. Fordeling af pellets I foråret og forsommeren 2009 blev tank 1, 2, 3, 4, og 5 i København besøgt og undersøgt i forbindelse med en renovering af tankanlægget. Gennemgangen af de forskellige tankanlæg viste, at der ud over fund af Asellus aquaticus, også var aflejret en del sedimenter ved indløbene til tankanlæggene, men også at der var stor forskel på mængden af sediment og antallet af pellets i de forskellige tankanlæg. Oplysninger om tankenes driftsperiode viste ikke overraskende, at jo længere en tank havde været i drift, jo større var de aflejrede mængder af sediment og sediment (tabel 5). Sted Periode i drift Måneder siden rensning Antal pellets Tank 1?? Mange Tank 2 idriftsat 7/ tømt 20/ Mange Tank 3 idriftsat 19/ tømt 24/ Middel Tank 4 idriftsat 5/ tømt 30/ Få Tank 10 kloret, men med kravle spor Tabel 5. Visuel bedømmelse af sedimentmængder og antallet af pellets i de besøgte tankanlæg, samt længden af den periode tankene har været i drift før tømning. G E U S 28

29 29 Figur 15. Strømribber mellem fra og tilløb i tank 4. Få pellets ved væg fod. Strømribberne viser at sediment og pellets formodentlig et fjernet pga. af strømmende vand. Det viste sig også, at selve tømningen af en tank påvirker de aflejrede sedimenter på tankbunden ret voldsomt. Tømningen sker ved, at en udløbsventil åbnes midt i tanken (figur 15) efter det meste af vandet i tanken er pumpet ud til forbrugerne. Der bliver normalt efterladt ca. 0,5 til en meter vand i tanken, alt efter produktionsforhold. Når bundventilen åbnes, strømmer vandet hurtigt ud, og trækkes over mod den længdegående udløbsrende. Ved tømningen fjernes det meste af det sediment, der er aflejret omkring indløbene og langs vægge og på selve gulvarealet. At vandet kan strømme hurtigt langs bunden af tanken mod afløbsventilen, ses af de små strømribber som kan opstå, fx på gulvet ved væggene (figur 15), hvor det ses at kalkflager på tankens bund er aflejret som flade strømribber. Dette betyder, at de lettere fraktioner af sedimentet, som sediment og pellets samt de dyr sedimentet indeholder, fjernes ved tømningen. Det vil derfor formodentlig ofte være de dyr der er i stand til at holde fast i underlaget som findes i tanken, mens pelagiske (fritsvømmende) former kun vil kunne findes tilbage i mindre udstrækning. G E U S 29

30 30 Figur 16. En tank med aflejringer af sediment, pellets og partikler omkring tilløbene i tanken. Antallet af dyr og pellets er størst omkring tilløbene. Undersøgelse af tilløbene viser, at dyrene kan findes i både tilløbsrør og afløbsrør. Figur 17. Sediment ved tilløb, tank 2. Stor forekomst af sediment sås tre til fire meter på hver side af tilløb og to - tre meter frem i tanken ved de to tilløb. De cirkelformede renvaskede arealer skyldes, at gulvet rammes af kondens fra loftet, efter tanken er tømt for vand. Den stribede overflade er krybespor fra Asellus aquaticus. Figur 16 viser en principfordelingen af sediment og pellets i en tank, der har været i drift gennem længere tid. Ved tilløbene kan der findes ret store mængder sediment og pellets, se også figur 17 og 18, og der kan findes op til 2-3 cm sediment i områderne tættest ved tilløbene. G E U S 30

31 31 Figur 18. Sediment bestående af jernoxider, kalkflager og pellets aflejret omkring et tilløb i tank 1. Vandet i tanken blev tømt ganske langsomt og det aflejrede sediment blev kun svagt påvirket af tømningen. Læg mærke til den lille strøm rende der skyldes, at ventilen i tilløbet ikke slutter 100% tæt. Det er netop i sådanne små strømme, at de større Asellus finder sammen i små klynger, da dyrene tilsyneladende vandrer mod strømmen for at finde fritstående vand. Med stigende afstand fra tilløbene findes stadig mindre mængder sediment og pellets. Figur 19 viser, hvordan man langs væggene og ved hjørnerne af en beholder ved tilløbene kan finde et mindre antal pellets aflejret ved vægfoden. Ved et tilsvarende hjørne ved fraløbsvæggen finder man stort set ikke aflejringer af sediment eller pellets. Dette viser dels, at der tilføres materiale til tanken fra tilløbet, og at materialet aflejres rundt om dette. Men også at langt den største del af krebsdyrene lever omkring tilløbet, hvor der tilsyneladende er en bedre udviklet biofilm som dyrene afgræsser. Figur 19. Venstre foto: Hjørne ved fraløb, rent gulv næsten ingen pellets. Højre foto: Hjørne ved tilløb. Mange pellets ved væg fod. Tank 4. G E U S 31

32 32 I tankanlæg som har været i drift i få måneder findes kun en begrænset mængde aflejring ved tilløbene, men også i disse tanke kan man ved vægfoden se aflejringer af pellets dannet af de dyr der afgræsser biofilmen på tankvæggene (figur 20). Figur 20. Pellets langs væg ved tilløb 2. Kun få pellets. Tank 4. Figur 21. Sediment udtaget i Århus området. Sedimentprøven er ikke vasket, og det ses at prøven består af jernoxider og pellets fra krebsdyr. Læg mærke til den næsten gennemsigtige juvenile Asellus aquaticus, knap 2mm lang. Når sedimentet blev undersøgt i mikroskop blev den fine fraktion sorteret fra, for lettere at kunne finde infaunale dyr som orme, snegne, cyclops mm. Undersøges sedimentprøverne i mikroskop, ses at materialet ofte indeholder en stor fraktion af finkornet materiale, som er udfældede jernoxider (figur 21). Fraslemmes den fine fraktion af sedimentet, fremkommer et meget homogent materiale, der mest består af pellets dannet af krebsdyr (figur 22). Langt hovedparten af disse pellets er aflange ca. 0,1 til 0,2 mm bredde stave, der har en fordybning/ stribe på langs (figur 23). Denne pellets type stammer fra Asellus aquaticus og samme type pellets kan findes i glas, hvor disse dyr har gået i nogle timer (figur 24). G E U S 32

33 33 Figur 22. Tank 2, nærbillede af sediment ved tilløb. Pellets stammer fra Asellus aquaticus, den enkelte pellet er ca. 0,1-0,2 mm. Prøven er vasket, og det meste af det fine jernslam er fjernet. De enkelte pellets er ca. 0,1 mm i tværsnit. Figur 23. Pellets karakteristiske ved en stribning der betyder at den enkelte pellet er flad hjerteformet i tværsnit. På foto til højre anes underliggende millimeterpapir (1x2 mm). G E U S 33

34 34 Figur 24. Pellets indsamlet fra akvarium med levende Asellus. Der kan dog også findes en række andre pellets som små dråbeformede pellets der formodentlig stammer fra cyclops samt lange cylinderformede pellets (figur 25), hvortil oprindelsen ikke kendes. Figur 25. Der kan i enkelte tilfælde også findes andre pellets former som fx denne langstrakte og cylindriske pellet. Figur 26. Krybespor Asellus aquaticus, tank 3. Sporene ses på en hvid flisebelægning på gulvet mellem de to tilløb. Find Asellus > se side 72, hvis du ikke kan finde krebsdyret, der er ansvarlig for dele af krybesporet. De sedimentfri runde områder skyldes kondensvand, der drypper ned fra tankens loft. G E U S 34

35 35 Krybe og hvilespor En enkel metode til at lede efter Asellus eller andre dyr på bunden af en tømt tank er, at lede efter de spor dyrene har sat, da tanken blev tømt for vand. I nogle af tankene er der etableret hvide flisebelægninger mellem de to tilløb, og denne hvide flade er meget velegnet til at vise krybespor (figur 26). På det viste foto ses et spor, hvor sporet ofte krydser sig selv. Der er ikke tale om et græssespor, selv om sporet ligner græssespor fra dybhavet på abbysale flader, men derimod spor, hvor en Asellus har ledt efter frit vand, mens tanken blev tømt for vand. Uden held, da krebsdyret faktisk kan ses på billedet. Figur 27 viser en blød sediment flade hvor et krebsdyr, med held, har ledt efter fritstående vand hvor det har kunnet overleve. En test med en levende Asellus på en glat plastflade med en tynd vandfilm viste, at de levende dyr ikke har kræfter til at trække sig over en glat fugtig flade. Dyrene har brug for 2-3 mm frit vand for at kunne skubbe sig fremad, og sporene på fliserne er opstået på denne måde. Testen viser, at Asellus har så lange ben, at krebsdyret ikke er i stand til at løfte sig selv fra en flade uden vand, hvor dyret nærmest klæber til underlaget (figur 28). Krebsdyret har derfor formodentlig ikke mulighed for at kunne krybe over land fx fra et vandløb til et andet med mindre der er fritstående vand, eller for eksempel fra et vandløb hen til en gravet brønd eller til en boring. Figur 27. Tank 1 krybespor fra Asellus i sediment nær tilløb til tank. Der er formodentlig samme dyr der har ledt efter frit vand. Sporene kan anvendes til at afsløre om der er en makro fauna til stede uden at krebsdyrene bliver fundet. G E U S 35

36 36 Figur 28. Levende Asellus der forsøger at kravle over en våd overflade. Det ses at dyret ikke kan bære sin egen vægt, og at dyret nærmest klæber fast til underlaget. Dyret overlevede testen og lever nu i bedste velgående i et akvarium. Tank 1 blev der i første omgang tømt for vand ved en meget skånsom tømning af vandet i beholderen. Da der var ca. 10 cm vand tilbage i beholderen, blev bundventilen lukket, således at det var muligt at undersøge tanken, mens der var vanddække. Dette betød, at et tyndt sediment lag var synligt på fx de flisebelagte arealer og at sedimentet på bunden af beholderen ikke var skyllet ud. På de flisebelagte arealer blev der observeret besynderligt lange slyngede spor, der i høj grad ligner hvilespor, men som måske også kan være krybespor fra en større snegl. Der blev dog ikke fundet noget dyr i nærheden af det slyngede spor (figur 29). Figur 29. Tank 1, krybe/hvile spor eller krybespor på flisebelagt gulv. Der står stadig 10 cm vand i tanken. G E U S 36

37 37 Figur 30. Venstre foto: Spor på bunden af nedlagt højdebeholder. Midt i sporet ses et rødligt tusindben, Scolopendra sp, der er faldet ned i beholderen, da den blev lukket. Der er ca. to cm vand i bunden af tanken. Højre: hvidt skalfragment fundet ved krybespor. I en nedlagt højdebeholder i Tisvilde Hegn blev der fundet en del krybespor, men ingen levende dyr. Beholderen indeholdt dog mange jernbakterier og en veludviklet bakteriefilm på både væg og gulv, og der var derfor et fint fødegrundlag for vandlevende krebsdyr. I forbindelse med lukning og tømning af tanken var det tilsyneladende faldet en skolopender ned i tanken, og det tre cm lange insekt havde efterladt to parallelle linjer/spor, da insektet kravlede rundt på bunden af tanken, der indeholdt et par cm vand (figur 29). Tanken indeholdt også nogle andre typer spor og der blev fundet nogle hvide skalfragmenter i forbindelse med disse (figur 30). Det var dog ikke muligt at bestemme, hvorfra skalfragmenterne stammede. Kalkflager Tank 1 blev besøgt i juni 2009, hvor der stadig var ca. 10 cm vand i tanken. I tanken blev der observeret, at store mængder kalkflager var aflejret omkring vindeltrappen og på trappens trin (figur 31). Disse flager er dannet i tanken ved udfældning i grænsezonen mellem vand og luft/vandets overflade. Hele vandoverfladen er normalt dækket af en kalkfilm, der ved dryp af kondensvand falder ned gennem vandet til samme sted på bunden, fx kan der findes små kegleformede kalkflagedynger i tankene under dæksler. Flagerne slås løs af kondensdryp og falder lodret ned gennem flere meter vandsøjle for at lande på samme sted på bunden, hvor der dannes en pyramide. se figur 32. Flagerne driver gennem tanken fra indløbs- mod fraløbsrørene. Når kalkflagerne når trappen bundfældes flagerne på denne, fordi en prøvehane ved trappen løber gennem lang tid hver dag. Derfor samles der meget kalk på trappen. G E U S 37

38 38 Figur 31. Aflejring af kalkflager på trappe og nærbillede af kalkflagerne. Tank 1. Figur 32. Lille pyramideformet dynge kalkflager bundfældet under dæksel pga. af kondensdråber. Den lille fordybning der ses i midten af dyngen, er dannet af kondensdråberne, der rammer den kegleformede dynge efter vandet er bortledt fra tanken. De sorte striber er tætningsmateriale. Figur 31 viser de krystallinske flager, mens figur 33 viser, at flagerne er dannet af små Ca- CO 3 krystaller. Nogle af de flydende flager blev indsamlet og efterfølgende undersøgelse med mikroskop viste at flagene husede en sparsom fauna (figur 33) bestående af blandt andet Collembola, springhaler. Disse primitive dyr, som er kendt fra fossiler gennem mere end 100 millioner år, har tilsyneladende været i stand til at tilpasse sig til de flager, der driver på tankenes overflade. Fra overfladevand kendes disse dyr fra stort set alle miljøer. Også fra overfladen af søer. G E U S 38

39 39 Figur 33. Kalkflager fra tank 2. Der lever tilsyneladende en tilpasset fauna på de kalkflager der driver på overfladen af vandet i tanken, her ses en flage med et dyr formodentlig en Collembola, springhale. En mm lang. G E U S 39

40 40 Makrofauna Asellus aquaticus Hvis man ikke er klar over, at der lever en særlig tilpasset fauna i drikkevandssystemerne i Danmark, er det sandsynligt at man ikke finder denne fauna, når tankanlæg og ledningsnet vedligeholdes eller renses. I de større tankanlæg er der ikke installeret lys, og man betjener sig derfor af pandelamper og almindelige håndbårne lygter, når man besøger eller renser tankanlæggene. De større dyr lever solitært i tanksystemerne, og da der kun er ganske lidt næring tilstede i form af biofilm på overflader, vil antallet af dyr i forhold til vandmængde være ganske lille, også selv om disse dyr tilsyneladende er i stand til at klare sig under ekstreme forhold. Når et tanksystem tømmes for drikkevand, vil krebsdyrene søge ned mod gulvfladen i samme takt som vandstanden synker i tanken. De fleste tankanlæg består af støbte beholdere, og det er ofte ikke muligt at konstruere gulvfladerne, uden at der opstår små lavvandede pytter, som ikke bortledes, når tanken tømmes for vand. I disse pytter vil krebsdyr kunne findes spredt jævnt ud over gulvfladen. Da krebsdyrene oftest er immobile, kræves nogen øvelse i at få øje på dyrene, også fordi de ofte er gennemsigtige eller svagt pigmenterede og derfor har samme farve som cementen. Det mest iøjnefaldende er en række lysreflekterende pletter placeret under dyrenes ryg og haleplader (figur 34). Det er formodentlig hvide fedtdepoter, der kaster lyset tilbage. Det er dog ikke alle dyr der har fedtdepoter eller, hvor depoterne er synlige. Det sidste gælder fx for de største dyr, oftest hanner, der generelt også har mere pigmenterede skaller. Figur 34. 0,5 cm dyb pyt i tank 5. på gulvfladen ses tre Asellus aquaticus. Ved den tykke pil ses omridset af det største dyr, mens et mindre næste gennemsigtigt dyr ses ved den tynde pil. I billedets venstre side findes den tredje Asellus. De hvidlige flager er kalkflager, der ligger på overfalden af pytten. Når vandet tømmes ud af et tanksystem, vil de bundlevende dyr søge hen mod de områder, hvor der stadig er fritstående vand eller mod områder i tanken, hvor der strømmer lidt G E U S 40

41 41 vand fra utætte ventiler. Dette betyder, at man næsten altid vil kunne finde små klynger af Asellus aquaticus tæt ved tilløbsventilerne i det strømmende vand (figur 35 og 36). På figur 35 ses at det strømmende vand har eroderet en lille strøm rende i det materiale, der er aflejret omkring tilløbet. Figur 35 viser krebsdyrene i hurtigt strømmende vand på en flade uden sedimenter. Krebsdyrenes form gør det tilsyneladende let for dyrene at holde sig fast i det strømmende vand. Dyrene presses tilsyneladende ned mod bunden af det strømmende vand. Denne form betyder også, at det er svært at indsamle disse dyr. Dyrene klæber nærmest til underlaget, og dyrene indsamles derfor lettest med en skarp ske, som forsigtigt føres opstrøms. Denne evne til at holde fast i underlaget forestiller vi os, vil også komme disse dyr til gode i ledningsnettet, hvor der forekommer langt højere strømhastigheder. Figur 35. Klynge af Asellus aquaticus samlet i en smule strømmende vand ved et tilløb. Dyrene har søgt sammen til et område, hvor en smule vand løber fra en utæt ventil. Figur 36. En lille klynge Asellus aquaticus læg mærke til de hvide tegninger under ryg og haleskjolde. Ved indsamling findes en iøjefaldende fordeling af krebsdyrene i tanksystemet, hvis dette har været i drift i en længere periode. I området omkring tilløbene og i småpytter tæt ved G E U S 41

42 42 disse findes mange krebsdyr, som før nævnt, ofte i klynger i strømmende vand, mens antallet af dyr bliver stadig mere sparsom jo længere man bevæger sig ned mod fraløbet. Dette hænger godt sammen med at biofilmen tilsyneladende er mere veludviklet tæt ved tilløbet, hvor indholdet af suspenderet materiale i vandet bundfældes. Indsamles det bundfældede materiale ved tilløbene og undersøges dette i et mikroskop med påfaldende lys, findes en righoldig fauna der lever nedgravet i sedimentet, bla. bestående af juvenile Asellus aquaticus (figur 37), men også af mange andre typer dyr, se afsnit om disse dyr side 48. Figur 37. Juvenil Asellus aquaticus 0,8 mm, fundet i sediment Kan man fjerne krebsdyrene? En undersøgelse af både tilløbsrør og afløbsrør viste, at krebsdyrene findes begge steder (figur 38). Dette betyder, at det ikke er muligt at fjerne disse dyr fra systemet, selv man har haft held til at fjerne dyrene i selve tanken, da det ikke vil kunne lades sig gøre at fjerne bestanden fra ledningsnettet. Figur 38. Asellus aquaticus i et af fraløbsrørene i tank 2. Både fraløbs- og tilløbsrør er dækket af et gitter. Krebsdyret sidder på diagonalen gående fra nederste højre hjørne til øverste venstre. I Odense arbejder Sarah Christensen på en teori om, at Asellus aquaticus findes i større antal i jernrør end i plastrør ude i ledningssystemet, og at man derfor kan holde populationen nede ved at udskifte de gamle jernrør med nyere plastrør (pers. komm.). Dette kan måske også skyldes at plastrørene er glattere og ofte nyere og derfor ikke har de samme aflejringer af kalk på indersiden som jernrørene. Dyrene har derved bedre betingelser for at blive i jernrørene, hvor de bedre kan holde fast i ujævnheder, mens dyrene bliver skyllet ud G E U S 42

43 43 af plastrørene sammen med kalken i forbindelse med regelmæssige brandhaneudskylninger. Dyrene vil dog formodentlig stadig være til stede i plastrørene. Da mange tankanlæg er samlet af elementer, vil der være både større og mindre sprækker, der er tætnet med forskelligt tætningsmateriale. I forbindelse med disse tætninger vil der opstå små sprækker eller fordybninger, hvor krebsdyrene kan gemme sig (figur 39). Dyrene er formodentlig i stand til at overleve den kloring, som alle tankanlæg gennemgår når et anlæg renoveres eller renses. Figur 39. Revne mellem to elementer tætnet med tætningsmasse. I en lille fordybning mod øverste element omtrent i midten af fotografiet ses en lille Asellus aquaticus. Størrelsesfordeling Asellus aquaticus Ved indsamling af Asellus aquaticus i tankanlæg, blev krebsdyrene ved hhv. til- og fraløb indsamlet hver for sig. Efterfølgende blev en delmængde af disse dyr undersøgt og følgende parametre blev registreret: Kropslænge Længde af antenner Pigmenteringsgrad (1 ingen, 2 svagt, 3 mellem og 4 stærkt pigmenteret) Tilstedeværelse af fedt depot (1 intet synligt depot, 2 udviklet synligt depot) Antal Gennemsnit Maks længde Gennemsnit dyr længde i mm i mm længde/antenne fraløb 95 4,1 9 1,1 tilløb 64 5,4 10 1,7 Tabel 6. Gennemsnitlig længde af dyr fundet ved tilløb og fraløb, største kropslængde, gennemsnit af forhold mellem kropslængde og antennelængde. Iben Brüsch hjalp med at måle de indsamlede dyr. Efterfølgende blev data fra omtrent 160 dyr lagt ind i en database. 95 dyr var indsamlet ved fraløb mens 64 dyr var indsamlet ved tilløb til tankanlæggene (tabel 6). G E U S 43

44 andel i % Asellus aquaticus 44 Den gennemsnitlige kropslængde på de indsamlede dyr var 5,4 mm ved tilløbene, hvor vandet ledes ind i tankanlægget, mens længden var væsentligt mindre ved fraløb fra tankanlægget. Ikke overraskende var også længden af antenner længst ved tilløbet. tilløb- fraløb, længde af Asellus aquaticus tilløb fraløb til 1 1 til 2 2 til 3 3 til 4 4 til 5 5 til 6 6 til 7 7 til 8 8 til 9 9 til 10 længde i mm Figur 40. Andel Asellus aquaticus i forskellige længdeintervaller, (kropslængde) i to populationer samlet ved henholdsvis tilløb og fraløb. n-tilløb 64, n-fraløb 95, se også tabel 7. Interval Andel i % Antal dyr i mm tilløb fraløb tilløb fraløb 0 til 1 6,3 1, til 2 3,1 1, til 3 3,1 24, til 4 10,9 43, til 5 26,6 20, til 6 20,3 6, til 7 12,5 2, til 8 10,9 1, til 9 4,7 1, til 10 1,6 0,0 1 0 I alt Tabel 7. Andel dyr i forskellige størrelsesintervaller ved tilløb og fraløb. Gennemføres en frekvensopdeling af kropslænge for de to grupper Asellus aquaticus, viser det sig at, der er en markant forskel på størrelsesfordelingen, se figur 40 og tabel 7. Andelen af store dyr dominerer ved tilløbet i samme område, hvor der også er aflejret sediment. Dette kunne tyde på, at vækstvilkårene bliver dårligere for disse krebsdyr i takt med at drikkevandet bevæger sig gennem tankanlæggene, fordi dyrene er effektive ved afgræsning af den biofilm der forekommer på vægge og gulve, og som næres af det organiske materiale, der kommer ind med drikkevandet ved tilløbet. Denne formodning understøttes også af resultaterne af bakterie tællinger i tankens biofilm forekomster, se afsnit om bakterier. Denne iagttagelse viser måske også, at dyrene ikke er så bevægelige, som man skulle tro, når man undersøger dem i tanksystemerne, hvor dyrene relativt hurtigt forsøger at undvige fx lys fra stavlygter. Frekvensopdeles længen af antenner ses en modsat tendens (figur 41 og tabel 8), hvor andelen af lange antenner er størst for de dyr, der lever ved fraløbene, selvom disse dyr G E U S 44

45 Andel i % 45 generelt er mindre. En hypotese til at forklare denne forskel kunne være, at dyrene er i stand til at kompensere for en mere besværlig fødesøgning ved at udvikle længere antenner? En tidligere videnskabelig undersøgelse af differentiering af en Asellus aquaticus overflade-population i en svensk sø viste, at arten er meget plastisk og tilpasser sin morfologi til forskellige nicher i et givet levemiljø (Eroukhmanoff et al. 2009) Antenne længde tilløb/fraløb tilløb fraløb til 1 1 til 2 2 til 3 3 til 4 4 til 5 5 til 6 Længdeintervaller i mm Figur 41. Antenne længde opdelt i andel dyr med antennelængde i de viste længdeintervaller. N tilløb 42, n fraløb 72, se også tabel 8. Længdeinterval Andel i % Antal målinger i mm tilløb fraløb tilløb fraløb 0 til 1 11,9 1, til 2 66,7 6, til 3 14,3 23, til 4 7,1 47, til , til 6 0 2,8 0 2 Antal antenne målinger Tabel 8. Længden af antenner på Asellus aquaticus som andel dyr i de forskellige længdeintervaller og som antal dyr i længde intervallerne. Se figur 40. Der er ligeledes stor forskel på de enkelte dyrs grad af pigmentering. Tabel 9 viser fordelingen af dyr i de fire forskellige pigmenteringsklasser, og det fremgår at Asellus aquaticus uden pigmentering har en mindre kropslængde end de øvrige pigmenteringsklasser. Tilsvarende er antennerne ikke overraskende lidt mindre for dyr uden pigment. Forholdet mellem kropslængde og antennelængde viser sig at være stort set ens for alle fire pigmenteringsgrupper. Eksempler på Asellus aquaticus med varierende grader af pigmentering ses på figur 42, 43, 44 og 45. Pigmentering Antal dyr Gennemsnit længde i mm Gennemsnit længde antenner i mm Gennemsnit længde/antenne ingen 45 3,6 3,2 1,3 svagt 45 5,2 4,2 1,3 mellem 43 4,8 3,5 1,4 stærkt 25 5,3 4,2 1,3 Tabel 9. Pigmentering af Asellus aquaticus. Der er skelnet mellem fire pigmenteringsklasser: Ingen pigment, svagt pigmenteret, mellem pigmenteret og stærkt pigmenteret. Den gennemsnitlige længde, gennemsnitlig antenne længde og gennemsnitlig forhold mellem længde og antennelængde er vist for de fire klasser. G E U S 45

46 46 Figur 42. Dyr fundet i sediment, 1,5 til 3 mm lange. De hvide perler langs kroppen er formodentlig fedtdepoter. Dyrene er uden pigmenter. Figur 43. En lille Asellus i sit rette element. Når dyret bliver truet graver det sig ned i sedimentet, der også er substrat for næring. fedtdepot Antal dyr Gennemsnit længde i mm Gennemsnit antenner i mm ja 83 4,3 3,7 nej 75 5,0 3,6 Tabel 10. Fedtdepoter. Gennemsnitlig længde for dyr med og uden fedtdepoter, samt antal dyr og gennemsnitlig antennelængde. Opdeles dyrene i to grupper med og uden fedtdepoter (tabel 10) findes, at dyrene uden fedtdepoter har den største gennemsnitlig kropslængde, mens antenne længden for de to grupper tilsyneladende er ens. Figur 42 og 43 viser små pigmentløse gennemsigtige juvenile Asellus aquaticus. Denne størrelse dyr kan ikke fanges på flader eller i klyngerne med større dyr men ved at undersøge sedimentet/okkerslam, hvor denne størrelsesfraktion gemmer sig. G E U S 46

47 47 Anvendes de indekserede pigmenteringsværdier (tabel 11) ses, at dyrene ved fraløbet er lidt mindre pigmenteret, hvilket passer fint sammen med den mindre kropslængde. Det indekserede fedtdepot tal viser tilsvarende den modsatte tendens. Antal dyr Gennemsnit Gennemsnit Gennemsnit pigment tal fedtdepot tal længde i mm fraløb 95 2,2 1,3 4,1 tilløb 64 2,4 1,7 5,4 Tabel 11. Gennemsnitlig pigmenterings tal ved tilløb og fraløb (ingen pigment 1, svagt pigmenteret 2, mellem pigmenteret 3 og stærkt pigmenteret 4) og gennemsnitlig fedtdepot tal (intet depot -1, depot 2). Figur 44. Eksempler på voksne dyr med varierende pigmenteringsgrad. Det er tilsyneladende hannerne der er størst og oftest har den kraftigste pigmentering. Størrelse op til ca. 8 mm. G E U S 47

48 48 Figur 45. Tank 2, Asellus aquaticus med lange antenner. Dyret stammer fra fraløbet. Læg mærke til, at dyret mangler pigment og til de meget lange antenner. To til tre mm lange kroppe. Når sediment fra både tankanlæg og fra klaringsbeholdere undersøges i mikroskop findes ofte fritliggende æg som bla. stammer fra fertile Asellus aquaticus hunner, se figur 46 og 47. Hunnerne bærer æggene under brystpladerne (figur 47), men dyrene kan formodentlig tabe æggene, fx i stress situationer når en tank tømmes for vand. De fertile hunner der er fundet, har ret store æg i forhold til kropsstørrelsen, og antallet af æg er ikke særligt stort. Figur 46. Løse æg fundet i sediment formodentlig Asellus. Fra to forskellige tankanlæg. G E U S 48

49 49 Figur 47. Venstre: Asellus hun med æg under bryst plader. Foto til højre fra tank 3 indløb, læg mærke til at æggene under brystpladen er meget store i forhold til hunnen. Asellus aquaticus, indsamlet andre steder i landet I forbindelse med bestemmelse af DNA fra Asellus aquaticus blev der indsamlet dyr fra andre lokaliteter, bla. med venlig assistance fra Peter Wiberg-Larsen, DMU/ÅU der indsamlede krebsdyr i sin dam på Fyn, Sarah Christensen DTU, der leverede dyr fra Odense, Erling Nissen der indsamlede dyr i Århus og fra Martin Keller, der hjalp med at indsamlede Asellus aquaticus og andre dyr i en kalkkilde ved Tølløse. Figur 48. Fyn. Asellus aquaticus indsamlet af Peter Wiberg-Larsen i en dam på Fyn. Overfladevandsformen er stærkt pigmenteret har en kraftig krop. Figur 48, 49, 50, 51og 52 viser Asellus aquaticus indsamlet forskellige steder i Danmark. Der er slående hvor forskellige dyrene er. Fra de stærkt pigmenterede kraftige og lange overfladevandsformer der er fundet i en dam på Fyn (figur 48), til den lidt mere spinkle, men stadig ret kraftigt pigmenterede og meget store form fra Odense (figur 49). De indsamlede dyr fra en kalkkilde ved Tølløse(figur 50), er lidt mindre farvede og lidt mindre af kropsstørrelse. Asellus forekommer her sammen med ferskvandstangloppen Gammarus pulex, som formodentlig også kan findes i vandforsyninger, der indvinder grundvand fra højtliggende opsprækkede kalkmagasiner. Gammarus forekommer netop hyppigt i kilder, der springer ud i kalkområder. G E U S 49

50 50 Dyrene indfanget i Århus (figur 51) er fundet i en sedimentprøve og dyret fra figur 51 er en lille gennemsigtig farveløs juvenil form, der minder meget om den type dyr der lever i sediment i tankanlæggende i København. Figur 49. Odense. Asellus aquaticus indsamlet af Sarah Christensen, DTU, i en højdebeholder i Odense. Krebsdyret har gennem et års tid levet i et syltetøjsglas opbevaret i et kølerum. Dyret har levet af nogle blade og lidt sediment i bunden af glasset. Et stort ret kraftigt pigmenteret dyr, ca mm langt. Figur 50. Tølløse. Asellus aquaticus og Gammarus pulex indsamlet I en kilde der udspringer I et kalkflageområde ved Tølløse. Dyrene er indsamlet ca. 1,5-2 meter under terræn i samarbejde med Martin Keller. G E U S 50

51 51 Figur 51. Århus. Indsamlet af Erling Nissen Vandcenter Syd, og videregivet af Sarah Christensen, DTU. Venstre: lille næsten gennemsigtig Asellus på sediment bla. bestående af Asellus pellets. Se også figur 43. Højre: lille cyklopodia svømmende mellem Asellus pellets. En pellet er ca. 0,1 mm på tværs. Figur 52. Fårdrup. Asellus aquaticus. Fanget i en brønd der indvandt grundvand fra et grovkornet grundvandsmagasin ca. to meter under terræn. Grundvandsdyrene fra Fårdrup (figur 52) er oftest farveløse som dyrene i København, og Fårdrup dyrene minder af udseende meget om de mindre pigmenterede af disse. Andre dyr Ud over Asellus aquaticus er der fundet en lang række andre organismer i tanksystemerne i København. Fælles for disse dyr er, at de i overvejende grad kan findes i det sediment, der er aflejret omkring tilløbene i tankanlæggende. De lever infaunale i sedimentet, eller i tilknytning til den veludviklede biofilm i tilløbsenden af tankene. G E U S 51

52 52 Figur 53. Skaller fra ostracoder fundet i sediment, hvor der også findes en del levende eksemplarer. Foto til venstre tom skal. Højre: ostrakod fotograferet på sediment, hvor den fine fraktion ikke er fjernet ved renvaskning. Figur 53 og 54 viser dels 0,1 mm store skaller fra en muslingkrebs, en ostracod, der hyppigt findes i sedimentet, samt to levende ostracoder. De to levende tilhører ikke samme art som de to skalpar i figur 53. Skallerne på figur 53 er hårde, mens skallerne på de levende virker bløde, da disse klapper sammen, når dyrene udtørrer. Figur 54. Lille krebsdyr, muligvis ostracod. 0,5 mm stor, fundet svømmende i mellem sedimentkornene. Bryder sig tilsyneladende ikke om at opholde sig i den fri vandmasse. Når dyret tørrer ud, ses at skallerne er bløde da de klapper sammen. Højre fra akvarium med Asellus, 0,1 mm. Venstre: fundet i sediment fra tank. Af andre krebsdyr kan nævnes cyclopodia, som findes hyppigt i næsten alle sedimentprøver fra både tankanlæg og fra ledningssystemer. Figur 55 viser to små hvide eksemplarer fra både København og Århus. Begge er fundet svømmende rundt mellem pellets kornene i sedimentprøverne. G E U S 52

53 53 Figur 55. Venstre: Ganske lille cyklopodia, ca. 0,1 mm fundet i sediment fra bunden af akvarium med dyr fra København, med bund lag af groft grus dyret er besværligt at fotografere pga det stødvise bevægelsesmønster. Højre: cyklopodia fra Århus læg mærke til Asellus pellets der er ca. 0,1 x 0,1 mm. Der er også fundet et utal af andre forskellige mindre organismer i sedimenter, fx en amøbelignede organisme (figur 56) der findes hyppigt i anlæg der har været længe i drift. Orme af forskellige typer er også ganske hyppige, fx fladorme som minder lidt om små snegle, også fordi de tilsyneladende efterlader slim tråde, når de bevæger sig gennem sedimentet (figur 57). Dette kan dog også skyldes stress adfærd. Andre typer orme findes også hyppigt (figur 58), hvor en tubifix lignende orm, og to meget mindre rundorme ses. Figur 56. Lille dyr med maveindhold. 0,1 mm. G E U S 53

54 54 Figur til 7 mm lang vandlevende fladorm fundet i sedimentet i tank 1. Læg mærke til det sneglelignende spor som ormen efterlader. Højre foto lidt større orm/langstrakt fladorm ved at gemme sig i sediment, tank 1. Figur 58. Eksempler på orme fundet i sediment. Det kan være svært at finde disse orme, da ormene tilsyneladende hurtigt bliver ædt af Asellus, hvis orme og Asellus opbevares sammen. Øverst venstre: ganske tynd 1-2 mm lang orm fra tank 2. Øverst højre orm fra tank 1, ca. 6-7 mm lang. Nederst til venstre: 1,5 til 2 mm lang orm, tern er 1x1mm, tank 1. G E U S 54

55 55 Figur 59. Højre: Mulige enkrusterende kugleformede organismer, der danner en hård skal, formodentlig af kalk. Kalkskallen virker porøs. En anden mulighed er at der er tale om et 0,1-0,15 mm stort æg. Dette ligner dog ikke et Asellus æg. Venstre: en anden kugle fundet i samme prøve. Fundet i april 2009 tank 2. I nogle prøver forekommer der en del små 0,05 til 0,1 mm store æglignende kugler, der kan stamme fra fx cyclopodia der har tabt æggene fra ægsækkene, eller måske fra andre ægbærende dyr (figur 59). Nogle store amøbe lignede organismer er iagttaget, mens de tilsyneladende danner enkrusterende kugler, når organismen føler sig truet fx pga. udtørring. Disse kugler er porøse og perlemorsglinsende. G E U S 55

56 56 DNA fra Asellus aquaticus DNA-analyser Formålet (se bilag 1) med dette arbejde var 1. At udvikle en robust metode til DNA baseret karakterisering af rentvands- og grundvandsdyr som f.eks. Asellus aquaticus baseret på 18SrRNA sekventering. 2. At udvikle DNA-metoder med højere opløsning med henblik på at kunne skelne mellem beslægtede arter, samt 3. At forsøge at finde unikke genetiske markører, der tillader detektion af Asellus aquaticus i miljøer, hvor den ikke kan ses her tænkes i første omgang på analyser af tilbageskylningsslam. Hvis der gennem den første del af projektet kan findes specifikke markører, vil det blive undersøgt, om det er muligt at ekstrahere DNA af høj kvalitet fra sedimentprøver. Prøvetagning Indsamling af dyr og filtersediment-materiale blev foretaget under flere separate prøvetagninger. De Asellus aquaticus eksemplarer, der indgik i undersøgelsen, var indsamlet hhv. fra HOFOR s rentvandstanke (højdebeholdere) i Gladsaxe samt fra ledningssystemer i Odense og Århus (af Sarah Christensen, DTU og af Århus Vandforsyning). GEUS indfangede desuden fritlevende A. aquaticus fra et kalkvæld i Tølløse, og Peter Wiberg-Larsen, Seniorrådgiver DMU-AU, indsamlede dyr fra en fynsk havedam. Disse overfladeformer fra dammen af A. aquaticus er medtaget i analyserne, for at skabe en forståelse af diversiteten inden for arten, samt for at sikre, at den anvendte metode var tilstrækkelig sensitiv til at kunne adskille enkelt-populationer fra hverandre. DNA-ekstraktion DNA fra de indsamlede dyr blev ekstraheret med et ekstraktions kit fra Mobio: UltraClean Tissue & Cells DNA Kit (No ). Arvematerialet fra hvert dyr, der er medtaget i analysen blev ekstraheret og analyseret for sig (figur 60). G E U S 56

57 57 A B C Figur 60. Illustrerer Asellus + arvemateriale. Illustrationer tv. Af hhv. Walter Brüsch (A), College of DuPage-IL (B) og 3dscience på en.wikipedia (C). Den første opgave gik ud på at finde en DNA-sekvens, der var tilpas variabel inden for arten Asellus aquaticus, men også tilpas evolutionært stabil (med få mutationer), så sekvensen ikke varierer inden for en population. Derefter er det vigtigt at designe primere, så de rammer et udvalgt område i DNA-strengen, der er selektivt for Asellus DNA. Primere er korte DNA-stykker, der binder sig til hver sin ende af den DNA-streng, man ønsker at opformere, se figur 61. PCR-reaktion Figur 61. Principperne bag PCR: Opformering af en gén-sekvens ved hjælp af to kendte primere, der består af korte DNA-stykker, der binder sig til hver sin ende af den DNAstreng, man ønsker opformeret. G E U S 57

58 58 Der findes store Databaser, med data-samlinger over de DNA-sekvenser, der hidtil er publiceret internationalt, eksempelvis GenBank (www.ncbi.nlm.nih.gov/). Heri kan man orientere sig om hvilke gener, der allerede er sekventeret for den eller de organismer, man interesserer sig for. Eftersom gener, der koder for protein-syntese organeller (også kaldet ribosomer), findes i højt antal hos både bakterier, svampe, planter og dyr, har disse historisk været anvendt til molekylær bestemmelse af arter. Der findes således mange tilgængelige sekvenser for disse gener, både for Asellus aquaticus, dens nærmeste slægtninge, samt alle øvrige organismer, vi kan forvente at finde i de danske vandforsyningssystemer og i dansk grundvand (se eksempelvis tabel 12). Tabel 12. Tabel over længde og variable regioner af 18S ribosomale del af ribosomet hos en række arter (A. aquaticus i grøn markering). Tabel efter Mattern & Schlegel (2001). Analyse af Asellus aquaticus ribosomale 18S DNA-sekvenser En analyse af et dyrs gensekvens for den ribomale 18S enhed kan bruges til med sikkerhed at identificere et dyr eller fragmenter af et dyr som tilhørende arten Asellus aquaticus. Analyse af 18S ribosomale DNA sekvenser fra 16 Asellus aquaticus individer indsamlet i København, gav helt identiske sekvenser for alle de analyserede dyr (figur 62). Genet er derfor meget stabilt inden for arten, og kan følgelig ikke bruges til at kortlægge enkelt populationers udbredelse. Dertil skal bruges mere variable DNA-sekvenser. Efterfølgende ledte vi efter et gen, der har lidt større variation inden for arten Asellus aquaticus. Valget faldt på genet, der koder for mitochondrielt cytochrome oxidase 1 enzymet (CO1). Mitochondrielt cytochrome oxidase er et enzym der produceres ved cellers respiration. G E U S 58

59 DNA-Markør WB 1 WB 2 WB 3 WB 4 WB 5 WB 6 WB 7 WB 8 DNA-Markør 59 A B 2323 bp 1929 bp 18S rdna PCR produkt C Figur 62. Til ventre (A) ses en elektroforese-gel af de opformerede 18S rdna PCR produkter fra 8 dyr (WB1-WB8). 18S rdna genet er hos Asellus aquaticus omtrent basepar langt. At PCR-produkterne har den rette længde fremgår af sammenligning med en standard-dna markør yderst til højre og venstre i gelen. Efter verifikation på en gel, oprenses PCR-produktet og sendes til sekventering. Resultatet aflæses af et chromatogram (B) der viser rækkefølgen af de fire baser i gensekvensen. (C) viser en grafisk sammenligning af et stykke af 16 Asellus aquaticus 18S rdna sekvens. De 16 dyr er indfanget i to højdebeholdere i Københavnsområdet. (C) viser et eksempel på en grafisk fremstilling af DNA sekvensen for et af de 16 identiske dyr. Analyse af dyrenes mitochondrielle CO1-sekvenser Fuld CO1 sekvens for 54 dyr indsamlet fra HOFOR, Vandcenter Syd, Århus, Tølløse, samt overfladeformer fra Fyn blev opformeret med universelle CO1 primere fra Folmer et al. (1994), og derefter sekventeret hos det tyske firma AGOWA (agowa.de). De fulde CO1 sekvenser blev derefter, sammen med yderligere tæt beslægtede (outgroup) sekvenser fra GenBank inkluderet i analysen. Resultatet viste, at det var muligt, at identificere enkeltpopulationer af Asellus aquaticus og adskille dem fra hinanden. Nedenstående figur D viser, at genet er velegnet til en sådan adskillelse af enkelt-populationer. Det fremgår af dendrogrammet (figur 63), at der i HOFORs tanke kun er tale om én enkelt population (orange gruppe), idet dyrene har fuldstændig ens arvemateriale. Til gengæld falder dyrene, der er indsamlet i ledningssystemet i Odense (Fyn vs), ud i to grupper (mellemblå og pink gruppe). Det vil sige, at vi temmelig sikkert kan slå fast, at der er tale om to individuelle populationer, der formentlig har forskellig oprindelse. Dyrene stammer derfor formentlig fra to forskellige lokaliteter og er kommet ind i drikkevandssystemet ved to uafhængige hændelser. Kun et enkelt dyr fra Århus var tilstrækkelig velbevaret til at vi kunne ekstrahere rent DNA fra dyret. Dette dyr falder i sin egen gruppe, og adskiller sig derfor fra de øvrige dyr (markeret med grønt). De indsamlede dyr fra Tølløse kalkkilde har også identisk arvemateriale og udgør derfor én samlet population (gul markering), mens det sidste indsamlingssted, en havedam på Fyn, viser sig at indeholder hele tre forskellige populationer (markeret med hhv. lyseblå, mørkeblå og lavendel). G E U S 59

60 60 UPGMA topology B-GenBank C-GenBank A-GenBank 24- Tank 4-KE Male-Pigm-L 23- Tank 4-KE Fem-nonPigm-L 22- Tank 4-KE Fem-nonPigm-S-round 21- Tank 4-KE Male-Pigm-L 20- Tank 4-KE Fem-nonPigm-S+eggs 19- Tank 4-KE Fem-Pigm-L 17- Tank 2-KE Fem-Pigm-L 15- Tank 2-KE Fem-Pigm-S+eggs 12- Tank 2-KE Fem-Pigm-L+egss 8- Tank 2-KE Fem-Pigm-L 21- Toelloese 22- Toelloese 23- Toelloese 24- Toelloese 25- Toelloese 26- Toelloese 28- Toelloese 30- Toelloese 50- Aarhus ledning 3- Overflade Fyn 7- Overflade Fyn 11- Overflade Fyn 13- Overflade Fyn 15- Overflade Fyn 43- Fyn vs 46- Fyn vs 49- Fyn vs 14- Overflade Fyn 18- Overflade Fyn 10- Overflade Fyn 2- Overflade Fyn 1- Overflade Fyn 4- Overflade Fyn 5- Overflade Fyn 6- Overflade Fyn 8- Overflade Fyn 9- Overflade Fyn 12- Overflade Fyn 16- Overflade Fyn 17- Overflade Fyn 19- Overflade Fyn 20- Overflade Fyn 44- Fyn vs 45- Fyn vs 47- Fyn vs 48- Fyn vs 52- Aarhus ledning Figur 63. Dendrogram over CO1 sekvenserne, der viser hvordan dyrene grupperer fint efter indfangningssted. Rød gruppe: Refererence-sekvenser fra GenBank. Orange gruppe: Dyr indfanget i to højdebeholdere i København. Gul gruppe: Dyr fra kalkkilde i Tølløse. Grøn gruppe: Århus ledningsnet. Lyseblå gruppe: Del-population fra fynsk havedam. Mellemblå gruppe: Dyr fra Vandcenter Syds Vandforsynings ledningsnet. Mørkeblå gruppe: Delpopulation fra fynsk havedam. Lavendel gruppe: Del-population fra fynsk havedam. Pink gruppe: Dyr fra Odense Vandforsynings ledningsnet. G E U S 60

61 61 Sammenligningen af DNA fra dyr indsamlet i overfladevand, kilder/grundvand samt fra vandforsyningerne viser, at alle dyrene er nært beslægtede, idet de kun adskilles af få enkeltmutationer i arvematerialet. Det er relativt få base-substitutioner i DNA et, der adskiller de individuelle populationer. Kun 16 positioner af 617 baser varierer (figur 64). Figur 64. Grafisk præsentation af variationerne af CO1-genet hos 51 Asellus aquaticus individer, der er inkluderet i vores analyse. Det er relativt få base-substitutioner i DNA et, der adskiller de individuelle populationer. Kun 16 positioner af 617 baser variere. Basesubstitueringen ses ved farveskifter i 16 positioner ud af de viste 617 rækker (for folk over 50 er det en god ide at forstørre figuren, hvorved farveskifterne i de 16 rækker fremtræder mere tydeligt) Konklusionen på DNA analysen er, at den kan anvendes til at skelne detaljeret mellem forskellige populationer af Asellus aquaticus. DNA analyserne kan dog ikke på grundlag af det indsamlede materiale anvendes til at fastslå oprindelsen af en population i et vandforsyningssystem, fx overfladevand vs. grundvand. Såfremt de forskellige slægtskaber ønskes vurderet nærmere, bør der gennemføres yderligere undersøgelser, hvor der fokuseres på andre dele af dyrenes arvemateriale, samt udføres en udvidet indsamling af dyr fra mulige oprindelses lokaliteter. Kun derigennem kan populationernes oprindelse sandsynliggøres. G E U S 61

62 62 Sedimentprøver fra vandindvindingsanlæg Sedimentprøverne blev indsamlet fra forskellige typer lokaliteter. På Fyn blev prøverne indsamlet i tre anlæg der opsamler og bundfælder tilbageskylsmateriale fra sandfiltrene. Denne tilbageskylning sker regelmæssigt som en del af vedligeholdelse af sandfiltrene der anvendes til at fjerne jern fra vandværksvandet. Alle prøver blev indsamlet i underjordiske opsamlingsanlæg. På Sjælland stammer prøverne fra filtermateriale, fra vakuum beholdere placeret mellem indvindingsboringer og vandværkerne og fra efterbehandlingsanlæg. En detaljeret beskrivelse af de mikroskoperede prøver kan findes i bilag 3, mens den udarbejdede vejledning i prøveudtagning findes i bilag 2. Sedimentprøverne blev undersøgt med et Wild-Heeburg mikroskop med påfaldende lys. De fundne skal fragmenter, æg og smådyr mm blev fotograferet digitalt. Nogle fragmenter flyder oven på opslæmningen af prøverne pga. overfladespænding. Disse fragmenter blev først indsamlet og fotograferet. Dernæst blev det mest finkornede af prøven fjernet ved at lave en opslæmning med rent postevand. Denne proces blev gentaget adskillige gange, og prøverne blev undersøgt mellem hvert trin. Til slut var der opkoncentreret et residual af de groveste fragmenter bla. filter grus og større skalfragmenter. Figur 65. De undersøgte lokaliteter. DNA fund er vist som beregnet antal dyr pr kg sediment. Læg mærke til at næsten alle anlæg er placeret ved vandløb, hvilket særligt tidligere var normalt når man placerede indvindings boringer, for man tilstræbte at lægge indvindingsboringerne i områder med en opad rettet grundvandsstrømning som man finder i ådalene under vandløbene. G E U S 62

63 63 Prøver fra Fyn På Fyn blev der fundet levende cyclops og små levende ostrakoder, samt afrevne lemmer fra krebsdyr i de tre prøver fra klaringstankene med skyllevand. I særlig grad fra hovedværket i Odense og i mindre grad fra Lundeværket. I Lindved er sedimentet fattigt på genkendelige rester, men der blev fundet et æg og noget, som kan være pellets. Der er ikke fundet pellets fra Asellus aquaticus Hvis der har forekommet pellets, bliver de tilsyneladende slået i stykker af de kraftige og hurtigløbende pumper, der anvendes ved returskylning af filterne. Ved en gentagen prøvetagning skal der derfor også udtages prøver fra sandfiltrene i værket, når der returskylles. Til gengæld er der fundet nogle ganske små pellets, der hidrører fra andre dyr. Prøvelokaliteternes beliggenhed og det beregnede antal dyr pr kg sediment fremgår af figur 65 og tabel 13. Prøver fra Sjælland På Sjælland blev der ikke fundet levende Asellus aquaticus i de undersøgte prøver, men der var spor efter Asellus aquaticus i nogle af prøverne, hvor der blev fundet pellets, omsatte fragmenter, der kan stamme fra krebsdyr, samt en del spikler/små fragmenter. I mange prøver blev der fundet tråd formet vækst af bakterier, hvor bakterierne var hæftet til grus partikler fra det biologisk aktive jernfilter. I nogle at prøverne blev der også fundet små orme, mulige æg, ostracoder mm. I forhold til prøverne fra Fyn indeholder de sjællandske prøverne ikke så mange levende organismer eller så mange spor efter disse, og sedimenterne fremtræder som et temmelig ugæstfrit miljø. På trods af dette er der fundet DNA fra Asellus aquaticus i samtlige sedimentprøver, se tabel 13, der indeholder en opsummering af de mest karakteristiske egenskaber ved de undersøgte sedimentprøver. G E U S 63

64 Fyn Sjælland antal dyr pr kg sediment sediment virker "dødt" æg Andre dyr bakterie tråde Andre pellets asellus pellets Asellus hel/ fragment Fint sediment Grus 64 Beskrivelse af sedimentprøve Lokalitet Slangerup filtersediment Strø Vakuum beholder Attemose St. 1 Æbelholt Vakuum beh nej ja nej muligvis ja ja ostracod nej ja 0,16 nej nej nej Suspenderet ganske lidt fint sediment nej nej nej nej nej, muligvis spikler nej ja 0,03 nej nej ja ja nej nej nej 0,1 SØSØ EF2 ja ja nej nej slidte pellets små SØSØ EF3 ja ja nej nej muligvis muligvis muligvis ja ja orme, ostracoder, skalfragmenter masser SØSØ EF5 ja ja nej nej nej ja mange ja nej nej 0,12 nej nej nej 1,42 spikler muligvis Asellus spikler muligvis SØSØ EF8 Bogøgård Vak-beh Attemose Vakbeh Lindved værket Lunde værket, nyt Odense Hovedværk, gammelt ja Asellus SØSØ EF7 ja ja nej muligvis ja ja ostracod, ben fragmenter Asellus enkelte nedbrudte rester nedbrudte? ja ja skalfragmenter ja ja 0,38 nej nej 0,42 nej nej 2,08 nej nej 0,84 klart vand lidt fnuller 0 klart vand 0 ja ja 32,3 5 nej ja ja nej nej ja, få ja skalfragmenter formodentlig fra filter grus ja ja muligvis nej få ja ja, ben fragmenter og gennemsigtige skjold fragmenter ja ja ja muligvis ja ja ja levende cyclops og ostracoder delvist 0,31 ja nej 0,32 Tabel 13. Udvalgte parametre fra beskrivelsen af sedimentprøver fra Sjælland(HOFOR) og Fyn (Vandcenter Syd). Se bilag 3 for en detaljeret beskrivelse. G E U S 64

65 65 DNA i sedimentprøver udtaget fra boringer ved Marbjerg, Strø og Attemose GEUS har som opfølgning på projektet i samarbejde med Hovedstadsområdets Forsyningsselskab, HOFOR, tidligere Københavns Energi (KE), udtaget sediment prøver fra bunden af fem boringer udvalgt af HOFOR beliggende på Marbjerg Kildeplads (tabel 14 og tabel 16) og efterfølgende fra fire boringer placeret på kildepladserne Strø og Attemose. Prøverne er udtaget for at teste, om der er DNA fra Assellus aquaticus i sedimenterne. Prøveudtagningen ved Marbjerg kildeplads blev gennemført i marts 2012, mens prøverne fra Strø og Attemose blev udtaget i oktober 2012 Boring HOFOR nr DGU nr dybde fra Jupiter Dybde til vsp dybde HOF- OR diameter filter Bemærkninger observationer fra video 8A ,7 4,5 225 mm slam og sand - ingen bundbillede, men aflejringer på filter 9A ,3 4 do bund belagt med slam- filter meget belagt med okker 10A ,5 47,05 6,3 do bund belagt med slam- "kun" slam på bunden 11A ,48 6,65 do bund belagt med slam- "kun" slam på bunden 14A ,7 5,4 do sand og slam på bund- lidt slam+sand på bund Tabel 14. De fem boringer der er prøvetaget med observationer fra video fra HOFOR. Prøvetagning i boringer ved Marbjerg. Før prøvetagningen d. 15. marts 2012 havde HOFOR to gange forsøgt at udtage prøver med to sæt sediment prøvetagere som GEUS havde fremstillet. På grund af manglede succes med prøvetagerne blev det besluttet at udtage sedimentprøverne med en 8/10 mm plastslange tilsluttet en vakuum pumpe, hvor slangen ved hjælp af et lod blev trukket ned til boringernes bund. For at undgår krydskontaminering mellem de enkelte boringer blev der anvendt en ny slange i hver boring. Selv om vandspejlet lå tæt ved terræn viste det sig, at løftehøjden var for stor, når det skulle pumpes en blanding af slam/sediment op fra bunden af boringerne (tabel 14). Slangerne blev derfor afproppet i den ene ende, før slangens åbne ende blev sænket ned til boringernes bund. Efter den åbne ende var placeret ved boringernes bund blev proppen ved terræn fjernet. Da boringerne er ca. 50 meter dybe med et vandspejl beliggende tre til fire til meter under terræn, blev sedimentet fra bunden af boringerne skudt op i slangerne med et tryk svarende til 45 meters vandsøjle (4,5 bar). Før slangen blev trukket op til overfladen, blev den åbne ende ved terræn koblet på en vakuum pumpe, således at sedimentet i den nederste del af slangen blev fastholdt under optrækningen. For at trykke sedimentet ud af slangerne blev der efterfølgende anvendt trykluft. Prøverne blev opsamlet i to liters glasflasker som under opsamlingen af sediment blev tømt for overskydende klart vand. Flaskerne blev opbevaret i køletasker og efterfølgende under køl indtil oprensningen af prøverne fandt sted. Der blev anvendt samme analysemetode der er udviklet i forbindelse med projektet. Hvor man ved hjælp af tre genetiske markører kan påvise DNA fra Asellus aquaticus. G E U S 65

66 66 Resultater, Marbjerg Der blev ikke fundet DNA fra Asellus aquaticus i de indsamlede prøver fra Marbjerg (tabel 15). Prøverne er indsamlet i boringer, hvor der muligvis ikke er velegnede livsbetingelser for Asellus aquaticus i de dybere dele af magasinet. Indtagene er placeret i grundvand med op til 1,7 mg opløst jern pr. liter og med små eller ingen mængder opløst ilt, og det er derfor muligt at krebsdyrene kan findes i det øvre iltholdige grundvand ved siden af det vandløb, hvor kildepladsen er placeret, men ikke i de dybder, hvor indtagene i boringerne er placeret og hvor livsbetingelserne er dårlige, se tabel 15. Boring KEnr DGUnr dybde til Vsp 03/12 Bund 03/12 DNA A. aquaticus Fe++/O2 i mg/l Beliggenhed 8A ,2 mut 51 intet spor 0,94/0,07 ligger i sumpet terræn 0,7/0,1 9A ,01 mut 49 intet spor 0,12/0,05 ligger over vådområde 0,075/0,07 10A ,05 mut 49,1 intet spor 0,6/0,09 på lille høj 0,5/0,05 11A ,44 mut 48,8 intet spor 1,7/0,011 på tørt område 0,9/0,05 14A ,06 mut 49,5 intet spor 1,2/0,04 på tørt område 1,5/0,05 Tabel 15. Resultater fra DNA analyser af de indsamlede sedimentprøver fra Marbjerg Kildeplads. Tabellen viser også de målte dybder til vandspejlet d Der er gennemført to boringskontrolanalyser i boringerne. Jern og ilt analyser stammer fra januar-juni 2006 og fra juli Den øverste analyse for opløst jern/ilt i hver boring er den ældste. Prøvetagning i boringer ved Strø og Attemose D. 10. oktober 2012 blev der udtaget to prøver fra bunden af fire boringer i forbindelse med opskylning og oprensning af boringerne. Der blev udvalgt boringer beliggende i oplande, hvor der tidligere blev fundet DNA fra Asellus aquaticus i vakuum beholdere i ledningssystemet, se tabel 13. Prøverne blev udtaget fra Strø boring S 5a, Strø boring S 11a, Attemose boring S 36 og Attemose boring S 29a (tabel 16 og 17). De fire boringer blev opskyllet fra bunden ved hjælp af kompressor med spuledyse. Vandet fra opskylningen blev opsamlet i kar på l, der for hver boring blev foret med ny plast. Der blev prøvetaget to gange i forbindelse med hver opskylning, hvor der blev opsamlet bundslam i rengjorte flasker fra karret. Resultater Strø og Attemose Der blev ikke fundet kvantificerbart DNA i de 8 prøver fra de fire boringer med den nyudviklede metode, hvor man kan beregne antal dyr/gram sediment. Denne metode har en detektionsgrænse på 5*10-4. Nested PCR har en langt større følsomhed, og denne metoden er gange mere følsom end metoden, hvor antallet af dyr kan vurderes. Metoden kan anvendes til at afgøre, om der er DNA fra Asellus aquaticus til stede i sedimentet, men ikke hvilket antal dyr, der forekommer pr. gram sediment. 8 sediment prøver fra de fire boringer blev undersøgt med Nested PCR, og resultaterne viser fund af DNA fra Asellus aquaticus i tre prøver udtaget fra to boringer ud af de fire un- G E U S 66

67 67 dersøgte (tabel 16). De to boringer med fund af Asellus aquaticus DNA ligger i to oplande, hvor der tidligere er påvist DNA fra Asellus aquaticus i trykbeholdere i ledningssystemet efter indvindingsboringerne. Pr nr Boring nr DGUnr Afvejet (g) Fund 1 Strø S5A ,2731 N/A 2 Strø S5A 0,2536 1,00E-04 til 1,00E-03 dyr/g 3 Strø 11A ,2709 N/A 4 Strø 11A 0,2817 N/A 5 Attemose S29A ,222 N/A 6 Attemose S29A 0,2871 N/A 7 Attemose S ,2557 1,00E-04 til 1,00E-03 dyr/g 8 Attemose S36 0,2891 1,00E-04 til 1,00E-03 dyr/g Tabel 16. Strø og Attemose. Fund bekræftet ved PCR- kørsel på Clean Up produkt. De afvejede prøvers vægt er i gram. N/A - der ikke er DNA og at prøven er analyseret. Boring Fund DGUnr Dybde Indtag Jern og ilt i vandprøver Jer n Ilt Bor alder Udtag. år Udtag. år Strø S5A intet til ,6 0, ,2 0,2 fund 38 Strø S5A DNA ,6 0, ,7 0,8 6 Strø 11A intet til ,9 0, ,9 0,1 fund Strø 11A intet , ,8 fund 8 Attemose S29A intet fund ,5 26 til 36, ,0 9 Attemose S29A intet fund Attemose S36 DNA ,7 26 til ,5 0, ,4 0,0 9 Attemose S36 DNA ,4 0, ,5 0,2 2 Tabel 17. De fire boringers DGUnr, alder, dybde og filtersætning samt udvalgte analyser af opløst jern og ilt. Udtag. år det år vandprøven blev udtaget og hvor analysen blev gennemført. De fire boringer er omkring 40 meter dybe (tabel 17) og boringerne er filtersat i den nedre del af boringerne med indtag der er op til 13 meter lange. Vandet i boringernes indtag stammer derfor fra et stort interval i magasinerne. Der er i de to boringer med fund fundet opløst jern og i nogle tilfælde ret høje iltkoncentrationer. At der findes både opløst jern og ilt i de analyserede vandprøver kan skyldes, at der sker en opblanding af forskellige vandtyper i indtagene, eller at der kan trækkes grundvand fra de øver dele af magasinerne ned til indtagene under prøvetagningen. Selv om der er en vis usikkerhed forbundet med at måle ilt i grundvand er de målte koncentrationer så høje at de må anses for valide. Asellus aquaticus kan, som tidligere beskrevet, overleve i grundvand med små koncentrationer af ilt på 0,25mg/l og i perioder mindre. I begge boringer med fund viser tidsserierne for ilt (figur 66), at mængden af opløst ilt varierer meget gennem tid og at koncentrationerne i perioder overstiger en mg/l, mens jernkoncentrationen i boring er mere stabil, bortset fra en outlier der formodentlig er en fejlmåling. I stiger jernindholdet fra 2000 til 2011, mens iltindholdet varierer meget. Dette tyder på, at der opblandes flere vandtyper i de to indtag. Jer n Ilt G E U S 67

68 68 Figur 66. Ilt og opløst jern i grundvand fra boring og Der er anvendt forskellige skalaer for bøde x og y akser. Konklusion, sedimentprøver fra boringer Det var ikke muligt at bestemme antallet af dyr pr gram sediment i de undersøgte sedimentprøver udtaget fra bunden af boringer ved Marbjerg, Strø og Attemose. Der blev dog påvist DNA fra Asellus aquaticus i to boringer beliggende i Strø og Attemose, hvilket viser, at Asellus aquaticus kan forekomme i det grundvand, som boringernes indtag er sat i. Da disse dyr kun forekommer sjældent i grundvand, var det ikke muligt at kvantificere antal dyr pr gram opsamlet sediment. Ved en renpumpning af en boring tilhørende TREFOR Vand a/s blev der observeret et grundvandsdyr af ukendt art, som bevægede sig op fra en sprække i bunden af den renpumpede boring for efter en periode dernæst igen at kravle ned i sprækken, se bilag 4. Der er tale om en ny art som ikke tidligere er observeret i Danmark, og det kan ikke udelukkes at der er tale om en art, der kun findes i Danmark. G E U S 68

69 69 Udvikling af analysemetode for DNA i sedimentprøver Ifølge projektbeskrivelsen, (bilag 1), var den tredje opgave, der skulle løses: at finde unikke genetiske markører, der tillader detektion af Asellus aquaticus i miljøer, hvor det ikke kan ses her tænkes i første omgang på analyser af tilbage-skylningsslam. Hvis der gennem den første del af projektet kan findes specifikke markører, vil det blive undersøgt, om det er muligt at ekstrahere DNA af høj kvalitet fra sedimentprøver. Resultaterne af CO1 sekvensanalyserne, beskrevet under afsnittet Analyse af dyrenes mitochondrielle CO1-sekvenser (se s. 55), blev efter den sammenlignende analyse anvendt til at designe unikke gen-markører (kaldet primere) for Asellus aquaticus. Arbejdet med at finde unikke markører foregår ved computeren og kræver anvendelse af en række molekylære software-programmer. Ved at sammenholde gensekvenser for Asellus aquaticus med andre nært beslægtede og fjernere beslægtede arter, er det muligt at finde mulige unikke gen-markører for en enkelt dyreart. I GenBank (www.ncbi.nlm.nih.gov/genbank ) afprøves specificiteten af de fundne sekvenser ved en sammenligning med alle kendte gen-sekvenser, der er indeholdt i databanken. Herved fås yderligere indikation af gen-markørens specificitet for arten og det gen, man ønsker at analysere for. Selvom disse forberedende undersøgelser af de udvalgte markører viser sig lovende, forestår et stort arbejde med at verificere markørernes specificitet i laboratoriet. Følgende arbejde skal udføres i laboratoriet: 1. Valg og test af primer kombination (se også figur B om PCR). Her ønsker man at finde to primer sekvenser, der ligner hinanden mht. smeltepunkt (hvornår DNA strengene adskilles), og som ikke klistrer til hinanden under PCR-reaktionen, hvilket ville forhindre opformeringen. Kombinationen af primere bestemmer også længden af den opformerede DNA-sekvens. Den optimale længde for et stykke DNA, der ønskes amplificeret ved qpcr er basepar. 2. Udvikling af DNA standarder til kvantitativ bestemmelse af DNA indhold i sedimentprøver fra vandforsyningerne. 3. Optimering af betingelserne for primernes DNA amplifikation. Under denne fase testes forskellige PCR-opskrifter, og temperatur og antal cyklusser varieres for at få det bedste kvantitative og kvalitative resultat. Dette arbejde blev udført som gentagne PCR-kørsler på rent DNA ekstraheret fra Asellus aquaticus samt fra DNA ekstraheret fra bundfald i et akvarium, hvori Asellus aquaticus havde gået i adskillige måneder (positiv kontrol). Desuden medtog vi i optimeringen separate DNAprøver fra en Gammarus sp. (negativ kontrol). Gammarus DNA skulle ikke gerne opformeres af de udvalgte primere. 4. Test af primernes opformering af DNA fra blandede sediment prøver. I dette tilfælde anvendtes DNA-prøver fra filterslam (se nedenfor). I sådanne sedimentprøver findes DNA fra millioner af bakterier, svampe og dyr i en skøn blanding. Her skal specificiteten af et primer-sæt stå sin endelige prøve. Selvom der i GenBank også ligger et meget stort antal sekvenser, er det kun en brøkdel af den naturlige genvariation, der hidtil er sekventeret. Et lovende primersæt kan derfor sagtens vise sig, at opformere flere ukendte sekvenser i en prøve, og primersættet vil derefter ikke kunne anvendes til hverken kvalitative eller kvantitative analyser. 5. Det opformerede DNA-materiale sendes til sekventering i Tyskland (med eller uden et kloningstrin) for at sikre sig, at alene det ønskede genstykke er blevet opformeret. G E U S 69

70 70 Udvikling af ny analysemetode Som beskrevet i bilag 2 blev sediment fra tilbageskylning af primære sandfiltre og fra hydroforer indsamlet af HOFORs personale på 11 lokaliteter i HOFORs indvindingsområde. Desuden medtoges prøver fra tre fynske værkers klaringstanke for returskyllevand, hhv. Odense Hovedværk, Lindved og Lundeværket. DNA fra sedimentprøverne indsamlet fra vandindvindingsanlæggene (og før disse) blev ekstraheret med Mobios Powersoil DNA Kit (No ). Prøvestørrelsen for hver ekstraktion var 250 mg sediment. I tilfælde, hvor sedimentet indeholdt meget væske, blev den samlede prøve centrifugeret i 10 minutter og dekanteret for at opkoncentrere materialet. For to af prøverne (Bogøgård vakuum-beholder samt Attemose vakuum-beholder) var indholdet af materiale så sparsomt, at DNA blev forsøgt ekstraheret med et ekstraktions kit beregnet til vandprøver, Mobio UltraClean Water ( NF). Disse to prøver gav dog efterfølgende negativt resultat i analyserne for tilstedeværelse af Asellus aquaticus formodentlig pga manglende materiale. Udvikling af Asellus aquaticus specifikke primere Fuld CO1-sekvens fra 52 dyr blev analyseret med universelle primere fra Folmer et al (1994), og derefter sekventeret hos AGOWA. De fulde sekvenser blev derefter, sammen med yderligere nært og fjernt beslægtede (outgroup) sekvenser fra GenBank brugt til at identificere mulige arts-specifikke primere indenfor genet. I tabel 14 gives en liste over de primere, der blev elektronisk testede for deres specificitet overfor alle kendte DNA-sekvenser i GenBank. Hvis fuldstændig specificitet overfor den ønskede sekvens bekræftes ved elektronisk PCR, gives en indikation af, at primer-sekvensen er specifik overfor det DNA, der ønskes opformeret. Der kræves dog efterfølgende test af primernes faktiske specificitet, særligt når der arbejdes med DNA fra sedimentprøver, idet de fleste DNA-sekvenser endnu ikke er kortlagt (jfr. tekst ovenfor). Primer navn Position på CO1 genet Sekvens Specificitet Artsspecifik 1F 27F CAGGGTAGGAACTGCTCTTAGTA 5/23 b 2F 72F ACAACCTGGTAGATTTATTGGCA 5/23 b 3F 183F AAATTGATTAATTCCCCTAATGC 6/23 b 4F 252F CTGACTATTACCTCCTTCTCTAACCC 7/26 b 5F 259F TTACCTCCTTCTCTAACCCTGCTC 9/24 b 6F 273F AACCCTGCTCCTGTCTAGGGGG 10/22 b ja 7F 312F AGGAACTGGCTGAACAGTGTAT 6/21 b ja 8F 363F TGGTCCTTCTGTAGATTTAGGA 5/22 b ja 9F 393F TTTACACTTAGCTGGGGCTAGT 7/22 b ja 10F 486F GGTTCCTTTGTTTGTGTGGTCA 5/22 b 11F 534F ACTTTCTCTACCTGTGTTAGCC 7/22 b 12F 557F CGGGGCCATTACTATATTACTT 7/22 b 13F 612F CCCCAGGGGAGGAGGAGAC 7/19 b 9R 415R ACTAGCCCCAGCTAAGTGTAAAGA 7/24 b ja Tabel 18. Oversigt over mulige primere og deres artsspecificitet for Asellus aquaticus, testet ved hjælp af elektronisk PCR i GenBank. Sekvenserne der er markeret med gult (6F, 7F, 9R) er arts specifikke og derfor testet som primere. Den blå sekvens er ligeledes arts specifik og anvendt som probe (8F). G E U S 70

71 71 Ud fra resultatet af den elektroniske test, se tabel 18 og figur 67, blev det besluttet at hjemkøbe primerne 6F, 7F og 9R. Desuden blev det besluttet at hjemtage primer 8F som en specifik probe. I denne sammenhæng er en probe et stykke DNA, der binder sig til det udvalgte og opformerede CO1 DNA fragment (figur 67). >gi gb FJ Asellus aquaticus isolate UP4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial TATTTTATTTTTGGTGCATGATCAGGCAGGGTAGGAACTGCTCTTAGTATATTAATTCGAACAGAACTGG GACAACCTGGTAGATTTATTGGCAATGACCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTTAT AATTTTTTTCTTAGTTATACCAGTGATAATCGGAGGGTTTGGAAATTGATTAATTCCCCTAATGCTAGGT GCCCCAGATATAGCATTTCCTCGCATAAATAATATAAGATTCTGACTATTACCTCCTTCTCTAACCCTGC TCCTGTCTAGGGGGTTAATTGAAAGAGGAGTAGGAACTGGCTGAACAGTGTATCCTCCGCTAGCTGCAAG CATTGCACACAGTGGTCCTTCTGTAGATTTAGGAATTTTTTCTTTACACTTAGCTGGGGCTAGTTCTATT TTAGGCTCTGTTAATTTTATCTCAACAGTTATTAATATGCGCGCAGAAGGCATAAGATTTGATAAGGTTC CTTTGTTTGTGTGGTCAGTATTTTTAACTACTATTTTACTTCTACTTTCTCTACCTGTGTTAGCCGGGGC CATTACTATATTACTTACAGATCGTAATTTAAACACATCTTTTTTTGACCCCAGGGGAGGAGGAGACCCT ATTTTATATCAACACTTGTTTTG Figur 67. Placering af de mulige arts specifikke primere for Asellus aquaticus på CO1 genet. Sekvenserne der er markeret med gult (6F, 7F, 9R) er arts specifikke og derfor testet som primere. Den blå sekvens er ligeledes arts specifik og anvendt som probe (8F). De indledende primer tests i laboratoriet viste, at primer 7F og 9R gav uspecifik opformering af eksempelvis DNA fra en Gammarus pulex (ferskvandstangloppe). Fuldstændig specificitet blev opnået ved at kombinere primer 6F med 9R, som vist i figur 68 nedenfor. Asellus specifikke qpcr primere og Taqman probe CO1 DNA-streng (142 basepar) 3 -TTGGGACGAGGACAGATCCCCCAATTAACTTTCTCCTCATCCTTGACCGACTTGTCACATAGGAGGCGATCGACGTTCGTAACGTGTGTCACCAGGAAGACATCTAAATCCTTAAAAAAGAAATGTGAATCGACCCCGATCA-5 5 -AACCCTGCTCCTGTCTAGGGGGTTAATTGAAAGAGGAGTAGGAACTGGCTGAACAGTGTATCCTCCGCTAGCTGCAAGCATTGCACACAGTGGTCCTTCTGTAGATTTAGGAATTTTTTCTTTACACTTAGCTGGGGCTAGT-3 CO1 PCR opformering 3 -TTGGGACGAGGACAGATCCCCCAATTAACTTTCTCCTCATCCTTGACCGACTTGTCACATAGGAGGCGATCGACGTTCGTAACGTGTGTCACCAGGAAGACATCTAAATCCTTAAAAAAGAAATGTGAATCGACCCCGATCA-5 5 -AACCCTGCTCCTGTCTAGGGGG-3 5'FAM-TGGTCCTTCTGTAGATTTAGGA-3'BHQ2 Asellus forward primer 6F Asellus Taqman probe Asellus reverse primer 9R 3 -AGAAATGTGAATCGACCCCGATCA-5 5 -AACCCTGCTCCTGTCTAGGGGGTTAATTGAAAGAGGAGTAGGAACTGGCTGAACAGTGTATCCTCCGCTAGCTGCAAGCATTGCACACAGTGGTCCTTCTGTAGATTTAGGAATTTTTTCTTTACACTTAGCTGGGGCTAGT-3 CO1 PCR-produkt 3 -TTGGGACGAGGACAGATCCCCCAATTAACTTTCTCCTCATCCTTGACCGACTTGTCACATAGGAGGCGATCGACGTTCGTAACGTGTGTCACCAGGAAGACATCTAAATCCTTAAAAAAGAAATGTGAATCGACCCCGATCA-5 5 -AACCCTGCTCCTGTCTAGGGGGTTAATTGAAAGAGGAGTAGGAACTGGCTGAACAGTGTATCCTCCGCTAGCTGCAAGCATTGCACACAGTGGTCCTTCTGTAGATTTAGGAATTTTTTCTTTACACTTAGCTGGGGCTAGT-3 3 -TTGGGACGAGGACAGATCCCCCAATTAACTTTCTCCTCATCCTTGACCGACTTGTCACATAGGAGGCGATCGACGTTCGTAACGTGTGTCACCAGGAAGACATCTAAATCCTTAAAAAAGAAATGTGAATCGACCCCGATCA-5 5 -AACCCTGCTCCTGTCTAGGGGGTTAATTGAAAGAGGAGTAGGAACTGGCTGAACAGTGTATCCTCCGCTAGCTGCAAGCATTGCACACAGTGGTCCTTCTGTAGATTTAGGAATTTTTTCTTTACACTTAGCTGGGGCTAGT-3 Figur 68. Opformering af et stykke af CO1 genet vha Asellus aquaticus specifikke primere. Det 142 basepar lange dobbeltstrengede DNA-stykke er vist i fuld længde øverst. Under PCR-reaktionen spaltes de to komplementære strenge, og de to primere 6F og 9R binder sig til hver sin streng, som vist i midten. Efter én PCR-cyklus er ét stykke dobbeltstrenget DNA blev til to (nederst). Principperne bag kvantitativ PCR (qpcr) Ved kvantitativ PCR (qpcr) opformeres det udvalgte DNA-stykke eksponentielt (jfr. figur 69). I løbet af 35 cyklusser opformeres én kopi af DNA-stykket ideelt set til 2 36 kopier, dvs. 1, kopier. Til PCR reaktionen sættes et fluorescerende molekyle, i dette tilfælde G E U S 71

72 72 stoffet SYBR Green, der binder sig til alt dobbeltstrenget DNA. Mængden af opformeret DNA måles efter hver cyklus, som intensiteten af SYBR green fluorescens. Fluorescensværdierne for hver cyklus plottes til en kurve, der viser forløbet af opformeringen. Det bedste udtryk for DNA-mængden i en prøve afspejles af analysens Ct-værdi. Ct står for Cycle Treshold, og angiver, ved hvilken PCR-cyklus fluorescens-signalet når op over en beregnet grænse-værdi. I én kørsel på qpcr-apparatet, kan vi analysere op til 96 PCR-reaktioner. Udvikling af DNA standardkurve En DNA standardrække bruges til at lave den kvantitative beregning af mængden af DNA i en ukendt prøve. DNA-standardkurven for analysen af Asellus aquaticus blev lavet som en 10-folds fortyndings-serie af DNA ekstraheret fra ét eksemplar af Asellus aquaticus indsamlet i HOFOR s tank 2. Hver fortynding af DNA-standarden kørtes tre gange (triplikat prøve). Figur 68 viser opformeringen af fem fortyndinger af Asellus aquaticus DNA-standarden. Den gennemsnitlige Ct-værdi for de tre prøver anvendes til at plotte en standard-kurve for PCR-opformeringen henover fortyndingsrækken (Figur 70). Standardkurve PCR opformering Figur 69. PCR opformering af 10-folds fortyndinger af DNA udvundet fra et enkelt eksemplar af Asellus aquaticus. Hver fortynding er kørt som en triplikat prøve. Cycle treshold værdierne for DNA standarden anvendes til at plotte en standard-kurve (se figur 70 nedenfor), der anvendes til at beregne mængden af DNA i de ukendte sediment prøver. G E U S 72

73 73 Standardkurve korrelation SYBR Green qpcr Figur 70. De gennemsnitlige Ct-værdier for den fortyndede DNA-standardrække plottes til en standard-kurve for PCR opformeringen. I dette tilfælde er PCR-effektiviteten beregnet til 83.5%. R2 er 0,987. Hældning på kurven er -3,79 og skæring m Y-aksen 13,67. qpcr opformering af DNA fra sedimentprøver med SYBR Green fluorescens Asellus aquaticus DNA fra de 12 udtagne sedimentprøver opformeredes i én kørsel sammen med DNA-standardrækken (Figur 71). De gennemsnitlige Ct-værdier for de triplikate prøver, blev derefter plottet mod standard-kurven, for at beregne mængden af Asellus aquaticus DNA i hver enkelt oprindelig sedimentprøve (Figur 72). Smeltepunktet for et PCR-produkt angiver den temperatur, hvor det dobbeltstrengede DNA deles til enkelte strenge. Smeltekurve-analysen viser, at det opformerede produkt i de ukendte prøver har samme smeltepunkt som DNA-standarden (Figur 73). Dette indikerer, at der ikke har været co-amplifikation af uønsket DNA, dvs. at primerne har været specifikke i deres binding til CO1 target-dna sekvensen. G E U S 73

74 74 Opformering af DNA fra sediment prøver med SYBR Green qpcr Figur 71. Grafik af opformeringen af de 12 sediment prøver i triplikate gentagelser. Kvantificering af sediment prøver med SYBR Green qpcr Figur 72. Ct-værdierne for de ukendte prøver plottes mod den kendte standard-kurve, og bruges til at beregne mængden af Asellus aquaticus DNA for hver enkelt prøve. G E U S 74

75 75 Smeltekurve-analyse for SYBR Green qpcr Assay Figur 73. Smeltekurve-analysen her viser, at det opformerede produkt i de ukendte prøver har samme smeltepunkt som DNA-standarden. Dette indikerer, at der ikke har været coamplifikation af uønsket DNA, dvs. at primerne har været specifikke i deres binding til CO1 target-dna sekvensen. Resultat af qpcr opformering af DNA fra sediment prøver (SYBR Green) qpcr-analyserne viste, at alle 12 sedimentprøver indeholdt DNA fra Asellus aquaticus (Tabel 19). De fleste dog i små mængder, svarende til DNA fra under eller omtrent ét dyr pr. kg sediment. Undtaget herfra er tilbageskylningssediment fra et vandværk fra Fyn, der indeholdt DNA svarende til op til 32 dyr pr kg filtersediment. Prøverne indsamlet fra Bogøgård og Attemose vakuumbeholderne indeholdt ikke tilstrækkeligt sediment materiale til påvisning af Asellus aquaticus, selvom de blev forsøgt opkoncentreret ved filtrering. G E U S 75

76 76 Gennemsnitlige antal cykler indtil tærskelværdi for dna detektion opnås (triplikat analyse) SYBR Green Cycle treshold Mean of triplicate Usikkerhed antal cykler. (Standard afvigelse) Cycle treshold Std. Dev. Beregnet antal dyr pr kg sediment Starting Quantity Mean Usikkerhed, antal dyr (standard afvigelse) Starting Quantity Std. Dev. Lokalitet Slangerup filterslam 31,13 0,31 0,16 0,03 Strø Vak-beholder 34,13 1,27 0,03 0,02 Attemose St. 1 31,88 0,45 0,10 0,03 Æbelholt Vak-beh 31,71 0,46 0,12 0,03 SØSØ EF 2 27,56 0,19 1,42 0,16 SØSØ EF 3 29,71 0,17 0,38 0,04 SØSØ EF 5 29,55 0,32 0,42 0,09 SØSØ EF 7 26,94 0,22 2,08 0,29 SØSØ EF 8 28,41 0,06 0,84 0,03 Bogøgård Vak-beh 0,00 N/A 0,00 0,00 Attemose Vak-beh 0,00 N/A 0,00 0,00 Lindvedværket, Fyn 22,44 0,20 32,35 3,76 Lundeværket, Fyn 30,05 0,25 0,31 0,05 Odense Hovedværk, Fyn 30,00 0,39 0,32 0,07 Tabel 19. DNA fra Asellus aquaticus i sedimentprøver, omregnet til gennemsnitlig antal dyr pr kg sediment. De tre prøver fra Fyn er samlet i klaringstanke, hvor jern fra jernfiltrene bundfældes før restvandet bortledes. Seks af de undersøgte prøver indeholder ikke filtergrus og stammer fra vakuumbeholdere med bundfaldet materiale. Resultaterne af SYBR Green qpcr analysen viser, at de fleste undersøgte prøver indeholdt Asellus aquaticus DNA svarende til mindre eller omtrent ét dyr pr kg. Tabel 19 viser, at der er fundet DNA i alle udtagne prøver, med tilstrækkeligt materiale til at foretage en DNA ekstraktion, og at DNA også blev fundet i de prøver, hvor det ikke var muligt visuelt at finde levende dyr, fragmenter fra disse eller Asellus aquaticus pellets. Faktisk blev der kun fundet fragmenter fra Asellus aquaticus i én prøve, mens der i fire prøver blev fundet nedbrudte rester eller slidte pellets muligvis produceret af Asellus aquaticus. G E U S 76

77 77 qpcr opformering af DNA fra sediment prøver med Asellus-probe fluorescens I forbindelse med udviklingen af DNA-metoden til bestemmelse af Asellus i ukendte prøver, har vi forsøgt at øge specificiteten og dermed sikkerheden af analysen, ved at indføre en Asellus-specifik probe i qpcr-assayet. DNA fra Asellus aquaticus bliver i den forbindelse opformeret med de samme primere som ved SYBR Green qpcr, men udviklingen af DNAprodukt, måles i stedet som fluorescens fra en Asellus specifik DNA-probe, der binder sig til et midterstykke af den opformerede DNA-streng (se Figur 68). Principperne bag opformering og beregning og behandling af data ved Probe qpcr er fuldstændig identisk med SYBR Green qpcr assayet beskrevet ovenfor. Idet ikke hele produktet fluorescerer, mistes lidt af sensitiviteten i assayet, men der opnås yderligere sikkerhed for, at det korrekte DNA produkt opformeres under analysen. Derfor fås relativt lavere fluorescens-værdier for Probe qpcr sammenlignet med SYBR Green qpcr (Se Figur 76). Som en yderligere verifikation af, at assayet er Asellus-specifikt, blev de opformerede PCRprodukter oprenset og sendt til sekventering hos AGOWA i Tyskland. Alle PCR-produkter blev identificeret som Asellus aquaticus-dna. Opformering af Asellus aquaticus DNA-standardkurve med Probe qpcr Figur 74. PCR opformering af 10-folds fortyndinger af DNA udvundet fra et enkelt eksemplar af Asellus aquaticus målt som flourescens fra Asellus-proben. Hver fortynding er kørt som en triplikat prøve. Cycle treshold værdierne for DNA standarden anvendes til at plotte en standard-kurve (se figur 73 nedenfor), der anvendes til at beregne mængden af DNA i de ukendte sediment prøver. G E U S 77

78 78 Asellus aquaticus DNA fra de 12 udtagne sediment prøver opformeredes i én kørsel sammen med DNA-standardrækken (Figur 74). De gennemsnitlige Ct-værdier for de triplikate prøver, blev derefter plottet mod qpcr probe standard-kurven, for at beregne mængden af Asellus aquaticus DNA i hver enkelt oprindelig sediment prøve (Figur 75). Standardkurve korrelation Asellus aquaticus Probe qpcr Figur 75. Ct-værdierne for den fortyndede DNA-standardrække anvendes til at plotte en standard-kurve for Probe qpcr-amplifikationen. I dette tilfælde er PCR-effektiviteten beregnet til 85.8%. R2 er 0,996. Hældning på kurven er -3,72 og skæring m Y-aksen 18,81. Cycle treshold Mean of triplicate Cycle treshold Std. Dev. Starting Quantity Mean Starting Quantity Std. Dev. Lokalitet Slangerup filterslam 36,59 0,84 0,08 0,04 Strø Vak-beholder 36,66 0,85 0,07 0,03 Attemose St. 1 34,82 0,49 0,21 0,06 Æbelholt Vak-beh 35,74 0,45 0,12 0,03 SØSØ EF 2 32,62 0,42 0,82 0,20 SØSØ EF 3 33,72 0,43 0,42 0,11 SØSØ EF 5 33,89 0,23 0,37 0,05 SØSØ EF 7 32,04 0,13 1,15 0,10 SØSØ EF 8 33,10 0,45 0,61 0,17 Bogøgård Vak-beh 0,00 N/A 0,00 0,00 Attemose Vak-beh 0,00 N/A 0,00 0,00 Lindvedværket 27,93 0,03 14,63 0,26 Lundeværket 34,59 0,56 0,25 0,08 Odense Hovedværk 34,42 0,17 0,26 0,03 Tabel 20. Assayet til detektion af Asellus aquaticus ved hjælp af Probe qpcr, viser i store træk de samme resultater som SYBR Green qpcr assayet. DNA fra Asellus aquaticus i sediment prøverne er omregnet til gennemsnitlig antal dyr pr kg slam. Resultaterne af Probe qpcr analysen viser, at 12 undersøgte prøver indeholdt Asellus aquaticus DNA svarende til mindre eller omtrent ét dyr pr kg. Undtaget er igen sediment fra Lindvedværket, hvor assayet måler DNA i en mængde svarende til ca. 15 dyr pr kg sediment. G E U S 78

79 79 Nedenfor er indsat en graf (Figur 76), der viser den flotte overensstemmelse mellem resultaterne for de to qpcr assays, hvor fluorescensen måles med hhv. SYBR Green og en fluorescerende Asellus aquaticus-specifik probe. Grafen viser, at vi har fået udviklet et assay med høj specificitet (alle PCR-produkter er verificeret Asellus aquaticus) men også med en høj sensitivitet. Vi kan med assayet detektere DNA i en mængde svarende til et dyr (ca 0,1 g pr dyr) pr. 100 kg slam. Asellus aquaticus probed qpcr vs Sybr Green qpcr Cycle treshold means Ct values Sybr Green qpcr Ct values probed qpcr Figur 76. Graf, der viser overensstemmelsen mellem SYBR Green qpcr og Probe qpcr. Den gode korrelation mellem Ct-værdierne for hhv. Asellus Sybr Green qpcr og Probed qpcr viser, at vi har udviklet et meget stærkt assay med høj specificitet. Konklusion for udviklingen af assay til qpcr opformering- og detektion af Asellus aquaticus DNA fra sediment prøver (SYBR Green og Probe qpcr) Af tabel 19 og 20 fremgår, at alle sedimentprøver, der blev indsamlet fra hhv. HOFOR og- Vandcenter Syd indeholdt DNA fra Asellus aquaticus. De fleste prøver dog i mindre mængder, dvs. svarende til DNA fra under eller omtrent ét dyr pr. kg slam. Undtaget herfra er resultatet for Lindvedværket, der viser indhold af DNA svarende til 32 dyr pr kg slam med SYBR Green qpcr assayet og 15 dyr med Probe qpcr assayet. Resultaterne for de to assays udviser en høj grad af korrelation og støtter dermed hinanden. Det er lykkedes at udvikle et nyt detektions-assay for Asellus aquaticus med høj specificitet og høj sensitivitet. Assayet kan detektere DNA ned til en mængde svarende til ca. et dyr pr. 100 kg slam. Da det formentlig i høj grad er DNA fra dyrenes tarmkanal (epitelceller), som udtrækkes fra sedimenterne, er detektionsmetoden langt mere robust, end hvis metoden alene byggede på påvisning af DNA fra kropsdele. Dette skyldes, at levende dyr producerer pellets gennem et helt livsforløb. G E U S 79

80 80 DNA i disse pellets nedbrydes langsomt på grund af den lave temperatur på ca o C i vandværksledninger og grundvand. Et enkelt dyr vil derfor kunne efterlade sig mange DNA spor, og disse vil kunne spores i sediment prøver selv i meget fortyndet form. De undersøgte prøver er udtaget på selve vandværkerne og i beholdere før vandværkernes filtre. De DNA-positive prøver viser, at DNA kan stamme fra dyr, der lever i de øvre dele af de grundvandsmagasiner, hvorfra værkernes via deres indvindingsboringer pumper råvand op, netop fordi der er fundet DNA spor i hydroforer efter boringerne. Man kan forestille sig, at Asellus aquaticus søger hen mod de boringer, hvor der er en smule ilt øverst i inddraget, for der at afgræsse biofilmen i boringens indre. Hvis Asellus aquaticus afgræsser biofilm på indersiden af boringen vil dyrene producere pellets med DNA spor som vil kunne genfindes i rørsystemerne. Da dyrene og særligt de juvenile individer kan overleve næsten anaerobe forhold, vil dyrene lejlighedsvis kunne transporteres fra boringerne til vandværkernes beluftningsanlæg og derfra vandre videre ud i ledningssystemerne. En anden mulig indvandringsvej er via overfladevand eller højtliggende grundvand, når eventuelt beskadigede eller utætte nedgravede rør er under reparation. Fra side 32: Den røde ring viser, hvor langt Asellus aquaticus kom, da tanken blev tømt for vand. Krybesporene er typiske for dette krebsdyr. G E U S 80

81 81 Referencer Bork, J. & Hahn, H. J. 2010?: Die Heinzelmännchenchen der Trinkwasserversorgung, Brüsch W, 2003: Den gemte fauna. Vandforsyningsteknik 52. Danva. Dansk vand- og spildevandsforening. P I. Brüsch W., Jacobsen C.S., Fredslund F. og Bundgaard T., 2009: Splinternye fund af grundvandsdyr - en ny fauna fra grundvands- og rentvandsmiljøer i Danmark. Hvad betyder dette for vort drikkevand? 7. december 2009, GEUS Brüsch W., Jacobsen C.S., Fredslund L., Bundgaard T., 2009: Groundwater shrimps - Findings of stygoide animals (in groundwater) and a new clear water fauna in water plants. 2. december 2009, De Nationale Geologiske Undersøgelser for Danmark og Grønland. Eroukhmanoff, F., Hargeby, A. & E. I. Svensson (2009) Rapid adaptive divergence between ecotypes of an aquatic isopod inferred from F ST Q ST analysis. Molecular Ecology 18: Folmer, O., Black, M. Hoeh, W., Lutz, R. and R. Vrijenhoek (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): Gledhill, T.; Sutcliffe, D.W. & Williams, W.D., 1993: British Freshwater Crustacea Malacostraca: A key with ecological notes. Freshwater Biological Association, Scientific Publication no. 52, 173 pp. Graca, M.A.S.; Maltby, L. & Calow, P., 1993b: Importance of fungi in the diet of Gammarus pulex and Asellus aquaticus. II: Effects on growth, reproduction and physiology. Oecologia 96(3): Griebler C., Stein, H., Claudia Kellermann, Berkhoff, S., Brielmann, H, Schmidt S., Selesi D., Steube C., Fuchs, A., Hahn H.J., 2010: Ecological assessment of groundwater ecosystems Vision or illusion? Ecological Engineering 36 (2010) GWF-Wasser, Juli/August 2009: Wenn Krebse durch die Wasserleitung krabblen. GWF- Wasser, s 546. Henry, J.-P. & Magniez, G., 1978: Isopoda. Pp i: Illies, J. (Ed.): Limnofauna Europaea. A checklist of the Animals Inhabiting European Inland Waters, with Accounts of their Distribution and Ecology (except Protozoa), 2. Edition, Gustav Fischer Verlag, Stuttgart & New York. Humphreys W. F., 2009: Hydrogeology and groundwater ecology: Does each inform the other? Journal Hydrogeology, ISSN (Print) (Online).Issue Volume 17, Number 1 / February, 2009 Kristensen, Preben (2004): Vandløbsøkologiske studier af invertebratfaunaen i Kobbeå - et typisk bornholmsk sprækkedalsvandløb. Specialerapport, Ferskvandsbiologisk Laboratorium, Københavns Universitet, april G E U S 81

82 82 Limno-Plan, 2001: Die Wasserassel (Asellus aquaticus) in Wasserversorgungsanlagen. Studie für die Dahme-Nuthe Wasser, Abwasserbetriebsgesellschaft mbh. Limno-Plan BbR, Bauernweg 8, Bestensee, Deutchland. Maltby, L.., 1995: Sensitivity of the Crustaceans Gammarus Pulex (L.) and Asellus aquaticus (L.) to short-term exposure to hypoxia and unionized ammonia: Observations and possible mechanisms. Wat. Res. 29(3): Mattern & Schlegel, 2001: Molecular evolution of the small subunit ribosomal DNA in Woodlice (Crustacea, Isopoda, Oniscidea) and implications for Oniscidean phylogeny. Mol. Phylogen. Evol. 18: Stein H., Kellermann C., Schmidt S.I., Brielmann H., Steube C., Berkhoff S.E, Fuchs A., Hahn H.J., Thulin B. & Griebler C., 2010: The potential use of fauna and bacteria as ecological indicators for the assessment of groundwater quality. J. Environ. Monit., 2010, 12, Svavarsson, J. and B. K. Kristjánsson (2006) Crangonyx islandicus sp. nov., a subterranean freshwater amphipod (Crustacea, Amphipoda, Crangonyctidae) from springs in lava fields in Ice-land. Zootaxa 1365: 1 17 (2006) TREFOR Vand, 2014: Pers. komm. Charlotte Schmidt, TREFOR VAND A/S Vinther, F.P.; Hansen, E.M. and Eriksen, J. (2005) Udvaskning af organisk kulstof efter kløvergræs. [Leaching of organic carbon and nitrogen.] In: Olesen, J.E. (Ed.) Drivhusgasser fra jordbruget - reduktionsmuligheder, chapter 11, pp Andre relevante referencer: Bech, T.B., Johnsen, K., Dalsgaard, A., Laegdsmand, M., Jacobsen, O.H., Jacobsen, C.S. (2010) Transport and Distribution of Salmonella enterica Serovar Typhimurium in Loamy and Sandy Soil Monoliths with Applied Liquid Manure. Applied and Environmental Microbiology 76: Christensen, S.C.B., Hansen, H.L., Albrechtsen, H-J. (2010) Biologi i ledningsnettet. Dansk-VAND 1/10: Claret, C., Marmonier, P., Dole-Olivier, M.-J., and Castella, E. (1999) Effects of management works on the interstitial fauna of floodplain aquatic systems (River Rhône, France) Journal Biodiversity and Conservation. Issue Volume 8, Number Declerck, P.,Behets, J., Margineanu, A.,van Hoef, V.,De Keersmaecker, B., Ollevier, F. (2009) Replication of Legionella pneumophila in biofilms of water distribution pipes. Microbiological Re-search 164: DVWK (1997) Parameter und Methoden der biologischen Charakterisierung des Untergrundes Feststoffe und Wasser, DVWK Schriften Heft p. Ekelund, F. & R. Rønn (1994) Notes on protozoa in agricultural soil, with emphasis on heterotro-phic flagellates and naked amoebae and their ecology. FEMS Microbiology Reviews 15: Ekelund, F., Rønn, R & S. Christensen (2001a) Distribution with depth of protozoa, bacteria, and fungi in soil profiles from three Danish forest sites. Soil Biol. Biochem. 33, Ekelund F, Rønn R, Griffiths BS (2001b) Quantitative estimation of flagellate community struc-ture and diversity in soil samples. Protist: 152: G E U S 82

83 83 Fredslund, L, Ekelund F, Jacobsen CS, Johnsen K (2001) Development and application of a most probable number-pcr assay to quantify flagellate populations in soil samples. Applied and Environmental Microbiology: 67: Galassi DMP (2001) Groundwater copepods: diversity patterns over ecological and evolutionary scales Hydrobiologia 453/454: ,. Griebler C und F. Mösslacher, 2003: Grundwasser-ökologie. UTB, Facultas Universität Verlag, Wien Hahn, H. J. (1996) Litteraturstudie zum Thema Grundwasserfauna. Inst. Für Biologie der Universi-tät Koblenz-Landau. Roesch, L.F. et al. (2007) Pyrosequencing enumerates and contrasts soil microbial diversity. ISME Journal 1: Rumm, P. (1999) Untersuchungen zum Abbau partikulärer organischer Substanzen in einem Lang-samsandfilter durch Metazoen am Beispiel von Niphargus fontanus. VI, 156 Bl. - Oldenburg, Univ., Diss., pp. Rønn, R.M., Griffiths, B.S. and Young, I.M. (2001a) Protozoa, nematodes and N- mineralization across a prescribed soil textural gradient. Pedobiologia 45: Rønn, R., Grunert, J. and Ekelund, F. (2001b) Protozoan response to addition of the bacteria Mycobacterium chlorophenolicum and Pseudomonas chlororaphis to soil microcosms. Biology and Fertility of Soils 33: Rønn, R., McCaig, A.E., Griffiths, B.S. and Prosser, J.I. (2002). Impact of protozoan grazing on bacterial community structure in soil microcosms. Applied and Environmental Microbiology 68: Thulin, B. and H. J. Hahn (2008) Ecology and living conditions of groundwater fauna. TR Swedish Nuclear Fuel and Waste Management Co. Verovnik, R., B. Sket, et al. (2005) The colonization of Europe by the freshwater crustacean Asel-lus aquaticus (Crustacea : Isopoda) proceeded from ancient refugia and was directed by habitat con-nectivity. Molecular Ecology 14: Whitehead, A.G., and Hemming, J.R. (1965) A comparison of some quantitative methods of ex-tracting small vermiform nematodes from soil. Ann. Appl. Biol. 55: G E U S 83

84 84 Bilag 1: Projektbeskrivelse DNA karakteriseringsprojekt i forbindelse med rentvands-, overfladevands- og grundvandsdyr i Odense og København. Formål: Projektet vil udvikle en robust metode til DNA baseret karakterisering af rentvands- og grundvandsdyr som f.eks. Asellus aquaticus baseret på 18SrRNA sekventering til entydig karakterisering af dyrenes genotype. Der vil endvidere blive benyttet metoder med højere opløsning mhp at kunne skelne mellem beslægtede arter. Der vil forgå to aktiviteter: dels sekventering af mitochondrielt DNA og/eller ITS sekvenser dels RAPD fingerprint. I projektet vil der blive isoleret DNA fra Asellus aquaticus fanget i fire forskellige miljøer: ferskvand, grundvand samt i vandforsyningen i København og i Odense. DNA vil blive chekket for renhed og der vil blive gennemført en RAPD fingerprint af alle dyr. Baseret på båndmønstre vil dyrene blive inddelt i grupper, og der vil blive gennemført sekventering af ITS sekvenser, mitocondrielt DNA samt 18SrRNA genet. De karakteriserede dyr vil blive sammenlignet i et dendrogram, for at udrede slægtskabsforholdene. Endeligt vil projektet forsøge at finde unikke genetiske markører, der tillader detektion af Asellus aquaticus i miljøer, hvor den ikke kan ses her tænkes i første omgang på analyser af tilbage-skylningsslam. Hvis der gennem den første del af projektet kan findes specifikke markører, vil det blive undersøgt, om det er muligt at ekstrahere DNA af høj kvalitet fra sedimentprøver. Dette DNA vil i første omgang blive klonet og klonerne analyseret for tilstedeværelse af Asellus aquaticus DNA. Forudsætninger for projektet: Der er gennemført indfangning af dyr fra en enkelt grundvandslokalitet på Sjælland. Der er indfanget dyr fra forskellige steder i Vandcenter Syds forsyninger og der er gennemført indfangning af dyr fra Tinghøj højdebeholder i København. (Der er desuden også pt indsamlet dyr fra overfladevand på Fyn, samt fra en kalk kilde i et kildefelt på Sjælland). Der er udvalgt og valideret en metode til ekstraktion af høj kvalitets DNA fra Asellus aquaticus, og det er vist, at GEUS i det særlige PCR-renrum også kan håndtere 18 S rrna PCR amplifikation uden forurening med humant DNA. Det er lykkedes at sekventere op til 2200 basepar af 18rRNA genet, hvilket muliggør en sikker karakterisering af dyrene. Det er endvidere lykkes at opformere og sekventere mitochondrielt DNA, hvilket muliggør en udredning af slægskabsforhold mellem undergrupper af A. aquaticus med forskellig oprindelse. Forløb: Projektet vil blive drevet af Line Fredslund, Carsten Suhr Jacobsen og Walter Brüsch i fællesskab. Der vil blive afholdt møder med DTU, mens der vil blive indfanget overfladevands former af Asellus aquaticus ved samarbejde med Peter Wiberg-Larsen, DMU og af GEUS. Trin 1: Der vil blive ekstraheret DNA og kørt RAPD på ca. 300 isolater. Trin 2: På det allerede ekstraherede DNA vil der blive gennemført en sekvensanalyse af repræsentanter for unikke grupper af dyr (baseret på udvalgte isolater fra TRIN 1). Trin 3: Optimering af sekvens analyse kombination af interview med nøglepersoner, litteratur og test på 50 forskellige dyr. DNA ekstraktion fra 20 vanskelige matricer med og uden tilsat Asellus aquaticus og validering af DNA kvalitet ved q-pcr. Oprensning af DNA og kloning af DNA fra 10 udvalgte miljøer hvor der ønskes viden om tilstedeværelse af Asellus aquaticus G E U S 84

85 85 Bilag 2: Vejledning i udtagning af sediment. GEUS Udtagning af sedimentprøver til undersøgelse af DNA spor fra rentvandsfauna Formål Formålet er at undersøge, om sediment udtaget fra fx sandfiltre indeholder DNA, som kan sammenholdes med DNA ekstraheret fra rentvandsdyr (Asellus) fundet i København og Odense. Forekommer DNA fra Asellus i sedimentprøverne viser dette dels, at dyrene forekommer i sandfiltrene og/eller i forsyningsnettet før disse. Den udviklede metode kan desuden anvendes til at vise, om der forekommer en rentvandsfauna, selv om dyrene ikke er fundet eller kan indsamles. Hvor udtages af sedimentprøverne? Sedimentprøver udtages fx, når sandfiltre returskylles, eller fra bundfældning i tanke efter sandfiltre i værkerne. Findes der mulighed kan der også udtages sedimentprøver fra udfældningsbeholdere før sandfiltret. Sådanne prøver vil på et senere tidspunkt kunne være med til at kortlægge udbredelsen af faunaen i lednings og boringssystemerne, såfremt det lykkes at ekstrahere anvendeligt DNA fra både dyr og sediment. Sedimentet kan opsamles direkte over sandfiltrene hvis dette er muligt og ellers så tæt på filtrene som muligt i udløbet. Metode Det forslås, at sedimentprøverne fx udtages ved at udtage store vandprøver fra skyllevand, når filtrene returskylles og efterfølgende at lade sedimentet sedimentere i beholderen. Sedimentationstiden kendes ikke, men det skønnes at den kan varierer fra en time til adskillige timer. En omrystet prøve fra en rentvandstank sedimenterede næsten 100 % efter ca. 1½ time. Efter sedimentation dekanteres vandet fra flasken/flaskerne, og sedimentet opsamles i 50 ml sterile plastrør, som GEUS fremsender. Forurening Det er selvfølgelig vigtigt at undgå at forurene prøverne med materiale der kan stamme fra overfladevand. Menneskeligt DNA vil ikke kunne forurene de udtagne sedimentprøver. Mængde, opbevaring og forsendelse til GEUS Det tilstræbes at indsamle ca. 10 g sediment i tørvægt, men mindre kan også gøre det, prøverne sendes så vidt muligt hurtigt (ikke over en weekend) til GEUS i de særlige køle bokse som GEUS fremsender. Disse indeholder dels nogle køleelementer som skal fryses samt de plastflasker der skal anvendes. Prøverne opbevares i køleskab indtil prøverne forsendes. Husk at adressere prøverne til Walter Brüsch eller Pernille Stockmarr. Prøverne må IKKE fryses. I samme kasse fremsendes de ekstra prøver der udtages til Sarah fra DTU og til Walter der vil undersøge om der er pellets i sedimentet. Eventuelle prøver til undersøgelse med mikroskop Overskydende sediment og sandprøver fra filtrene opsamles til mikroskopisk undersøgelse (af Sarah og Walter), hvor bla eventuelle pellets forsøges identificeret. Disse prøver skal også opbevares på køl. Disse prøver udtages kun såfremt der er tilstrækkeligt materiale til DNA undersøgelsen. G E U S 85

86 86 Bilag 3: Sedimentprøver fra vandindvindingsanlæg Sedimentprøverne blev undersøgt med et Wild-Heeburg mikroskop med påfaldende lys. De fundne skal- fragmenter, æg og smådyr mm blev fotograferet digitalt. Nogle fragmenter flyder oven på opslæmningen af prøverne pga. overfladespænding. Disse fragmenter blev først indsamlet og fotograferet. Dernæst blev det mest finkornede af prøven fjernet ved at lave en opslæmning med rent postevand. Denne proces blev gentaget adskillige gange, og prøverne blev undersøgt mellem hvert trin. Til slut var der opkoncentreret et residual af de groveste fragmenter bla. filtergrus og større skalfragmenter. Vandcenter Syd, Fyn Udtagning af sedimentprøver fra returskyllevand fra følgende tre vandværker tilhørende Vandcenter Syd: Hovedværket i Odense, Lindved værket og lundeværket (figur 1, 2 og 3). Figur 1. Hovedværket i Odense, klaringstanken er etableret under parkeringspladsen til venstre i billedet, hvor nedgangen til tankanlægget kan ses på grænsen mellem græsplæne og parkeringsplads. Figur 2. Lindved værket. Klaringstanken er placeret ved værket nederst til højre i billedet. G E U S 86

87 87 Figur 3. Lundeværket. Klaringstanken er placeret mellem vejen og vandværket, til højre i billedet. Udtagning af sedimentprøver Prøverne blev alle udtaget d fra tre klaringstanke. I hovedværket med en grab sampler, mens prøverne blev taget med et forlænget biolog net ved Lindved og Lundeværket. Alle prøver indeholdt sand/grus materiale som tilsyneladende i mindre mængder hvirvles op og transporteres sammen med jernoxiderne. Sedimentet virkede meget fint og fedt og en undersøgelse med lup ved udtagning viste ingen forekomst af pellets. En klaringstank er i denne sammenhæng en stor nedgravet tank, hvortil tilbageskylsvandet fra sandfiltrene pumpes, således at jernoxider kan bundfældes, før det overskydende vand bortskaffes enten ved udledning til nærmeste vandløb eller til kloak. Hovedværk, Odense Helt ben fra krebsdyr formodentlig fra Asellus aquaticus. En del levende cyclops, enkelte ostrakoder. Mange små hår der godt kunne ligne de små hår fra krebsdyr benene. 2 æg der ligner de æg som asellus bærer under brystpladerne, et er opsamlet. Mange meget små mulige pellets. En del små kalkflager som kunne være udfældninger. Figur 4. Odense hovedværk. Tilbageskyls- / klarings-tank: Venstre: afrevet ben fra krebsdyr. Midten: filtergrus med bakterie belægning. Højre: lille fecal pellets. G E U S 87

88 88 Lindved værket Sedimentet virker som er meget ugæstfrit miljø, fedt og klæbrigt. Der er ikke observeret levende dyr. Et æg er fundet (Asellus?) samt enkelte meget små, bløde og grå pellets, fra Cyclops? Mange kalkfragmenter fra skaller ligner både snegle og muslinger > grusblanding må stamme fra marine gruslag. Figur 5. Lindved værket, klaringstank. Venstre: Skalfragment i sedimentprøve. Midten: små fecalpellets - underliggende tern er en mm. Højre: filtergrus med biologisk aktiv belægning. Lundeværket Skjoldfragmenter. Flere ben fragmenter mørke med mørk central kanal er formodentlig ikke Asellus. Et stk død orm. I rentvandstanken kunne man gennem en rude observere et mørkt punkt som bevægede sig punktet havde samme størrelse som en Asellus, men det var umuligt at afgøre, om der var tale om et dyr, eller om der var tale om en afskalning, der blev flyttet lidt frem og tilbage af strømmen i beholderen. Figur 6. Lundeværket, klaringstank. Venstre: Slidt og delvist omsat skalfragment. Højre: Delvist omsat ben, oprindelse ukendt. Delkonklusion, sediment fra klaringstanke på vandforsyningsanlæg på Fyn Der blev fundet levende cyclops og små levende ostrakoder, samt afrevne lemmer fra krebsdyr i prøverne. I særlig grad fra hovedværket og i mindre grad fra Lundeværket. I Lindved er sedimentet fattigt på genkendelige rester, men der blev fundet et æg og noget, som måske kan være pellets. Der er ikke fundet pellets fra Asellus aquaticus Hvis der har forekommet pellets, bliver de tilsyneladende slået i stykker af de kraftige og hurtigløbende pumper, der anvendes ved returskylning af filterne. Ved en gentagen prøvetagning G E U S 88

89 89 skal der derfor udtages en prøve over og fra sandfiltret i hovedværket, når der returskylles. Til gengæld er der fundet nogle ganske små pellets, der hidrører fra andre dyr. HOFOR. Sedimentprøver udtaget af Hovedstadsområdets Forsyningsselskab. Alle prøver er udtaget af HOFOR, pakket og fremsendt i kølekasser med køleelementer efter forskrifterne gennemgået i bilag 2. Prøvelokaliteternes beliggenhed fremgår af figur 7, der viser et kort udarbejdet af HOFOR. Figur 7. Kort med placering af lokaliteter, hvor HOFOR har udtaget sedimentprøver. Søsø Søndersø. Kortet er udarbejdet af Københavns Energi. G E U S 89

90 90 SØSØ EF2 Blødt sediment med grus, trådet. Mørke pellets? virker sidt. Slim tråde er fæstet på næsten alle gruspartikler bakterievækst. Figur 8. SØSØ EF2. Venstre: gruspartikler og fint jernslam. Midten: tråd formet bakterievækst på grus fra det biologisk aktive filter. Højre: næsten helt omsat biologisk struktur. Æbelholt vakuum Figur 9. Æbelholt vakuum. Højre: ulden/slidt pellets. Højre midten: hår formet struktur. Venstre midten: omsat ydre del af ben formodentlig fra isopod. Venstre: Sammentrukket orm formodentlig en lille fladorm. En tern svarer til 1x1 mm. Vand med en smule bundfald. Der er observeret organiske strukturer muligvis biofilm eller nedbrudt skalrest. Mulige benfragmenter nedbrudte Ringorm? Minder om dyr fra Fårdrup, der er ikke tale om fiber. 1 stk pellet. En del døde små snegle/sammentrukne orme eller henfaldne cyklops Mulige skalfragmenter/afskalninger af biofilm. Isopod ben ganske henfaldet, næsten sikker bestemmelse Et stk død ostrakod + skalfragment der ligner en del af et knæled. Attemose st 1 Rester af biofilm, mulige pellets slidte. Næsten rent vand G E U S 90

91 91 Strø vakuum beholder Vand med fint okker, svæver lang tid i vandet. Spikler? Intet tegn på liv. Slangerup Filtersediment Fint rent slam, fedt, når man vasker sedimentet findes dog en del slidte korn, hvor nogle kan stamme fra Asellus aquaticus. En spikkel i sedimentet kan stamme fra Asellus. Sediment virker ret dødt! Figur 10. Slangerup filtersediment. Venstre: ostracod begge skaller er intakte. Højre: vasket sediment med grynet struktur der kan stamme fra pellets. Bl. a. centralt i foto ses en stribet langstrakt pellets der minder meget om en pellets fra Asellus aquaticus. Tilsvarende stribning ses på andre pellets. SØSØ EF 8 Blødt finkornet okkerslam, stærkt orange, med enkelte gruspartikler. Udfældning af kalkkrystaller på overflader, Flager af okkerfarvede kalkudfældninger? Ingen fecal pellets, men en del slim pellets (mest slim men opblandet med sedimentpartikler/okker). Mulige skal og benfragmenter stærkt nedbrudt, enkelte slim/algetråde. SØSØ EF 5 Blødt orange okkerslam med grus partikler. Mange slim/alge tråde på gruspartikler (se fotos). Gennemsigtigt hvidligt hår muligvis spikkel. Netop i denne prøve findes en del beskidte luftperler der minder om æg. G E U S 91

92 92 Figur 11. SØSØ EF5. Venstre: trådet okkerslam og grus fra jernfiltret. En beskidt luft boble ses i højre side af foto. Venstre: bakterie tråde fæstnet til grus partikler. Attemose vakuum Rent vand klart Bogøgård vakuum Klart vand med lidt fnuller intet tegn på liv SØSØ EF 7 Blødt orange okkerslam med en del gruspartikler. Kalkflager/orange, slim tråde på gruspartikler, muligt fragment af ben. Figur 12. SØSØ EF7. Venstre: Blødt okkerslam med en ostracod skal til venstre i foto. Højre renvaskede gruspartikler med bakterie tråde fæstnet på gruspartiklerne, taget i modlys. G E U S 92

93 93 SØSØ EF 3 Blødt okkerslam, gruset, grus med slimtråde. En del klare hår muligvis afbrækket fra ben. Et muligt æg fotograferet gik dog i opløsning når der blev tilført sprit muligvis en lille luftperle. Intet tegn på liv ikke et gæstfrit miljø. Bemærkning: Der er for øvrigt mange hår i alle sedimentprøver er nogle af rørene lavet af fiberholdigt materiale? Figur 13. SØSØ EF 3. Venstre: orange fint og blødt okkerslam med et ganske lille perlemorsfarvet æg, muligvis en luftperle. Højre: lille spikkel der flyder i rødt okkerslam. Ligner de hår man ser på krebsdyrene. Delkonklusion, sedimentprøver i vandindvindingsanlæg, HOFOR Der blev ikke fundet levende Asellus aquaticus i de undersøgte prøver, men der var spor i nogle af prøverne, hvor der blev fundet pellets, omsatte fragmenter der kan stamme fra krebsdyr, samt en del spikkellignende små fragmenter. I mange prøver blev der fundet trådformet vækst af bakterier, hvor bakterierne ofte var hæftet til gruspartikler der ved tilbageskylning er ført fra det biologisk aktive jernfilter til klaringstankene. I nogle at prøverne blev der også fundet småorme, mulige æg, ostracoder mm. I forhold til prøverne fra Fyn indeholder HOFOR prøverne ikke levende organismer eller så mange spor efter disse. Tabel 1 viser en oversigt af nøgleparametre i de undersøgte prøver fra Fyn og Sjælland. G E U S 93

94 Fyn Sjælland 94 Lokalitet Slangerup filtersediment Beskrivelse af sedimentprøve Grus Fint slam Asellus hel/ fragment Asellus pellets Andre pellets bakterie tråde Andre dyr æg sediment virker "dødt" Antal dyr Pr kg sediment DNA måling nej ja nej muligvis ja ja ostracod nej ja 0,16 Strø Vakuum beholder nej Suspenderet nej nej nej nej nej, muligvis spikler nej ja 0,03 Attemose St. 1 nej ganske lidt Æbelholt Vakuum beh nej nej ja ja nej nej nej 0,1 nej ja muligvis muligvis ja ja orme, ostracoder, skalfragmenter SØSØ EF 2 ja ja nej nej slidte pellets + små nej nej 0,12 masser nej nej nej 1,42 SØSØ EF 3 ja ja nej nej muligvis ja spikler muligvis fra benene på Asellus SØSØ EF 5 ja ja nej nej nej ja mange spikler muligvis fra benene på Asellus SØSØ EF 7 ja ja nej muligvis ja ja ostracod, ben fragmenter muligvis Asellus SØSØ EF 8 enkelte ja nej, dog nedbrudte rester nej, en del nedbrudte? ja ja skalfragmenter muligvis Asellus ja, muligvis ja 0,38 nej nej 0,42 nej nej 2,08 nej nej 0,84 Bogøgård Vakbeh klart vand lidt fnuller 0 Attemose Vakbeh klart vand 0 Lindvedværket Lundeværket, nyt Odense Hovedværk, gammelt ja ja nej nej ja, få ja skalfragmenter formodentlig fra filter grus ja ja muligvis nej få ja ja, ben fragmenter og gennemsigtige skjold fragmenter ja ja ja muligvis ja ja ja levende cyclops og ostracoder ja ja 32,35 nej delvist 0,31 ja nej 0,32 Tabel 1. Beskrivelse af sediment prøver med en oversigt af karakteristiske fund fx af levende dyr, kropsdele fra disse mm. Den sidste kolonne viser om der er fundet DNA spor i de undersøgte sedimentprøver. G E U S 94

95 95 Bilag 4: Fund af grundvandsdyr DGUnr , TRE- FOR Vand Ved en renpumpning af DGUnr gennemført af Vandcenter Syd d. 12/ for TREFOR Vand A/S, blev den 79 meter dybe boring videofilmet efter oprensning. Boringen ligger lidt nord for Vejle og tilhører TREFOR Vand, Lysholt Vandværk. Figur 1 Grundvandsdyr i vandværksboring DGUnr Fotos fra boring er taget af teknikere fra Vandcenter syd. Dyret er ca mm langt. Haleskjoldet er mindre og dyret har flere led end Asellus aquaticus. Da videofilmen blev uploadet kravlede et lille krebsdyr op af en vandførende revne i bunden af boringen, hvorefter dyret gik en lille runde for dernæst at kravle ned i revnen igen. Da filmen var ved at blive uploadet, blev dyret desværre ikke videofilmet, men teknikerne G E U S 95

96 96 fra Vandcenter Syd fotograferede videoskærmen med deres mobiltelefoner, figur 1. Videofilmen viste, at der strømmede grundvand op af en revne i kvartssandet i boringens bund under renpumpningen. Figur 1 viser et grundvandsdyr der er meget forskelligt fra Asellus aquaticus: Der et tale om et krebsdyr, der ligner en almindelig landlevende bænkebidder af form, men skjoldet er gennemsigtigt, og dyret har tilsyneladende en lidt anderledes opbygning m.h.t. til led, og en flad kropsbygning, hvor man kan se hvide felter (mulige fedtdepoter) under skjoldet. Da Asellus aquaticus er den hidtil eneste kendte vandlevende isopod i Danmark, kan fundet af denne isopod der lever i grundvand i bunden af en 78 meter dyb boring betyde, at antallet af vandlevende isopoder i Danmark er udvidet med en ny art. Vandspejlet i boringen har gennem de seneste år stået i ca mut, hvilket betyder, at der stod ca. 30 meter vand i boringen, da grundvandsdyret blev fotograferet. Boringen indvinder vand fra et filter placeret i intervallet meter under terræn. Af tabel 1 fremgår, at der i den øvre del af boringen forekommer 20 meter moræneler, og at der er to andre morænelerslag på henholdsvis 2,5 og 7 meters tykkelse under det øverste morænelerslag. Det nederste morænelerslag på 7 meter er underlejret af 34 meter smeltevandssand, der igen er underlejret at kvartssand, hvori boringens filter/indtag er placeret. Grundvandet i boringen indeholder op til 2 mg opløst jern pr liter, men i december 2009, et år før renpumpningen, blev der målt 0,4 mg ilt/liter i blandingsvand fra boringen. Grundvandet indeholder ikke nitrat og kun små mængder klorid (18-28 mg/l). Da der, i det mindste periodevis, forekommer små mængder ilt i grundvandet, kan det ikke udelukkes, at der i kvartssandet forekommer grundvand, der er infiltreret i områder i boringens opland, hvor der ikke forekommer dæklag af moræneler, og hvor der derfor kan transporteres iltholdigt vand til større dybder. En tyk umættet zone betyder også, at der vil/kan forekomme poreluft med ilt under lerlagene, og at der derfor er mulighed for at større krebsdyr kan overleve i kvarts og smeltevandssandet i omkring boringens indtag. Tabel 1 De gennemborede lag i boring DGUnr ml moræneler, dg - smeltevandsgrus, ds smeltevandssand (ds oprindeligt diluvial sand syndflodssand som i dag tolkes som sand aflejret af større smeltevandsfloder under og efter istiden), ks - kvartssand, gs glimmersand. Top og bund top og bund af lag. G E U S 96

Randers Kommune. Orientering til ejere af private enkeltboringer og brønde om kommunens tilsyn med drikkevandskvaliteten

Randers Kommune. Orientering til ejere af private enkeltboringer og brønde om kommunens tilsyn med drikkevandskvaliteten Randers Kommune Orientering til ejere af private enkeltboringer og brønde om kommunens tilsyn med drikkevandskvaliteten Teknisk forvaltning vand og virksomheder Oktober 2001 Tilsyn Randers Kommune fører

Læs mere

Vejledning nr. 307 11/2011 Gammelt nr. 105

Vejledning nr. 307 11/2011 Gammelt nr. 105 Vejledning nr. 307 11/2011 Gammelt nr. 105 Emne: Forbrugerinformation Ifølge 28 i bekendtgørelse nr. 1024 af 31. oktober 2011 om vandkvalitet og tilsyn med vandforsyningsanlæg skal vandværkerne stille

Læs mere

Teknisk hygiejnisk tilsyn på Bøsserup Vandværk

Teknisk hygiejnisk tilsyn på Bøsserup Vandværk Bøsserup Vandværk A M B A Formand Rudy Ploug formanden@bosserupvv.dk Den 22. april 2014 Teknisk hygiejnisk tilsyn på Bøsserup Vandværk Odsherred Kommune har den 13. januar 2014 foretaget varslet tilsyn

Læs mere

Bioaugmentering til oprensning af pesticidpunktkilder

Bioaugmentering til oprensning af pesticidpunktkilder Bioaugmentering til oprensning af pesticidpunktkilder MCPP Anders Johansen, Aarhus Universitet, Institut for Miljøvidenskab. Miljøingeniør Katrine Smith, Miljøstyrelsen. Hydrogeolog Hasse Milter, Region

Læs mere

Figur 1 Skitse af nedsivningsanlæg

Figur 1 Skitse af nedsivningsanlæg Nedsivningsanlæg I et nedsivningsanlæg bortskaffes spildevandet ved, at vandet siver ned gennem jordlagene til grundvandet. Spildevandet pumpes fra bundfældningstanken over i selve nedsivningsanlægget,

Læs mere

# $ % $ $ #& $ & # ' # ' & # $ &($ $ ( $ $ )!# $& $

# $ % $ $ #& $ & # ' # ' & # $ &($ $ ( $ $ )!# $& $ " # % % # # ' # ' # ( ( )# " ) " ", " - * " - ". % " " * / 0 *+ # 2, *3 4 # % " "/ *1 4 /0' /6 )77*)/8 9 )77)-/6 : 9 ;)777*/ 0)77.. 0 + +7< 17< '=-7 ' > *> " +?. @ *5 #. @ ' -. '* - " '=*777 - ' > *> 8

Læs mere

Indtagsbegrebet. Eks. på boring i kalk.

Indtagsbegrebet. Eks. på boring i kalk. Indtagsbegrebet Indtag er et stykke af boringen, som indeholder et eller flere filtre. Det er det sted hvor vandet løber til/ind i boringen og/eller det sted, hvorfra der bliver taget vandprøver. Et indtag

Læs mere

Hvad betyder? Sådan læser Du en vandanalyse: Direkte undersøgelse:

Hvad betyder? Sådan læser Du en vandanalyse: Direkte undersøgelse: Hvad betyder? Sådan læser Du en vandanalyse: Direkte undersøgelse: Temperatur ved prøvetagning: For høj temperatur på drikkevandet påvirker smagsindtrykket og kan give risiko for bakterievækst. Der er

Læs mere

Hovedstadsområdets Vandsamarbejde VAND. Vand er liv brug det med omtanke

Hovedstadsområdets Vandsamarbejde VAND. Vand er liv brug det med omtanke Hovedstadsområdets Vandsamarbejde VAND Vand er liv brug det med omtanke Renhed Vand er liv Energi Fællesskab Velvære Leg Lyst Ansvar Omtanke Behov For millioner af år siden var hele kloden dækket af vand.

Læs mere

Notat. Holbæk Kommune HOLBÆK ARENA Hydraulisk analyse 1 BAGGRUNDEN FOR NOTATET 2 TYPER AF UDFORDRINGER. 2.1 Risiko for oversvømmelser

Notat. Holbæk Kommune HOLBÆK ARENA Hydraulisk analyse 1 BAGGRUNDEN FOR NOTATET 2 TYPER AF UDFORDRINGER. 2.1 Risiko for oversvømmelser Notat Holbæk Kommune HOLBÆK ARENA Hydraulisk analyse 8. november 2012 REV.25-11-2012 Projekt nr. 211553 Dokument nr. 125590549 Version 3 Udarbejdet af MSt Kontrolleret af ERI Godkendt af MSt 1 BAGGRUNDEN

Læs mere

GEUS-NOTAT Side 1 af 3

GEUS-NOTAT Side 1 af 3 Side 1 af 3 Til: Energistyrelsen Fra: Claus Ditlefsen Kopi til: Flemming G. Christensen GEUS-NOTAT nr.: 07-VA-12-05 Dato: 29-10-2012 J.nr.: GEUS-320-00002 Emne: Grundvandsforhold omkring planlagt undersøgelsesboring

Læs mere

Bilagsrapporter Grønt Regnskab 2011 - Herning Vand A/S

Bilagsrapporter Grønt Regnskab 2011 - Herning Vand A/S Bilagsrapporter Grønt Regnskab 2011 - Herning Vand A/S Herning Vand A/S Herning Vand A/S er et selvstændigt forsyningsselskab, der transporterer og renser spildevandet i Herning Kommune, samt indvinder

Læs mere

Biologisk rensning Fjern opløst organisk stof fra vand

Biologisk rensning Fjern opløst organisk stof fra vand Spildevandscenter Avedøre Biologisk rensning Fjern opløst organisk stof fra vand Øvelse I Formål: På renseanlægget renses et mekanisk, biologisk og kemisk. I den biologiske rensning på renseanlægget benyttes

Læs mere

Hvornår slår effekten af forskellige foranstaltninger igennem i vandmiljøet

Hvornår slår effekten af forskellige foranstaltninger igennem i vandmiljøet Side 1/7 Til: Torben Moth Iversen Fra: Hans Jørgen Henriksen Kopi til: JFR, ALS Fortroligt: Nej Dato: 17. november 2003 GEUS-NOTAT nr.: 06-VA-03-08 J.nr. GEUS: 0130-019 Emne: Hvornår slår effekten af forskellige

Læs mere

Fredericia Kommune Bilag 2 Spildevandsplan for det åbne land 2007-2011. Side 1

Fredericia Kommune Bilag 2 Spildevandsplan for det åbne land 2007-2011. Side 1 Spildevandsplan for det åbne land 2007-2011. Side 1 ANLÆGSTYPER 1.0 Generelt. Fredericia kommune er godkendelsesmyndighed for anlæg på 30 PE og derunder. Ansøgning ved anlæg større end 30 PE skal indsendes

Læs mere

Kun en dråbe... 3 historier i én: Spildevandet på landet Spildevandet i byen Vandets kredsløb

Kun en dråbe... 3 historier i én: Spildevandet på landet Spildevandet i byen Vandets kredsløb Kun en dråbe... 3 historier i én: Spildevandet på landet Spildevandet i byen Vandets kredsløb Følg en vanddråbes rejse fra vandhanen, gennem kloakken, renseanlægget og naturens eget renseproces. DANSKE

Læs mere

Tilladelse til forlænget drift af UV-anlæg ved afgang fra Tinghøj Højdebeholderanlæg

Tilladelse til forlænget drift af UV-anlæg ved afgang fra Tinghøj Højdebeholderanlæg Miljøafdelingen Gladsaxe Kommune Rådhus Allé 7, 2860 Søborg Telefon: 39 57 59 29. E-mail: miljo@gladsaxe.dk HOFOR A/S Ørestads Boulevard 35 2300 København S 20. november 2014 Tilladelse til forlænget drift

Læs mere

Odense. OBH Indeklima. Ny DNA-teknologi til vurdering af arbejdspladsens indeklima. Århus Kolding. Hillerød. Niels Skals, Biolog PhD Produktchef

Odense. OBH Indeklima. Ny DNA-teknologi til vurdering af arbejdspladsens indeklima. Århus Kolding. Hillerød. Niels Skals, Biolog PhD Produktchef Ny DNA-teknologi til vurdering af arbejdspladsens indeklima Århus Kolding Odense Hillerød, Biolog PhD Produktchef Dagens Danmark - en ny arbejdsplads bliver til! Der er gener men.. årsagen? Luftprøver

Læs mere

1. Fakta om drikkevand 2. Vand og geologi 3. Kalk og kridt 4. Grundvand 5. Drikkevand 6. Overvågning og forurening

1. Fakta om drikkevand 2. Vand og geologi 3. Kalk og kridt 4. Grundvand 5. Drikkevand 6. Overvågning og forurening 6 1. Drikkevand 1. Fakta om drikkevand 2. Vand og geologi 3. Kalk og kridt 4. Grundvand 5. Drikkevand 6. Overvågning og forurening 7. Case A: Syrer og baser Case B: Østerbyværket Case C: Rensning Case

Læs mere

Adresse: Nylandsvej 16 Formand: Sønnik Linnet, Kærgårdvej 5, 6280 Højer Dato for besigtigelse: Den 21. september 2011

Adresse: Nylandsvej 16 Formand: Sønnik Linnet, Kærgårdvej 5, 6280 Højer Dato for besigtigelse: Den 21. september 2011 Vandværket Generelle data Lokalitet / JUP PlantID: 517-V02-20-0002 / 116353 Navn: Adresse: Nylandsvej 16 Kontaktperson: Formand: Sønnik Linnet, Kærgårdvej 5, 6280 Højer Dato for besigtigelse: Den 21. september

Læs mere

DANPURE HOME 200 TDS,

DANPURE HOME 200 TDS, Memo Type Dato Tilsluttet DANPURE OFFICE 200 TDS DanPure DR IN KING WATER S YS TEM Navn Adresse TLF: REVERSE OSMOSIS SYSTEM DANPURE HOME 200 TDS BRUGER MANUAL 19 01 02 03 04 05 06 07 12 13 14 15 17 18

Læs mere

Kvalitetskrav til drikkevand Fysiske og kemiske parametre Eurofins

Kvalitetskrav til drikkevand Fysiske og kemiske parametre Eurofins Kvalitetskrav til drikkevand Fysiske og kemiske parametre Eurofins Lugt og smag Organoleptisk undersøgelse, hvor det vurderes om vandet er fri for lugt og smager normalt Temperatur Det bør tilstræbes,

Læs mere

9. Er jorden i Arktis en tikkende bombe af drivhusgasser?

9. Er jorden i Arktis en tikkende bombe af drivhusgasser? 9. Er jorden i Arktis en tikkende bombe af drivhusgasser? Af Peter Bondo Christensen og Lone Als Egebo I det højarktiske Nordøstgrønland ligger forsøgsstationen Zackenberg. Her undersøger danske forskere,

Læs mere

Er der gift i vandet?

Er der gift i vandet? Er der gift i vandet? Hvordan måler man giftighed? Og hvordan fastsætter man grænseværdier? Introduktion I pressen ser man ofte overskrifter som Gift fundet i grundvandet eller Udslip af farlige miljøgifte

Læs mere

Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold.

Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold. Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold. Juni 2011 Helle Frank Skall og Niels Jørgen Olesen Veterinærinstituttet, Danmarks

Læs mere

9. Øvelse: Demonstration af osmose over en cellemembran

9. Øvelse: Demonstration af osmose over en cellemembran 1. Drikkevand 9. Øvelse: Demonstration af osmose over en cellemembran Teori I spildevandsrensning er det især mikroorganismer og encellede dyr der fjerner næringssaltene. For at sådanne mikroorganismer

Læs mere

Tænk dig om: Du bor oven på dit drikkevand

Tænk dig om: Du bor oven på dit drikkevand Tænk dig om: Du bor oven på dit drikkevand 1 fersk grundvand salt grundvand Vi er privilegerede i Danmark Vi kan åbne for vandhanen og drikke vandet direkte fra den. Sådan skal det gerne blive ved med

Læs mere

NorthPestClean. Notat. Dræning og tæthedsprøvning af testceller 22-11-2011. Projekt nr.: Life09/ENV/DK368

NorthPestClean. Notat. Dræning og tæthedsprøvning af testceller 22-11-2011. Projekt nr.: Life09/ENV/DK368 NorthPestClean Notat Dræning og tæthedsprøvning af testceller 22-11-2011 Projekt nr.: Life/ENV/DK368 Dræning og tæthedsprøvning af testceller Indholdsfortegnelse 1 Indledning...2 2 Testcelle 1...3 2.1

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Oprensning af genomisk DNA fra plantemateriale Manual Katalog nr. 166-5005EDU explorer.bio-rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, februar 2009

Læs mere

AKTIV RENGØRING MED BIOTEKNOLOGI

AKTIV RENGØRING MED BIOTEKNOLOGI AktivE Bakterier & Enzymer AKTIV RENGØRING MED BIOTEKNOLOGI Nilfisk Biobact er et miljørigtigt rengøringsmiddel, som består af mikroorganismer og enzymer. Biobact Clean ALT-I-ET-RENGØRING Nilfisk Biobact

Læs mere

Drikkevandsforureninger 2010. Opgørelse af sager behandlet af Embedslægerne

Drikkevandsforureninger 2010. Opgørelse af sager behandlet af Embedslægerne Drikkevandsforureninger 2010 Opgørelse af sager behandlet af Embedslægerne Organisation Embedslægerne arbejder i Sundhedsstyrelsens lokalkontorer i regionerne Der er lokalkontorer i følgende byer: Embedslægerne

Læs mere

Vandløbet et tværfagligt samarbejde

Vandløbet et tværfagligt samarbejde Ny skriftlighed i geografi/naturgeografi: B opgave Problemløsende hensigt; fx rapport, teoriafklarende opgaver, SRP/SS0 formuleringer, AT formuleringer 2011 Vandløbet et tværfagligt samarbejde 1 Formål:

Læs mere

FISKE ANATOMI DTU Aqua, Danmarks Tekniske Universitet

FISKE ANATOMI DTU Aqua, Danmarks Tekniske Universitet Gæller Seniorrådgiver Alfred Jokumsen Danmarks Tekniske Universitet (DTU) Institut for Akvatiske Ressourcer (DTU Aqua) Nordsøen Forskerpark, 9850 Hirtshals 1 DTU Aqua, Danmarks Tekniske Universitet FISKE

Læs mere

GODT VAND ER RENT VAND. Ny plan mod jordforurening SYDDANMARK. Danmarks bedste drikkevand er fra Syddanmark

GODT VAND ER RENT VAND. Ny plan mod jordforurening SYDDANMARK. Danmarks bedste drikkevand er fra Syddanmark SYDDANMARK Ny plan mod jordforurening GODT VAND ER RENT VAND Danmarks bedste drikkevand er fra Syddanmark Flere penge til grundvandstruende forureninger 1 intro Tekst: Morten Pickel / Foto: Hyldager Fotografi

Læs mere

VANDINDVINDINGS INDFLYDELSE PÅ VANDKVALITET: Konceptuelle betragtninger Loren Ramsay

VANDINDVINDINGS INDFLYDELSE PÅ VANDKVALITET: Konceptuelle betragtninger Loren Ramsay VANDINDVINDINGS INDFLYDELSE PÅ VANDKVALITET: Konceptuelle betragtninger Loren Ramsay ATV Mødenr. 58 om Grundvandskvalitet H.C. Andersen Hotel, Odense 19. maj 2010 VANDINDVINDINGS INDFLYDELSE PÅ VANDKVALITET:

Læs mere

Regnvandstønde. Hvordan nedsætter jeg min vandregning?

Regnvandstønde. Hvordan nedsætter jeg min vandregning? Regnvandstønde Hvordan nedsætter jeg min vandregning? Regnvandsopsamling er et enkel og billigt system til vandbesparelser. Du behøver nemlig ikke nødvendigvis at bruge rent drikkevand til toiletskyl,

Læs mere

Grønt regnskab. for. Kristrup Vandværk a.m.b.a.

Grønt regnskab. for. Kristrup Vandværk a.m.b.a. Grønt regnskab 2013 for Kristrup Vandværk a.m.b.a. CVR. nr. 34 744 726 10. marts 2014 Udarbejdet til Generalforsamlingen onsdag den 19. marts 2014 af Michael Mose vandværksbestyrer 1 1. Indledende oplysninger...

Læs mere

Kvalitetskrav til drikkevand

Kvalitetskrav til drikkevand - 1 - Forbrugerne stiller krav til kvaliteten af et. Og krav til information fra vandværker/vandforsyninger. Kravene til information i forhold til forbrugerne skærpes yderligere. Bekendtgørelse nr. 1024

Læs mere

Spildevandsrensning i det åbne land

Spildevandsrensning i det åbne land Spildevandsrensning i det åbne land Ejendomme og sommerhuse i det åbne land, som ikke er tilsluttet offentlig kloak, skal have en lovlig og godkendt spildevandsløsning. Kan du svare ja til et eller flere

Læs mere

Kombinationer af våde og tørre arealer samt forskellige græsningsdyr

Kombinationer af våde og tørre arealer samt forskellige græsningsdyr Genetablering af natur med forskellige græsningsdyr, side 1 af 8 Kombinationer af våde og tørre arealer samt forskellige græsningsdyr Af naturkonsulent Lisbeth Nielsen, Natur & Landbrug, og seniorforsker

Læs mere

TILSYNSRAPPORT. Oxby Ho Vandværk. Hygiejnekursus Ja Driftskursus Ja

TILSYNSRAPPORT. Oxby Ho Vandværk. Hygiejnekursus Ja Driftskursus Ja TILSYNSRAPPORT Oxby Ho Vandværk Kontaktoplysninger på tilsynsførende: Navn: Hardy Skov E-mail: hask@varde.dk Telefon: 79 94 74 60 Sags nr. 11/1583 Dok. nr. 127918/14 Dato for sidste tilsyn: 30. 08. 2011

Læs mere

Bakterie forurening. Handlingsplan 2007. Ø. Svenstrup Vandværk

Bakterie forurening. Handlingsplan 2007. Ø. Svenstrup Vandværk Bakterie forurening Handlingsplan 2007 Ø. Svenstrup Vandværk Rapport er udarbejdet af : Jørgen Krogh Andersen, Hydrogeolog, DVN - tlf. 98 66 66 66 Kvalitetssikring : Dorthe Michelsen, Teknisk assistent,

Læs mere

Bekendtgørelsen har fortsat til formål at beskytte jord og grundvand, og bekendtgørelsens tekniske krav er målrettet dette formål.

Bekendtgørelsen har fortsat til formål at beskytte jord og grundvand, og bekendtgørelsens tekniske krav er målrettet dette formål. Miljøudvalget 2013-14 MIU Alm.del Bilag 37 Offentligt Dato: 21. oktober 2013 J. nr.: MST-1210-00041 Høringssvar vedr. udkast til bekendtgørelse om jordvarmeanlæg Idet vi takker for at have modtaget udkastet

Læs mere

Demonstrationsprojekt Minirenseanlæg til fjernelse af N og P fra drænvand og vandløbsvand

Demonstrationsprojekt Minirenseanlæg til fjernelse af N og P fra drænvand og vandløbsvand EU LIFE projekt AGWAPLAN Demonstrationsprojekt Minirenseanlæg til fjernelse af N og P fra drænvand og vandløbsvand Foto fra af minirenseanlægget foråret 2008. Indløbsrenden med V-overfald ses i baggrunden,

Læs mere

Spørgsmål og svar fra informationsmøde d. 14. maj 2013

Spørgsmål og svar fra informationsmøde d. 14. maj 2013 Dato Ansvarlig Sags ID. 16. maj 2013 Frits Klemmensen USG-2013-00007 Spørgsmål og svar fra informationsmøde d. 14. maj 2013 Spørgsmål Kloak: Hvorfor laver man ikke regnvandskloak alle steder? Hvor skelner

Læs mere

ODDER VANDVÆRK A.m.b.a. SKOVDALSVEJ 8 8300 ODDER

ODDER VANDVÆRK A.m.b.a. SKOVDALSVEJ 8 8300 ODDER ODDER VANDVÆRK A.m.b.a. SKOVDALSVEJ 8 8300 ODDER GRØNT REGNSKAB FOR 2014 INDHOLDSFORTEGNELSE 1 INDLEDENDE OPLYSNINGER... 3 1.1 Virksomhed... 3 1.2 Branche... 3 1.3 Organisation... 3 1.4 Andelshavere pr.

Læs mere

Hvad fortæller en drikkevandsanalyse?

Hvad fortæller en drikkevandsanalyse? Hvad fortæller en drikkevandsanalyse? Den bakteriologiske vandanalyse Kimtal, 22 C Dette kimtal giver et udtryk for antallet af "kuldeelskende" bakterier, der kan være naturligt forekommende i naturen,

Læs mere

Fødevarelovgivningens rammer for rensning og genbrug af vand

Fødevarelovgivningens rammer for rensning og genbrug af vand Fødevarelovgivningens rammer for rensning og genbrug af vand Eva Høy Engelund, ph. d. (food science) Miljø og Toksikologi, DHI ehe@dhigroup.com 4516 9096 18. Marts 2015, Odense Indhold Hvor findes reglerne,

Læs mere

Grundvandsdannelse og udnyttelse af grundvandet

Grundvandsdannelse og udnyttelse af grundvandet Grundvandsdannelse og udnyttelse af grundvandet I vandplanerne er målet at 35 % af det dannede grundvand kan gå til vandindvinding. Det svarer til at lidt under 1.000 m 3 /ha/år af den årlige nedbør kan

Læs mere

Datakilder JUPITER, Miljøportal Vandværket d. 04-10-2010

Datakilder JUPITER, Miljøportal Vandværket d. 04-10-2010 Englerup Indelukke Vandværk Vandværket Generelle data Lokalitet: 350-V02-0042-00 Navn: Englerup Indelukke Vandværk Adresse: Indelukket 31, 4060 Kirke-Såby Kontaktperson: Formand: Allan Meier Bahn Dato

Læs mere

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Formål: at undersøge udviklingen i mængden af tilsatte patogene bakterier til hønsegødning.

Læs mere

Sådan undgår du vand i kælderen

Sådan undgår du vand i kælderen Sådan undgår du vand i kælderen Sammen har vi ansvaret Det samlede spildevandsledningsnet i Guldborgsund Kommune er på ca. 900 km. Der er store variationer i tilstanden af vores ledningsnet, men generelt

Læs mere

Tilstandsrapport og status Beauvais

Tilstandsrapport og status Beauvais Holbæk Kommune, Teknik og Miljø Tilstandsrapport og status Beauvais Maj 2010 Holbæk Kommune Side 2 Indholdsfortegnelse 1. Indledning 2. Nøgledata for vandværket 3. Vandkvalitet 4. Indvindingsanlæg 5. Vandværk

Læs mere

DATABLAD - BARSØ VANDVÆRK

DATABLAD - BARSØ VANDVÆRK Aabenraa Kommune Steen Thomsen 2014.07.31 1 Bilag nr. 1 DATABLAD - BARSØ VANDVÆRK Generelle forhold Barsø Vandværk er et alment vandværk i Aabenraa Kommune. Vandværket er beliggende centralt på Barsø (fig.

Læs mere

21. OKTOBER 2014 TRYK OG TRYKKOTER. En kort forklaring om begreberne meter vandsøjle og meter over havet. Lejre Vandråd

21. OKTOBER 2014 TRYK OG TRYKKOTER. En kort forklaring om begreberne meter vandsøjle og meter over havet. Lejre Vandråd 21. OKTOBER 2014 TRYK OG TRYKKOTER En kort forklaring om begreberne meter vandsøjle og meter over havet Lejre Vandråd Indholdsfortegnelse 1. Tryk og trykkoter i et vandforsyningssystem... 3 1.1 Tryk og

Læs mere

Pilerensningsanlæg. Pileanlæg op til 30 PE Pileanlæg med nedsivning op til 30 PE Begge anlægstyper er SOP anlæg

Pilerensningsanlæg. Pileanlæg op til 30 PE Pileanlæg med nedsivning op til 30 PE Begge anlægstyper er SOP anlæg Pileanlæg op til 30 PE Pileanlæg med nedsivning op til 30 PE Begge anlægstyper er SOP anlæg Status på anlæg efter 18 år. 23 år på Amdis anlæg i Tappernøje. Nye typer og erfaringer hermed. Hydraulisk omsætning

Læs mere

Indsatsplan. for Skagen Klitplantage

Indsatsplan. for Skagen Klitplantage Indsatsplan for Skagen Klitplantage Skrevet af Gruppe A213, Aalborg Universitet, 2010 Side 1 af 14 Indholdsfortegnelse Indledning... 3 Det siger loven om indsatsplaner... 3 Baggrund... 4 Sammenfatning...

Læs mere

Plakaten - introduktion

Plakaten - introduktion Plakaten - introduktion På plakaten kan du se den store havøgle Mosasaurus. Den var et krybdyr, der kunne blive helt op til 15 meter langt. Nogle kalder den for havets Tyrannosaurus. Det var fordi den

Læs mere

Risikovurdering uden brug af Miljøstyrelsens screeningsværktøj

Risikovurdering uden brug af Miljøstyrelsens screeningsværktøj Risikovurdering uden brug af Miljøstyrelsens screeningsværktøj Vintermøde den 11. marts 2015, Fagsession 4 Sandra Roost, Orbicon A/S Risiko for overfladevand. Efter ændring af jordforureningsloven pr.

Læs mere

Ord forklaring af analyse rapporter

Ord forklaring af analyse rapporter Ord forklaring af analyse rapporter Den kemiske analyse Farvetal Et højt farvetal er udtryk for, at vandet ikke er farveløst, men mere eller mindre gulligt. Denne gulfarvning skyldes som regel et højt

Læs mere

Kvalitetskrav til drikkevand

Kvalitetskrav til drikkevand -1 - Forbrugerne stiller krav til kvaliteten af et. Og krav til information fra vandværker/vandforsyninger. Kravene til information i forhold til forbrugerne skærpes yderligere. Bekendtgørelse nr. 1449

Læs mere

Tilladelse til etablering af 1 boring på matr. nr. 1857, Rødding Ejerlav, Rødding samt tilladelse til prøvepumpning af boringen.

Tilladelse til etablering af 1 boring på matr. nr. 1857, Rødding Ejerlav, Rødding samt tilladelse til prøvepumpning af boringen. Dato: 09-07-2015 Sagsnr.: 15/19015 Kontaktperson: Iben Nilsson E-mail: teknik@vejen.dk Rødding Vandforsyning Vestermarksvej 1 6630 Rødding Sendt pr. mail til: rvcentral@mail.tele.dk Og lcs@dge.dk Tilladelse

Læs mere

Vandløb: Der er fastsat specifikke mål for 22.000 km vandløb og der er planlagt indsats på 5.300 km vandløb (sendt i supplerende høring).

Vandløb: Der er fastsat specifikke mål for 22.000 km vandløb og der er planlagt indsats på 5.300 km vandløb (sendt i supplerende høring). FAQ OM VANDPLANERNE Hvor hurtigt virker planerne? Naturen i vandløbene vil hurtigt blive bedre, når indsatsen er sket. Andre steder kan der gå flere år. I mange søer er der akkumuleret mange næringsstoffer

Læs mere

NOTAT. København, den 03.05.2012 Rev. 01.06.2012 Projekt nr.: 6369-001 Dir. tlf.: +45 2540 0369. Projekt: Klimavej

NOTAT. København, den 03.05.2012 Rev. 01.06.2012 Projekt nr.: 6369-001 Dir. tlf.: +45 2540 0369. Projekt: Klimavej NOTAT Projekt: Klimavej Emne: Forundersøgelser Grundejerforeningen Øresund Notat nr.: 01 København, den 03.05.2012 Rev. 01.06.2012 Projekt nr.: 6369-001 Dir. tlf.: +45 2540 0369 Reference: jkn@moe.dk Rev.:

Læs mere

Geologisk baggrund for skifergas i Danmark

Geologisk baggrund for skifergas i Danmark Geologisk baggrund for skifergas i Danmark Niels H. Schovsbo Reservoir geolog De Nationale Geologiske Undersøgelser for Danmark og Grønland Klima-,Energi- og Bygningsministeriet Opdateret december 2013

Læs mere

Badevandsprofil. Badevandsprofil for Husby Klit, Vedersø. Ansvarlig myndighed:

Badevandsprofil. Badevandsprofil for Husby Klit, Vedersø. Ansvarlig myndighed: Badevandsprofil Badevandsprofil for Husby Klit, Vedersø Ansvarlig myndighed: Ringkøbing-Skjern Kommune Ved Fjorden 6 6950 Ringkøbing www.rksk.dk Email: post@rksk.dk Tlf.: 99 74 24 24 Hvis der observeres

Læs mere

Spørgsmål nr.1. Evolutionsteorien fra Lamarck til Darwin. Spørgsmål nr.2. Menneskets evolution. Spørgsmål 3. Diabetes

Spørgsmål nr.1. Evolutionsteorien fra Lamarck til Darwin. Spørgsmål nr.2. Menneskets evolution. Spørgsmål 3. Diabetes Spørgsmål nr.1 Evolutionsteorien fra Lamarck til Darwin I din fremlæggelse skal du redegøre for Lamarck s og Darwins teori om livets udvikling. Fremhæv væsentlige forskelle imellem teorierne, nævn gerne

Læs mere

UTÆTTE BORINGER PÅ EKSISTERENDE KILDEPLADSER. Mikael Jørgensen, NIRAS. 07/11/2012 NIRAS Utætte boringer på eksisterende kildepladser 1

UTÆTTE BORINGER PÅ EKSISTERENDE KILDEPLADSER. Mikael Jørgensen, NIRAS. 07/11/2012 NIRAS Utætte boringer på eksisterende kildepladser 1 UTÆTTE BORINGER PÅ EKSISTERENDE KILDEPLADSER. Mikael Jørgensen, NIRAS 07/11/2012 NIRAS Utætte boringer på eksisterende kildepladser 1 Disposition Indvendig udforing Overboring Overboring, optagning af

Læs mere

Badevandsprofil. Badevandsprofil for Bjerge Strand, Årgab. Ansvarlig myndighed:

Badevandsprofil. Badevandsprofil for Bjerge Strand, Årgab. Ansvarlig myndighed: Badevandsprofil Badevandsprofil for Bjerge Strand, Årgab Ansvarlig myndighed: Ringkøbing-Skjern Kommune Ved Fjorden 6 6950 Ringkøbing www.rksk.dk Email: post@rksk.dk Tlf.: 99 74 24 24 Hvis der observeres

Læs mere

BioMaster affaldskværn 3.0. Din madlavning kan blive billigere, hvis du vælger biogas

BioMaster affaldskværn 3.0. Din madlavning kan blive billigere, hvis du vælger biogas BioMaster affaldskværn 3.0 BioMasteren er selve affaldskværnen, eller bio kværnen som den også kaldes, hvor madaffaldet fyldes i. Det er en både let og hygiejnisk måde at bortskaffe madaffald på set i

Læs mere

De små & mindre vandværker. Ledelses kvalitetssikring. BEK nr. 132 af 08.02.2013 fra. Miljøministeriet. Skal være indført senest 31.

De små & mindre vandværker. Ledelses kvalitetssikring. BEK nr. 132 af 08.02.2013 fra. Miljøministeriet. Skal være indført senest 31. NYHEDSBREV Kvalitetssikring på vandværker De små & mindre vandværker Ledelses kvalitetssikring BEK nr. 132 af 08.02.2013 fra Miljøministeriet Skal være indført senest 31. december 2014 [Indsæt billedtekst

Læs mere

A/S Storebælt Storebæltsvej 70 4220 Korsør

A/S Storebælt Storebæltsvej 70 4220 Korsør A/S Storebælt Storebæltsvej 70 4220 Korsør Teknik og Miljø Miljøafdelingen Dahlsvej 3 4220 Korsør Tlf. 58 57 36 00 teknik@slagelse.dk www.slagelse.dk Tilladelse til membranfilter til drikkevand på Sprogø

Læs mere

Badevandsprofil. Badevandsprofil for Sønderballe Strand, Sønderballe. Ansvarlig myndighed:

Badevandsprofil. Badevandsprofil for Sønderballe Strand, Sønderballe. Ansvarlig myndighed: Badevandsprofil Badevandsprofil for, Sønderballe Ansvarlig myndighed: Haderslev Kommune Gåskærgade 26-28 6100 Haderslev www.haderslev.dk Email: post@haderslev.dk Tlf.: 74 34 34 34 Hvis der observeres uregelmæssigheder

Læs mere

Badevandsprofil. Grusgravssø ved Dyndet

Badevandsprofil. Grusgravssø ved Dyndet Badevandsprofil Grusgravssø ved Dyndet Maj 2012 Badevandets beliggenhed Medlemsstat Danmark Kommune Køge DKBW nr. 1086 Station nr. 593 Station Navn Grusgravsø ved Dyndet DKBW Navn Kort 593,B,Grusgravsø

Læs mere

Badevandsprofil. Badevandsprofil for Kyndeløse Sydmark, Kirke Hyllinge. Lejre Kommune Møllebjergvej 4 4330 Hvalsø www.lejre.dk Tlf.

Badevandsprofil. Badevandsprofil for Kyndeløse Sydmark, Kirke Hyllinge. Lejre Kommune Møllebjergvej 4 4330 Hvalsø www.lejre.dk Tlf. Badevandsprofil Badevandsprofil for, Kirke Hyllinge Ansvarlig myndighed: Lejre Kommune Møllebjergvej 4 4330 Hvalsø www.lejre.dk Tlf.: 46 46 46 46 Hvis der observeres uregelmæssigheder eller uheld på stranden

Læs mere

enterokokker, pr. 100 ml. i.m. DS/EN7899/2 Kimtal v. 37, pr.100 ml. 5 DS/EN6222 2254 Farvetal Pt mg/l 5 DS/EN7887 5%

enterokokker, pr. 100 ml. i.m. DS/EN7899/2 Kimtal v. 37, pr.100 ml. 5 DS/EN6222 2254 Farvetal Pt mg/l 5 DS/EN7887 5% Direkte undersøgelse * Temperatur Lugt Smag Farve Prøvested Prøvedato Prøvetager Modtaget på Lab Udseende MIKROBIOLOGISK UNDERSØGELSE Resultat Vandkvalitetskrav Analysemetode Coliforme bakterier, pr. 100

Læs mere

Badevandsprofil. Badevandsprofil for Præstø Strand, Præstø. Ansvarlig myndighed:

Badevandsprofil. Badevandsprofil for Præstø Strand, Præstø. Ansvarlig myndighed: Badevandsprofil Badevandsprofil for Præstø Strand, Præstø Ansvarlig myndighed: Vordingborg Kommune Valdemarsgade 43 4760 Vordingborg www.vordingborg.dk Email: post@vordingborg.dk Tlf. 55 36 36 36 Hvis

Læs mere

Carbonatsystemet og geokemi

Carbonatsystemet og geokemi Carbonatsystemet og geokemi Definition af carbonatsystemet og geokemi Carbonatsystemet udgøres af følgende ligevægte: CO 2 (aq) + H 2 O H 2 CO 3 (aq) H 2 CO 3 H + + HCO3 - HCO 3 - H + + CO 3 2- Kuldioxid

Læs mere

Regnorme er fantastiske! Jeg arbejder på universitetet med at studere, hvordan orme fungerer. Jeg elsker dem og alle deres fascinerende små vaner.

Regnorme er fantastiske! Jeg arbejder på universitetet med at studere, hvordan orme fungerer. Jeg elsker dem og alle deres fascinerende små vaner. TM Regnorme er fantastiske! Jeg arbejder på universitetet med at studere, hvordan orme fungerer. Jeg elsker dem og alle deres fascinerende små vaner. Der er tusinder af (vid)underlige arter af orme i verden.

Læs mere

Dansk Sportsdykker Forbund

Dansk Sportsdykker Forbund Dansk Sportsdykker Forbund Teknisk Udvalg Sid Dykketabellen Copyright Dansk Sportsdykker Forbund Indholdsfortegnelse: 1 FORORD... 2 2 INDLEDNING... 3 3 DEFINITION AF GRUNDBEGREBER... 4 4 FORUDSÆTNINGER...

Læs mere

Badevandsprofil. Badevandsprofil for Kragenæs, Kragenæs. Ansvarlig myndighed:

Badevandsprofil. Badevandsprofil for Kragenæs, Kragenæs. Ansvarlig myndighed: Badevandsprofil Badevandsprofil for Kragenæs, Kragenæs Ansvarlig myndighed: Lolland Kommune Jernbanegade 7 4930 Maribo www.lolland.dk Email: lolland@lolland.dk Tlf.: 54 67 67 67 Hvis der observeres uregelmæssigheder

Læs mere

TIL KAPITEL 3 Hvor får vi vores drikkevand fra? OPGAVE 3.01 Luftfugtighed og skyhøjde. (s. 69)

TIL KAPITEL 3 Hvor får vi vores drikkevand fra? OPGAVE 3.01 Luftfugtighed og skyhøjde. (s. 69) TIL KAPITEL 3 Hvor får vi vores drikkevand fra? 3-01.a Når vinden blæser op over bjerge og ned i lavland bag bjergene, ændres luftens temperatur og fugtighed ofte. Der dannes fønvind, som forekommer i

Læs mere

Den levende permafrost

Den levende permafrost Den levende permafrost Af: Morten Schostag Nielsen, Toke Andreasen, Bo Elberling, Anders Priemé & Carsten Suhr Jacobsen 18 TEMA // Den levende permafrost Permafrost er et ekstremt levested. I den øverste

Læs mere

Varde Vandråd. Kursus i Tilstandsrapport og Handlingsplan

Varde Vandråd. Kursus i Tilstandsrapport og Handlingsplan Varde Vandråd d. 9. oktober 2012 Kursus i Tilstandsrapport og Handlingsplan Indledning Formål Værktøj til optimal drift af vandværket Gøre bestyrelse og vandværks-passer vidende Forebyggende vedligeholdelse

Læs mere

Kortlægning af Danienkalk/Selandien ved Nyborg og Odense

Kortlægning af Danienkalk/Selandien ved Nyborg og Odense GEUS Workshop Kortlægning af kalkmagasiner Kortlægning af Danienkalk/Selandien ved Nyborg og Odense Geolog Peter Sandersen Hydrogeolog Susie Mielby, GEUS 1 Disposition Kortlægning af Danienkalk/Selandien

Læs mere

Tilstandsrapport og status Jukkerup Vandværk

Tilstandsrapport og status Jukkerup Vandværk Holbæk Kommune, Teknik og Miljø Tilstandsrapport og status Jukkerup Vandværk Maj 2010 Holbæk Kommune Side 2 Indholdsfortegnelse 1. Indledning 2. Nøgledata for vandværket 3. Vandkvalitet 4. Indvindingsanlæg

Læs mere

Livet i Damhussøen. Lærervejledning

Livet i Damhussøen. Lærervejledning Lærervejledning Generelle oplysninger Forløbets varighed: Fra kl. 9.00 til kl.13.00. Målgruppe: Forløbet er for 7. klasse til 10. klasse. Pris: Besøget er gratis for folkeskoler i Københavns Kommune. Det

Læs mere

Badevandsprofil. Badevandsprofil for Bagenkop Sommerland, Bagenkop. Ansvarlig myndighed:

Badevandsprofil. Badevandsprofil for Bagenkop Sommerland, Bagenkop. Ansvarlig myndighed: Badevandsprofil Badevandsprofil for, Bagenkop Ansvarlig myndighed: Langeland Kommune Fredensvej 1 5900 Rudkøbing www.langelandkommune.dk Email: post@langelandkommune.dk Tlf.: 63 51 60 00 Hvis der observeres

Læs mere

Notat. Hydrogeologiske vurderinger 1 INDLEDNING. UDKAST Frederikshavn Vand A/S ÅSTED KILDEPLADS - FORNYELSE AF 6 INDVINDINGSBORINGER VED LINDET.

Notat. Hydrogeologiske vurderinger 1 INDLEDNING. UDKAST Frederikshavn Vand A/S ÅSTED KILDEPLADS - FORNYELSE AF 6 INDVINDINGSBORINGER VED LINDET. Notat UDKAST Frederikshavn Vand A/S ÅSTED KILDEPLADS - FORNYELSE AF 6 INDVINDINGSBORINGER VED LINDET. Hydrogeologiske vurderinger 16. januar 2012 Projekt nr. 206383 Udarbejdet af HEC Kontrolleret af JAK

Læs mere

Skåstrup V. Side 1 af 10

Skåstrup V. Side 1 af 10 Skåstrup V Side 1 af 10 Badevandsprofil Badevandsprofil for Skåstrup V, Skåstrup Ansvarlig myndighed: Nordfyns Kommune Østergade 23 5400 Bogense Tlf.: 64 82 82 82 Email: post@nordfynskommune.dk Web: www.nordfynskommune.dk

Læs mere

»Sådan får De bedre vand-vaner«

»Sådan får De bedre vand-vaner« »Sådan får De bedre vand-vaner«danske Vandværkers Forening Det forventer vi af drikkevandet: Det er billigt Det er ikke sundhedsfarligt at drikke Det smager godt Det er klart Det er køligt Det lugter ikke

Læs mere

Syddjurs Kommune 19. November 2014

Syddjurs Kommune 19. November 2014 Møde mellem Ikke almene vandværker og Syddjurs Kommune 19. November 2014 Steen S. Wengel Anna Okkerlund Brahe Anne-Mette Randrup Rasmussen Velkomst: v/ Steen S. Wengel Dagsorden: 1. Ikke almene vandværker

Læs mere

Vand og vandforsyning

Vand og vandforsyning Af Erland Andersen og Jens O. Mortensen Udgave: 11-10-2004 Indledning Vand og vandforsyning er det 3. undervisningsforløb i det folkeskoleprojekt Vvs-branchens uddannelsesnævn startede i efteråret 2002.

Læs mere

Tilladelse til midlertidig avanceret vandbehandling - UV bestråling af drikkevandet på Bonnet vandværk

Tilladelse til midlertidig avanceret vandbehandling - UV bestråling af drikkevandet på Bonnet vandværk Bonnet Vandværk Sendt på e-mail til bestyrelsen på hanneogleif4243@gmail.com britmo37@vip.cybercity.dk aasborg@city.dk jensjogmerete@privat.tdcadsl.dk langgaard-pj@adslhome.dk 22. december 2014 Tilladelse

Læs mere

Grundlæg fremtiden. vandigrunden.dk. Tips & tricks. Test dig selv! Læs mere på. Se filmen

Grundlæg fremtiden. vandigrunden.dk. Tips & tricks. Test dig selv! Læs mere på. Se filmen NORDISK MILJØMÆRKNING Grundlæg fremtiden Grundvand betyder meget i Danmark. I modsætning til andre lande er dansk drikkevand baseret på grundvand, der kun kræver en let rensning. Vi bor ovenpå vores drikkevand.

Læs mere

Hygiejnepjece. Hygiejnepjece

Hygiejnepjece. Hygiejnepjece Hygiejnepjece Hygiejnepjece Hvem skal kende retningslinjerne for hygiejne? Hvad skal du vide noget om? Som medarbejder hos Nordvand kan du have direkte eller indirekte indflydelse på kvaliteten af drikkevandet,

Læs mere

Tilpasning og sanser På jagt efter løsningen - Lærervejledning

Tilpasning og sanser På jagt efter løsningen - Lærervejledning Tilpasning og sanser På jagt efter løsningen - Lærervejledning Pædagogisk ide I denne øvelse arbejdes der videre med stoffet fra den lærerstyrede undervisning i klassen. Men her er der fokus på nye vinkler

Læs mere

Badevandsprofil for Vilstrup Strand ved Hoptrup Kanal, Diernæs

Badevandsprofil for Vilstrup Strand ved Hoptrup Kanal, Diernæs Badevandsprofil Badevandsprofil for, Diernæs Ansvarlig myndighed: Haderslev Kommune Gåskærgade 26-28 6100 Haderslev www.haderslev.dk Email: post@haderslev.dk Tlf.: 74 34 34 34 Hvis der observeres uregelmæssigheder

Læs mere

Bentazon Pesticidprodukt der anvendes som sprøjtegift mod ukrudt i bl.a. kløver-, majs- og ærtemarker. Solgt under handelsnavnet basagran 480.

Bentazon Pesticidprodukt der anvendes som sprøjtegift mod ukrudt i bl.a. kløver-, majs- og ærtemarker. Solgt under handelsnavnet basagran 480. Bilag 4.13 Ordliste Alment vandværk (almene forsyningsanlæg) Vandværk som forsyner mindst 10 ejendomme. Arsen Stoffet er kræftfremkaldende, og er et af de mest sundhedsskadelige stoffer i dansk drikkevand.

Læs mere

Hvordan sikre rent vand i en ny sø?

Hvordan sikre rent vand i en ny sø? Hvordan sikre rent vand i en ny sø? Dette spørgsmål blev jeg for nylig stillet af en søejer fra Djursland. Han havde gravet en ny 1,7 hektar stor og meter dyb sø, og ville nu gerne vide, hvordan han bedst

Læs mere