NDRG2 s Interaction with Api5

Størrelse: px
Starte visningen fra side:

Download "NDRG2 s Interaction with Api5"

Transkript

1 Naturvidenskabeligt Basisstudium Roskilde Universitet 2. semesterprojekt Juni 2012 Hus 13.1 NDRG2 s Interaction with Api5 NDRG2 s interaktion med Api5 Gruppe 12: Freya Armstrong Annaleigh Ohrt Fehler Cecilie Felicia Hansen Louise Justesen Katrine Aagaard Myhr Mathias Mørup-Lendal Sebastian Niemeier Vejleder: Cathy Mitchelmore

2

3 Abstract Background: Studies show that the tumor suppressor gene N-myc downstream regulated gene 2 (NDRG2) is downregulated in cancer cells, whereas the anti-apoptosis gene Apoptosis Inhibitor 5 (Api5) is upregulated. Furthermore it is established that there is a complex formation between NDRG2 and Api5. The complex formation might result in a blockage of Api5 s function as an inhibitor of E2 promoter binding factor (E2F) induced apoptosis. Therefore one may suggest that NDRG2 indirectly induces apoptosis and thereby counteracts uncontrolled cell proliferation. Hypothesis: The Api5 binding site in NDRG2 is to be found in one of the following regions, the α- helix 6 domain or after the α/β-hydrolase domain. Methods: Based on the hypothesis two mutations are incorporated in the regions mentioned above in which it is possible to examine whether the interaction between NDRG2 and Api5 is still possible. To examine whether complex formation occurs, a yeast-2-hybrid assay is used. Initial experiments are necessary to incorporate the mutations in plasmids which are used in the yeast- 2-hybrid assay. Results: Incorporation of mutations and conduction of plasmids was successful. When the α- helix 6 domain was mutated, no complex formation between NDRG2 and Api5 occurred. The complex formation was not affected by the mutation after the α/β-hydrolase domain. Conclusion: The results indicate that the α-helix 6 domain in NDRG2 is essential for the binding to Api5.

4 Resumé Baggrund: Studier viser, at tumorsuppressorgenet, N-myc downstream-regulated gene 2 (NDRG2), er nedreguleret i cancerceller, mens antiapoptosegenet, Apoptosis Inhibitor-5 (Api5), er opreguleret. Desuden er det vist, at NDRG2 danner kompleks med Api5. Det foreslås, at kompleksdannelsen resulterer i en blokering af Api5 s hæmmende funktion på E2 promoter binding factor (E2F) induceret apoptose. I tilfælde af dette vil NDRG2 således indirekte inducere apoptose og derved modvirke ukontrolleret celledeling. Hypotese: Api5-bindingsstedet i NDRG2 kan findes i en af følgende to regioner, α-helix 6 domænet eller efter α/β-hydrolase domænet. Metoder: På baggrund af hypotesen indføres mutationer i de to nævnte regioner, hvormed det undersøges, om kompleksdannelsen mellem NDRG2 og Api5 stadig er mulig. Til at undersøge, hvorvidt kompleksdannelsen sker, bruges et gær-2-hybridsystem. Forudgående forsøg er nødvendige for at inkorporere mutationerne i plasmiderne, som bruges til gær-2-hybridsystemet. Resultater: Indføring af mutationer og formering af plasmider forløb succesfuldt. Ved mutationen i α-helix 6 domænet forekom der ingen kompleksdannelse mellem NDRG2 og Api5. Kompleksdannelsen var ikke påvirket af mutationen efter α/β-hydrolase domænet. Konklusion: Resultaterne indikerer, at α-helix 6 domænet i NDRG2 er essentielt for bindingen til Api5.

5 Forord Denne rapport er udarbejdet af 2. semester-studerende fra Naturvidenskabeligt Basisstudium på Roskilde Universitet. Den tager udgangspunkt i en semesterbinding under titlen Modeller, teorier og eksperimenter i naturvidenskab. Formålet er at opnå erfaring med grundvidenskabelige problemstillinger inden for naturvidenskab via eksperimentelt arbejde med et repræsentativt eksempel. Projektarbejdet forløb over 4 måneder, hvoraf der i 3 måneder indgik laboratoriearbejde. Den bagvedliggende motivation udsprang af en interesse for de mekanismer, der ligger til grund for udviklingen af cancer samt de bioteknologiske metoder, som benyttes til undersøgelse heraf. I en søgen på at komme et skridt nærmere forståelsen af cancer og dermed også fremtidige behandlingsmetoder har rapporten til formål at undersøge bindingsstedet mellem to proteiner, som spiller en rolle i flere cancertyper. Vi vil rette en stor tak til vores interne vejleder, Lektor Cathy Mitchelmore, som har støttet os gennem hele forløbet. Det eksperimentelle arbejde i forbindelse med rapporten er vejledt af laboratorieoverassistent Kirsten Olesen, som har været til stor hjælp. Freya Armstrong Annaleigh Ohrt Fehler Cecilie Felicia Hansen Louise Justesen Katrine Aagaard Myhr Mathias Mørup-Lendal Sebastian Niemeier

6 Indholdsfortegnelse 1 Læsevejledning Indledning Problemformulering Afgrænsning Målgruppe Semesterbinding NDRG API Hypotese Gær-2-hybridsystem Anvendte bioteknologiske metoder Resultater Forsøg 1: L172D Sekventering af psdm Skæring af psdm og pgbkt Ligering Transformation af E. Coli Podning af E. coli Miniprep DNA Skæring af pgbkt7-ndrg2-l172d Forsøg 2: S305X Site-directed mutagenese Transformation af E. coli Podning af E. coli Skæring af pgbkt7-ndrg2-s305x Fælles procedurer for forsøg 1 og Transformation af gærceller Formering af gærceller Gær-2-hybridsystem Diskussion Konklusion Perspektivering Referenceliste... 29

7 17 Appendix Materialeliste Forsøg 1 fremgangsmåde Forsøg 2 fremgangsmåde Sekventering af psdm Mislykkede forsøg Forkortelser Ordliste... 50

8

9 1 Læsevejledning Fagtermer markeret med stjerne forklares i en samlet ordliste eksempelvis apoptose* som findes sidst i rapporten. Forkortelser skrives ud første gang, efterfulgt af forkortelsen i parentes eksempelvis Apoptosis Inhibitor 5 (Api5), og er ligeledes samlet sidst i rapporten. Der skelnes mellem gener, enzymer og proteiner ved at skrive gener og enzymer i kursiv. Hvis generne er humane skrives de med stort, for eksempel API5. Hvis de ikke er humane skrives kun det første bogstav stort, for eksempel Api5. Undtagelsesvist skrives hele genet NDRG2 altid med stort, og det humane gen betegnes hndrg2. Fagtermer er så vidt muligt oversat til dansk. I enkelte tilfælde er de engelske termer bibeholdt og skrives med kursiv. 2 Indledning Omkring nye tilfælde af cancer rammer årligt den danske befolkning, og hvert år dør cirka heraf. Hver tredje dansker vil på et tidspunkt i deres liv lide af cancer, hvilket gør sygdommen til den anden mest hyppige dødsårsag. Cirka 30 % af årlige dødsfald i Danmark skyldes cancer. [Kræftens bekæmpelse, 2012]. Cancer er forårsaget af mutationer i cellers DNA, som påvirker celledeling blandt andet ved at hæmme apoptose*, programmeret celledød. I 1996 identificerede Miyatas laboratorium N-myc downstream-regulated gene 1 (NDRG1) [Kokame et al., 1996], og i 2001 yderligere tre andre medlemmer af familien, NDRG2-4 [Zhou et al., 2001]. Disse gener koder sandsynligvis for apoptosefremmende proteiner, og NDRG2 er således et formodet tumorsuppressorgen*. Forskning viser, at NDRG2 er nedreguleret i en række cancertyper [Melotte et al., 2010] [Hwang et al., 2011], men mange spørgsmål omkring dets funktion står dog stadig ubesvarede. Det er derfor relevant at foretage videre undersøgelser, som måske i fremtiden kan være nyttige ved udvikling af nye cancerbehandlinger. Udover opdagelsen af NDRG-generne blev det i 2009 vist, at Apoptosis Inhibitor-5 (Api5) kan danne proteinkomplekser med NDRG2 [Cathy Mitchelmore, ikke publiceret materiale]. Api5 er et antiapoptotisk* protein og bidrager derfor til celleoverlevelse [Faye & Poyet, 2010] [Rigou et al., 2009]. Det ses ligeledes, at proteinet er opreguleret i mange cancertyper [Sasaki et al., 2001] [Kim et al., 2000] [Krejci et al., 2007]. En mulig hypotese er, at kompleksdannelsen mellem NDRG2 og Api5 resulterer i en blokering af Api5 s antiapoptotiske funktion [Cathy Mitchelmore, 1

10 ikke publiceret materiale]. Man kunne derfor forestille sig, at NDRG2 i raske celler er medansvarlig for regulering af apoptose via dets blokering af Api5. NDRG2 vil i så fald modvirke ukontrolleret celledeling og dermed give cancercellen ringe vækstbetingelser. Følgende projekt har til formål at bidrage til grundforskningen i NDRG2. Via eksperimentelt arbejde med et gær-2-hybridsystem ønskes det at bestemme, hvilken region i NDRG2 der fungerer som bindingssted for Api5. Der er udvalgt to regioner i NDRG2, som kunne være mulige bindingssteder. De to regioner muteres i projektets eksperimentelle del for at undersøge, om de har nogen betydning for kompleksdannelsen. Årsagen til udvælgelsen af disse regioner uddybes nærmere i afsnit 9. 3 Problemformulering Hvilken region i NDRG2 er essentiel for interaktion med Api5? 4 Afgrænsning NDRG2 og Api5 er interessante at undersøge, da de muligvis spiller en rolle i cancerudvikling. Denne rapport beskæftiger sig hovedsageligt med bindingsstedet mellem NDRG2 og Api5, og cancer vil derfor ikke være i fokus. Dog vil apoptose i forhold til NDRG2 og Api5 diskuteres for at danne en teoretisk baggrundsforståelse. NDRG2 er en del af en familie på 4 medlemmer, men projektet afgrænses til kun at omhandle NDRG2. De andre familiemedlemmer omtales kun kort, blandt andet for at fremhæve eventuelle vigtige forskelle på proteinerne. Projektets problemformulering forsøges besvaret ved eksperimentelt arbejde, men af tidsmæssige årsager afgrænses undersøgelsen til kun at omhandle to regioner i NDRG2. Såfremt disse ikke viser sig at være essentielle for kompleksdannelsen mellem NDRG2 og Api5, kan problemformuleringen ikke besvares. 5 Målgruppe Følgende rapport henvender sig til molekylærbiologi-interesserede. En grundlæggende viden inden for cellebiologi er nødvendig for forståelsen af rapporten. 6 Semesterbinding Semesterbindingen for 2. semester fokuserer på grundvidenskabelige problemstillinger inden for naturvidenskab. På baggrund af relevant teori formuleres en hypotese, som gennem naturvidenskabelige metoder forsøges eftervist. Da forskningen inden for området er relativ ny og begræn- 2

11 set, mangler meget stadig at blive undersøgt. Lektor Cathy Mitchelmore forsker inden for området, og en del af teorien understøttes af hende. Følgende tre underafsnit vil belyse, hvorledes dette projekt opfylder semesterbindingen Modeller, teorier og eksperimenter i naturvidenskab. Teori For at kunne undersøge hvilken region i NDRG2 der er essentiel for bindingen med Api5, er det nødvendigt at undersøge strukturen af NDRG2, for at beslutte mulige targetområder for bindingsstedet. På baggrund af dette er det muligt at opstille en hypotese. Desuden vil det belyses, hvilken relevans interaktionen har for apoptose og udvikling af cancersvulster. I den eksperimentelle del af projektet udnyttes et gær-2-hybrid system, og der vil derfor fremgå en teoretisk gennemgang af principperne bag metoden. Øvrige metoder gennemgås i afsnit 12. Model Teoridelen bidrager til forståelsen af projektets model, udformet af Cathy Mitchelmore. Modellen tydeliggør den aktuelle forståelse af problemstillingen. Denne er vist i Figur 1, hvor det illustreres at proteinet E2 promoter binding factor (E2F) under sædvanlige omstændigheder promoverer celledeling. Ved en opregulering af E2F vil det derimod inducere apoptose. Api5 binder sig via andre proteiner indirekte til E2F og hæmmer den E2F-inducerede apoptose [Faye & Poyet, 2010]. Det kan dermed hypoteseres, at NDRG2 indirekte øger apoptose ved en hæmning af Api5. Figur 1 Model for NDRG2 og Api5 s indvirkning på apoptose. E2F inducerer normalt celledeling, men i opreguleret tilstand vil E2F inducere apoptose for at kontrollere celledelingen. Api5 hæmmer denne E2F-inducerede apoptose. Modellen illustrerer desuden, at NDRG2 kan hæmme Api5 s antiapoptotiske funktion og dermed indirekte øge apoptose [Egenproduktion, modificeret fra model af Cathy Mitchelmore]. Gærceller bruges som et modelsystem for humane celler. De er simplere opbygget end humane celler, hvilket gør dem lettere at arbejde med. Forskning med gærceller gør det muligt at undersøge forskellige mekanismer i kroppen, som ikke ville kunne opnås med forskning på mennesker. 3

12 De kan derfor bruges som en model for mammale celler og yderligere i et modelsystem for undersøgelsen af problemstillingen i dette projekt. NDRG2 og Api5 danner kompleks i gærceller og sandsynligvis også i humane celler. Det er således muligt at undersøge kompleksdannelsen efter inkorporering af mutationer i NDRG2. Eksperiment Følgende rapport er udarbejdet dels på baggrund af relevant litteratur, og dels ved eget eksperimentelt arbejde. For at bestemme hvorvidt Api5 og NDRG2 kan interagere efter en mutation er indsat, udnyttes et gær-2-hybridsystem. Indledningsvis er det nødvendigt at syntetisere plasmider med de ønskede inkorporerede mutationer. Yderligere beskrivelse af den eksperimentelle del, vil blive gennemgået i afsnit 11 og NDRG2 Siden 2003 har NDRG2 og dets rolle i cancer været genstand for intens forskning. En række studier har blandt andet vist, at NDRG2-ekspression er nedreguleret i en række cancertyper, og at genet virker væksthæmmende på tumorceller [Park et al., 2007] [Wang et al., 2008] [Hummerich et al., 2006] [Lee et al., 2008]. Dette påpeger NDRG2 s potentielle funktion som tumorsuppressorgen og/eller metastatisk suppressorgen* [Lorentzen & Michelmore, 2012]. NDRG2 kan inhibere cellevækst og invasion af cancertumorer via adskillige signalveje [Melotte et al., 2010]. En af disse signalveje involverer sandsynligvis det antiapoptotiske protein Api5, og NDRG2 hæmmer muligvis Api5 s funktion. Netop denne interaktion er essentiel for projektets problemstilling, og NDRG2 s proteinstruktur er i denne sammenhæng vigtig at forstå. Følgende gennemgang vedrører derfor NDRG2 s proteinstrukur og regulering af genet. NDRG2 er en del af NDRG-familien bestående af fire medlemmer, NDRG1-4. Herudover findes to isoformer af humant NDRG2, NDRG2a og NDRG2b. NDRG2b er 14 aminosyrer kortere [Melotte et al., 2010]. De fire NDRG-proteiner har % identiske aminosyresekvenser [Qu et al., 2002] med størst homologi i et såkaldt α/β-hydrolase-domæne*, som består af otte β-foldeplader kædet sammen af α-helix-domæner [Melotte et al., 2010]. Dette domæne er tilsyneladende ikke katalytisk, og NDRG-familien fungerer derfor ikke som hydrolaser* [Shaw et al., 2002]. α/βhydrolase-domænet er på Figur 2 markeret med grå områder, og på Figur 3.a med blå og grøn. Særligt α-helix 6 er i dette tilfælde interessant, som på Figur 2 er markeret med pil 1, og ses øverst i Figur 3.b. Denne region indeholder hydrofobe aminosyrer, som man normalt skulle forvente ville danne en indadvendt hydrofob lomme i den tertiære proteinstruktur. Hwang og kolleger har dog vist ved en krystallisering af NDRG2b fra aminosyre , at dette ikke gør sig 4

13 gældende. Derimod ses det, at de hydrofobe aminosyrer er udadvendte, og de ladede aminosyrer er indadvendte. Af denne grund er α-helix 6 let tilgængelig for proteininteraktion, og det er i denne sammenhæng også vist, at proteinet β-catenin interagerer her. Ydermere varierer α-helix 6 væsentligt i aminosyresekvensen i forhold til resten af NDRG-familien [Hwang et al., 2011]. Der vides ikke meget om betydningen af aminosyresekvensen efter α/β-hydrolase domænet (aminosyrerne efter pil 2 i Figur 2). Domænet afviger desuden markant i forhold til resten af NDRG-familien og er dermed en kandidat for bindingsstedets placering [Hwang et al., 2011]. I dette projekt benyttes NDRG2b, da der hovedsageligt tages udgangspunkt i Hwang og kollegers krystallisering. For overskuelighedens skyld betegnes proteinet fremover som NDRG2. Figur 2 NDRG2 s primær-proteinstruktur. De lysegrå områder angiver α-helix-domæner og de mørkegrå β-foldeplader. Nummerering af α og β-domæner er angivet øverst, og nummerering af aminosyrer nederst. Pil 1 markerer α-helix 6, som er tilgængelig for proteininteraktion. Pil 2 markerer regionen efter α/β-hydrolase-domænet, som varierer meget i forhold til resten af NDRG-familien [Egenproduktion, inspiration fra Hwang et al., 2011]. Figur 3 NDRG2 s tertiær-proteinstruktur. a Fuldkommen tertiær proteinstruktur af NDRG2b. Blå dele angiver α-helix-domæner og grønne dele β-foldeplader. Øverst ses α-helix 6. b Detaljeret struktur af α-helix 6. Aminosyrerne er angivet ved bogstav og nummer. For nærmere forklaring se afsnit 9 [Modificeret fra Hwang et al., 2011]. NDRG2 er trods navnet reguleret af cellular myelocytomatosis viral oncogene (c-myc), og ikke neuroblastoma-derived myelocytomatosis viral oncogene (N-myc) som NDRG1. c-myc er et proto-onkogen*, og kan derfor bidrage til udviklingen af cancer. Genet koder for en transskriptionsfaktor* af samme navn, som regulerer ekspressionen af bestemte gener. c-myc hæmmer via 5

14 Myc-interacting zinc finger protein 1 (Miz-1) transskriptionen af NDRG2. Herved udtrykkes NDRG2 ikke i så høj grad [Zhang et al., 2006][Yao et al., 2008]. Der er desuden i adskillige cancertyper vist en invers sammenhæng mellem NDRG2 og MYC-proteiner [Zhang et al., 2006], hvilket indikerer at c-myc muligvis nedregulerer ekspressionen af NDRG2 i cancer [Lorentzen & Mitchelmore, 2012]. 8 API5 Som nævnt interagerer NDRG2 med proteinet Api5 [Cathy Mitchelmore, ikke publiceret materiale], som hæmmer apoptose [Faye & Poyet, 2010]. Som Figur 1 synliggør, er det muligvis via denne interaktion, at NDRG2 blandt andet kan fremme apoptose. For nærmere at forstå denne eventuelle sammenhæng, samt bindingen mellem NDRG2 og Api5, vil følgende afsnit gennemgå væsentlig teori om Api5. API5 er et protein, som kodes af genet med samme navn. Genet API5 er lokaliseret på kromosom 11, og det tilsvarende protein er opbygget af 504 aminosyrer [Poyet et al., 2009]. Det er, på baggrund af sin antiapoptotiske effekt, også kendt som Anti-apoptosis clone 11 (AAC-11). API5 blev opdaget i 1997, og dens struktur blev kortlagt i 2012 ved en krystallografi [Han et al., 2012]. Trods dette er API5 et relativt uudforsket protein, og viden om dets funktion er stadig ikke komplet. API5 har siden dets opdagelse tiltrukket stor opmærksomhed, da det potentielt kan benyttes i cancerterapi. Genet er udtrykt i alle væv, og flere undersøgelser viser at API5 er opreguleret i tumorceller. En sådan opregulering vil hæmme apoptose, og dermed skabe god forudsætning for uhæmmet cellevækst. Med henblik på cancerterapi er der interesse for en blokering af API5, og der søges i dag efter nye kandidater, som kan blokere API5 og dermed hæmme dets funktion [Faye & Poyet, 2010]. I 2006 erfarede Morris og kolleger, at E2F-induceret apoptose er nedreguleret af Api5 [Morris et al., 2006]. Normalvis regulerer transskriptionsfaktoren E2F-ekspressionen af essentielle proteiner, der indgår i cellecyklen*. Ved opregulering af E2F vil der derimod ske en initiering af apoptose. Det er denne apoptose, Api5 nedregulerer. Interaktionen mellem Api5 og E2F foregår ved en indirekte interaktion, som involverer andre proteiner. Sammenhængen illustreres på Figur 4. Hvis der sker en ukontrolleret celledeling, hvor apoptosen ikke er tilstrækkelig, vil dette danne gode vækstbetingelser for en cancersvulst [Faye & Poyet, 2010]. 6

15 Figur 4 Model der illustrerer E2F s betydning for celledeling og apoptose. Den sorte pil til venstre angiver at E2F normalvis promoverer celledeling. Den røde pil angiver at en opregulering af E2F inducerer apoptose. Denne apoptose er Api5 i stand til at hæmme [Egenproduktion, modificeret fra model af Cathy Mitchelmore]. 9 Hypotese For at kunne bestemme bindingsstedet for Api5 på NDRG2 er det nødvendigt at opstille en hypotese. Denne hypotese skal således være et kvalificeret bud på, hvor bindingsstedet kunne befinde sig, og hvor en mutation derfor indføres. Hwang og kolleger har tidligere vist, at α-helix 6-regionen i NDRG2 er et bindingssted for proteinet β-catenin. Ydermere er det i samme undersøgelse vist, at aminosyrerne i denne region er udadvendte i proteinstrukturen trods deres hydrofobe egenskaber. Regionen er dermed let tilgængelig for proteininteraktion [Hwang et al., 2011]. Dette leder til opstilling af den hypotese, at netop denne region er vigtig for protein-interaktion. Om α-helix 6 ligeledes er et bindingssted for Api5, undersøges således ved indførelse af en mutation. I dette forsøg indføres som Hwang og kolleger en L172D-mutation. Navnet henviser til en mutation i basesekvensen kodende for aminosyre nummer 172 i NDRG2. Leucin med baserne CTA muteres til asparaginsyre, GAT. Da leucin er en hydrofob aminosyre i modsætning til asparaginsyre, som er negativt ladet, kunne man forestille sig, at denne mutation vil ændre den udadvendte proteinstruktur. Dette vil sandsynligvis besværliggøre en binding til Api5, såfremt α-helix 6 er bindingssted. Som nævnt varierer regionen efter α/β-hydrolase-domænet væsentligt i aminosyresekvensen i forhold til resten af NDRG-familien, og der vides generelt meget lidt om funktionen af denne region. Det vurderes derfor, at der her kan befinde sig et muligt bindingssted for Api5. Der indføres af denne grund en anden mutation i et sideløbende forsøg. Mutationen kaldes S305X, og er et stopcodon (TAA) efter α/β-hydrolase-domænet i NDRG2. Således vil regionen efter stopcodonet ikke transskriberes. Navnet på mutationen indikerer, at mutationen indføres i basesekvensen for aminosyre nummer 305, serin. 7

16 Ovenstående hypotese er således, at Api5-bindingsstedet i NDRG2 muligvis kan findes i en af følgende to regioner: α-helix 6. Efter α/β-hydrolase-domænet. Regionerne undersøges ved at indføre følgende to mutationer: L172D: Ændring af aminosyre leucin (hydrofob) til asparaginsyre (hydrofil). S305X: Indsættelse af stopcodon efter α/β-hydrolase-domænet. I dette projekt benyttes et gær-2-hybridsystem, til eftervisning af hypotesen. Dette er en genetisk analysemetode, som bruges til at undersøge proteininteraktioner in vivo. I dette tilfælde er det således proteininteraktionen mellem muteret NDRG2 og Api5. Såfremt der ikke er nogen kompleksdannelse mellem de to proteiner, indikerer dette, at den muterede region er essentiel for bindingen. Ved kompleksdannelse for begge mutationer er det ikke muligt at besvare problemformuleringen. 10 Gær-2-hybridsystem Til undersøgelse af proteininteraktion benyttes et gær-2-hybridsystem. Gærceller er som humane celler eukaryote, og en del af de cellulære processer i de to typer celler er sammenlignelige. Af denne årsag kan gærceller være en god og simpel model for humane celler. Gær-2-hybridsystemet udnytter strukturen af galaktosidase 4 (Gal4), en specifik transskriptionsfaktor for systemet, som kan initiere transskriptionen af et reportergen* i gærcellen. Gal4 er opdelt i to fysisk separate domæner, et aktiveringsdomæne (AD) og et bindingsdomæne (BD). Gal4-AD binder RNA-polymerasen*, og Gal4-BD bindes til et aktiveringssite på DNA et, kaldet upstream activating site (UAS). Dette er placeret opstrøms for reportergenet. Når Gal4-AD og Gal4-BD er i tæt kontakt, men ikke nødvendigvis kovalent bundet til hinanden, kan Gal4 aktivere transskriptionen af reportergenet Lac-Z. Denne sammenhæng illustreres i Figur 5.a. I gær-2-hybridsystemet indsættes to plasmider indeholdende gener for de to proteiner, som ønskes undersøgt. I dette projekt er det således et plasmid indeholdende NDRG2 med den ønskede mutation, og et plasmid indeholdende Api5. Det udnyttes nu, at genet for Gal4 kan adskilles i Gal4-BD og Gal4-AD, som inkorporeres i hvert deres plasmid. Disse er begge placeret i forlængelse af henholdsvis NDRG2 og Api5 således, at læserammen er kontinuert, og der dannes to fusionsproteiner ved transskriptionen af plasmiderne. Disse er illustreret på Figur 6. 8

17 Gal4-BD er fusioneret med det protein, som kaldes bait. Det er dette protein, som ønskes undersøgt, og som tiltrækker det kendte protein kaldet prey. Prey er fusioneret med Gal4-AD på det andet plasmid. I dette tilfælde er NDRG2 bait og Api5 prey. Uafhængigt af hinanden kan de to fusionsproteiner ikke initiere transskriptionen af reportergenet, som illustreret på Figur 5.b og Figur 5.c. Hvis proteinerne derimod interagerer, vil de to fusionsproteiner tilsammen danne et transskriptionsapparat* bestående af transskriptionsfaktorer og RNA-polymerase*, og reportergenet udtrykkes som det ses på Figur 5.d. Figur 5 Gær-2-hybridsystem. I gærceller undersøges kompleksdannelse mellem to proteiner, bait og prey a Transskriptionsfaktoren Gal4 består af to domæner, AD og BD, som ved tæt kontakt med hinanden aktiverer transskriptionen af reportergenet Lac-Z. b Gal4- BD og bait kan danne et fusionsprotein, hvis de er placeret i forlængelse af hinanden på et plasmid. Dette fusionsprotein kan ikke alene initiere transskriptionen af reportergenet. c Gal4-AD og prey kan ligeledes danne et fusionsprotein, hvis de er placeret i forlængelse af hinanden på et plasmid. Dette protein kan ikke alene initiere transskriberingen af reportergenet. d Når to plasmider med henholdsvis Gal4-BD+bait og Gal4-AD+prey transformeres ind i gærcellen, vil der transskriberes to fusionsproteiner. Såfremt bait og prey interagerer, vil transskriptionen af reportergenet Lac-Z forekomme [Egenproduktion. Inspiration fra Chien et al., 1991]. Figur 6 Plasmider, som benyttes i projektets gær-2-hybridsystem. Til venstre ses plasmidet indeholdende genet for fusionsproteinet mellem Gal4-BD og NDRG2. Til højre ses plasmidet indeholdende genet for fusionsproteinet mellem Gal4-AD og Api5. Det ses at læserammen for fusionsgenerne er kontinuert, og vil transskriberes sammen. Det udnyttes desuden, at Gal4 kan adskilles i to fysisk separate domæner [Egenproduktion]. Gærcellerne gøres afhængige af kompleksdannelsen, idet de er manipulerede til kun at syntetisere essentielle næringsstoffer ved transskription af reportergenet. Kun ved proteininteraktion vil gærcellen overleve. Det er derfor nødvendigt, at pladen hvorpå gærcellerne vokser, ikke indeholder de pågældende næringsstoffer, hvis der skal ske en selektion af gærceller uden kompleksdannelse. Reportergenet Lac-Z koder for enzymet β-galactosidase, som kløver substratet 5- bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal) til galaktose samt et blåt produkt. Dette 9

18 gør det muligt at se, om kompleksdannelsen forekommer. Det er ligeledes muligt at opspore mængden af blå farve for dermed at bestemme graden af kompleksdannelse. Dette gøres dog ikke i dette projekt. Som yderligere positiv kontrol benyttes to reportergener, HIS3 og ADE2, som koder for enzymer, der medvirker til syntesen af henholdsvis histidin og adenin. Disse er essentielle næringsstoffer, som udelades på agarpladen, og dermed kontrolleres kompleksdannelsen også herved. HIS3 og ADE2 har som Lac-Z et bindingssted for Gal4, og transskriptionen af de tre reportergener vil derfor alle initieres ved kompleksdannelse [Chien et al., 1991] [Nelson & Cox, 2008] [Griffiths et al., 2012]. Hvis det er muligt at eftervise dette projekts hypotese, vil gær-2-hybridsystemet således resultere i en manglende vækst i en af de to mutationer. Den manglende vækst vil indikere, at den muterede region er essentiel for kompleksdannelsen mellem NDRG2 og Api5. Desuden er det muligt ved brug af X-gal at observere, om der er nogen kompleksdannelse, hvilket ses ved tilstedeværelsen af blå farve. 10

19 11 Anvendte bioteknologiske metoder For at benytte et gær-2-hybridsystem er det nødvendigt først at producere anvendelige plasmider. Disse skal indeholde NDRG2 med den ønskede mutation, og genet skal placeres i forlængelse af Gal4-BD. Vektoren*, som benyttes i dette projekt, kaldes pgbkt7. Desuden udleveres plasmidet pgadt7-api5, som indeholder Api5 og Gal4-AD og bruges i gær-2-hybridsystemet. Projektets eksperimentelle del forløber i to sideløbende forsøg; forsøg 1 med L172D og forsøg 2 med S305X. Forløbet er illustreret på Figur 7. Til at inkorporere mutationerne findes forskellige metoder. I dette projekt benyttes for L172D ligering, og for S305X site-directed mutagenese. Disse og følgende metoder beskrives i afsnit 12. I forsøg 1 benyttes et plasmid, psdm, som indeholder det muterede gen NDRG2-L172D. At genet med sikkerhed indeholder mutationen er bestemt på forhånd ved en sekventering, en metode til kortlægning af DNA-sekvenser. Efterfølgende skæres NDRG2- L172D ud af plasmidet med restriktionsenzymer og inkorporeres i vektoren pgbkt7 ved ligering, hvor enzymet ligase* sammensætter de to plasmid-stykker. I forsøg 2 indeholder pgbkt7 allerede genet for NDRG2, og mutationen inkorporeres som beskrevet ved site-directed mutagenese. Efterfølgende er forløbet stort set identisk for de to forsøg. Når mutationerne er inkorporerede, indføres plasmiderne i bakterieceller ved transformation. Bakteriecellerne opformeres på agarplader, og herefter opformeres enkelte kolonier ved podning. Ved Miniprep DNA oprenses plasmiderne fra bakteriecellerne og skæres herefter med Figur 7 Projektets eksperimentielle forløb. Der foretages to sideløbende forsøg med to forskellige mutationer. Metoden til at indføre mutationen i vektoren er forskellig i de to forsøg, henholdsvis ligering og site-directed mutagense. Efterfølgende benyttes de samme metoder, og i sidste ende et gær-2-hybridsystem. 11

20 restriktionsenzymer. I forsøg 1 er det ved en gelelektroforese muligt at påvise, at NDRG2-L172D er indført, idet ét af fragmenterne vil være større end, hvis fragmentet med mutationen ikke er indført. Da S305X indeholder et restriktionssite*, vil en gelelektroforese ligeledes kunne vise om mutationen er indført, idet der vil forekomme et ekstra restriktionsfragment. Når det er påvist, at vektorerne indeholder NDRG2 med de ønskede mutationer, kan disse transformeres ind i gærceller. Ligeledes foretages dette for pgadt7-api5. Gærceller med henholdsvis den ønskede NDRG2-mutation og Api5 formeres, og nye gærstammer indeholdende begge plasmider kan således benyttes i gær-2-hybridsystemet. 12 Resultater Følgende afsnit præsenterer og analyserer projektets eksperimentelle resultater. Det har desuden til formål at danne en teoretisk forståelse for de benyttede metoder. Resultater fra mislykkede forsøg kan aflæses i appendix, afsnit Til de eksperimentelle forsøg benyttes hndrg2b, der som nævnt betegnes NDRG2. Desuden er Api5 udtaget fra mus, som er 98 % homologt med API5 [Van den Berghe et al., 2000] Forsøg 1: L172D Sekventering af psdm Til inkorporering af NDRG2-L172D i vektoren pgbkt7, tages udgangspunkt i en mindre vektor kaldet psdm, som er produceret på forhånd. Denne ses på Figur 8 og indeholder NDRG2-genet med den ønskede mutation. For at sikre, at mutationen er inkorporeret i genet, er der foretaget en sekventering af psdm. I dette projekt bruges cyclesekventering også kaldet Sanger-sekventering [Campbell et al., 2011]. Resultater for sekventering af psdm viser, at mutationen er inkorporeret. Den fuldkomne sekvens kan aflæses i appendix, afsnit Figur 8 psdm (5046 bp). Vektoren indeholder NDRG2- L172D samt genet for kanamycinresistens, Kan(R), og genet for ampicilinresistens, Amp(R). Der skæres med restriktionsenzymerne NcoI og XhoI. [Cathy Mitchelmore, 2012] 12

21 Skæring af psdm og pgbkt7 Til at skære NDRG2-L172D ud af psdm bruges restriktionsenzymer. Disse er meget specifikke og genkender typisk fire til otte nukleotider, som det ses på Figur 9.a. Her bryder enzymet en sukker-fosfat-backbone i det dobbeltstrengede DNA, hvorved der dannes restriktionsfragmenter [Campbell et al., 2011]. Kløvningen sker ved hydrolyse uden brug af ATP, og er illustreret i Figur 9.b. Det ses her, at udhængene eksponeres Figur 9 Restriktionsenzymet HindIII. Et udsnit af DNA hvor HindIII skærer ved det specifikke restriktionssite A A G C T T. Det ses at læserammen er ens fra 3 til 5 og 5 til 3. a Et udsnit af DNAgenkendelsessekvensen for HindIII b De to fragmenter er skåret fra hinanden og udhængende er nu eksponeret [Egenproduktion]. efter skæring, og ved brug af DNA-ligase kan de sættes sammen med et nyt stykke DNA, der ligeledes er klippet med samme restriktionsenzym [Pingoud & Jeltsch, 2011]. Der findes fire typer af restriktionsenzymer. I dette projekt benyttes type II restriktionsenzymer, blandt andet HindIII*, som er illustreret på Figur 9. I alle type II enzymer, er genkendelsessekvensen palindromisk, og er derfor identisk uanset læseretning [Pingoud & Jeltsch, 2011]. Til skæring af psdm benyttes restriktionsenzymerne XhoI og NcoI. Som det ses på Figur 8 vil disse kløve DNA et fire steder. Der fås således fire restriktionsfragmenter med størrelserne: XhoI (2) NcoI (1078): 1076 bp NcoI (1078) XhoI (1085): 7 bp XhoI (1085) NcoI (2515): 1430 bp NcoI (2515) XhoI (2): 2533 bp For at undersøge, om fragmenterne har den forventede størrelse, benyttes metoden gelelektroforese, som bruges til at adskille molekyler. Metoden har fordel i at makromolekyler, eksempelvis nukleinsyrer og proteiner, har forskellig negativitet og størrelse. I et kar med en elektrode i hver ende tilsættes en støbt polymerisk gel, eksempelvis en agarosegel. I den negative ende er dannet en række brønde, hvori det undersøgte materiale placeres. Desuden tilsættes loading dye og ethidiumbromid. Loading dye er som regel en blanding af ethylen diamin tetra-acetat (EDTA), sukrose og bromphenolblåt. EDTA stopper enzymaktiviteten ved at binde positive ioner og sukrose gør blandingen tungere, således at DNA et synker ned i brønden. Bromfenolblåt er en markør for, hvornår gelen er kørt færdig. Ethidiumbromid bindes til DNA et, og gør det muligt at 13

22 se fragmenterne under ultraviolet lys. Ved at tilføre elektrisk ladning, vil molekylerne, som er negativt ladede, vandre mod den positive ende af gelen. Gelen i karet består af lange polymere fibre, som vanskeliggør vandringen for længere molekyler. Molekyler, der er større, vil i højere grad bremses i gelen. Dette resulterer i, at molekyler med en bestemt ladning og størrelse vandrer lige langt i gelen [Campbell et al., 2011]. Til at bestemme fragmentstørrelserne køres til sammenligning en række fragmenter med kendte størrelser, hvorved der fremkommer en såkaldt KB-ladder. Restriktionsfragmenterne ved skæring af psdm har den forventede størrelse. Der er ikke taget noget billede af disse, idet fragmentet NDRG2-L172D på 1076 bp skæres ud af gelen. Dette fragment skal inkorporeres i vektoren pgbkt7, som ses på Figur 10. Plasmidet indeholder Gal4-BD, der skal sidde i forlængelse af NDRG2-L172D, idet der i gær-2-hybridstemet skal dannes et fusionsprotein mellem disse. pgbkt7 skæres med NcoI og SalI for at åbne vektoren, således at NDRG2-L172D kan indsættes. Denne køres ligeledes på en gel. Fragmenterne bør, som det udledes af Figur 10, have størrelserne: Figur 10 pgbkt7 (7304 bp) Vektoren indeholder et Gal4- bindingsdomæne, genet for kanamycinresistens, Kan(R), samt genet TRP1. Der skæres med Nco1 og Sal1. SalI (1316) NcoI (1289): 7277 bp NcoI (1289) SalI (1316): 27 bp Resultaterne er som forventet, og fragmentet på 7277 bp skæres ud af gelen, da denne udgør vektoren for NDRG2- L172D fragmentet. NDRG2-L172D fragmentet (1076 bp) skåret ud af psdm samt det store vektorfragment fra pgbkt7 (7277 bp) køres begge på en gel. Resultatet ses på Figur 11. I brønd 1 og 2 ses pgbkt7-fragmentet, hvor det i brønd 1 er en 10 gange Figur 11 Gelelektroforese af pgbkt7 fragment (7277 bp) og NDRG2-L172D (1076 bp). I brønd 1 og 2 ses pgbkt7-fragmentet, i brønd 1 i en 10 gange højere fortynding. I brønd 3 forekommer fragmentet NDRG2-L172D, men kan på grund af ringe billedkvalitet ikke ses på figuren. 14

23 højere fortynding. NDRG2-L172D forekommer i brønd 3, men ses kun meget utydeligt grundet den ringe billedkvalitet. De to forskellige opløsninger i brønd 1 og 2 bruges til sammenligning af forholdet mellem de to fragmenter, som skal ligeres sammen. Disse bør være i lignende koncentrationer. Da fragmentet i brønd 3 er i en høj fortynding, bør koncentrationen af fragmentet i brønd 1 være at foretrække, da denne ligeledes har en høj fortynding Ligering Til at sammensætte den skårede vektor pgbkt7 og fragmentet NDRG2-L172D benyttes metoden ligering. Dette er en proces, hvor DNA-ligase sammenføjer DNA-stykkerne på sukker-fosfatbackbone af DNA et [Berg et al., 2002] [Nelson & Cox, 2008]. De to fragmenter tilsættes en tube med buffer og DNA-ligase samt H 2 O for at opnå den korrekte koncentration. Som tidligere beskrevet, kan udhæng skåret med samme restriktionsenzym ligeres. I dette tilfælde sammenføjes dog to udhæng skåret med forskellige enzymer, henholdsvis SalI og XhoI. Da genkendelsessekvensen er stort set identisk for restriktionsenzymerne, vil udhængene dog være kompatible og vil derfor kunne ligeres. Såfremt ligeringen er vellykket, dannes et plasmid kaldet pgbkt7-ndrg2-l172d, som ses på Figur 12. Desuden foretages en kontrol-ligering udelukkende med pgbkt7- fragmentet. Da udhængene på dette fragment ikke passer sammen, burde der ikke kunne foretages en succesfuld ligering ved denne kontrol. Resultatet af denne kontrol kan aflæses ved en efterfølgende transformation beskrevet nedenfor Transformation af E. Coli For at benytte plasmidet pgbkt7-ndrg2-l172d i et gær-2-hybridsystem er det nødvendigt at opformere plasmiderne. Til dette udnyttes bakteriecellen E. coli, som optager plasmiderne ved metoden transformation. Ordet transformation dækker over optag af fremmed DNA i eksempelvis bakterie- eller gærceller. En bakterie kan optage DNA fra en anden bakterie og dermed indeholde arvemateriale fra to forskellige celler. Værten er ved kunstig behandling gjort kompetent, så den nemt kan optage det ønskede plasmid. Yderligere gives et varmechok for at gøre cellemembranen porøs [Snyder & Champness, 2007]. Figur 12 pgbkt7-ndrg2-l172d (8353 bp). Vektoren indeholder NDRG2-L172D, GAL4-BD, genet for kanamycinresistens (KanR) samt genet TRP1. Desuden findes tre restriktionssites for HindIII. 15

24 Der udnyttes antibiotikaresistens for at kontrollere, hvorvidt bakteriecellerne har optaget det ønskede plasmid. Som det ses på Figur 12 indeholder pgbkt7-ndrg2-l172d kanamycinresistens, og cellerne vokser således på agarplader tilført kanamycin. Dette vil medføre overlevelse af kun de modstandsdygtige bakterier med inkorporerede plasmider. Ved transformationen benyttes E. coli XL 10-Gold celler, som er velegnede til transformation af større plasmider. Da vi før har foretaget en vellykket transformation af samme E. coli-celler (se appendix, afsnit 17.2), er det vist, at cellerne kan benyttes, at resistensgenet virker, samt at bakterierne ikke i sig selv indeholder genet for kanamycinresistens. Derfor foretages denne gang ingen kontrolforsøg. Tabel 1 Transformation af E. coli X L10-Gold celler med pgbkt7-ndrg2-l172d. pgbkt7-ndrg2-l172d (100 µl) pgbkt7-ndrg2-l172d (rest) pgbkt7 skåret med NcoI og SalI (100 µl) Antal bakteriekolonier Ingen Som forventet ses en vækst på de to plader med pgbkt7-ndrg2-l172d, da disse indeholder plasmider med kanamycinresistens. Om plasmiderne reelt set indeholder NDRG2-L172D er dog endnu ikke påvist. Kontrollen på tredje agarplade vokser ikke, da der som forventet ikke er sket en ligering på grund af ukompatible udhæng, og plasmidet dermed er lineært. Derved kan bakterien ikke udnytte kanamycinresistensen og dør Podning af E. coli For at benytte de dannede plasmider, udtages enkelte bakteriekolonier fra agarpladen. Disse prikkes i forskellige rør indeholdende LB medie og kanamycin. Dette giver bakterierne gode vækstbetingelser, og samtidig sikres det, at ingen bakterier uden plasmidet overlever. Ved inkubation ved 37 grader vil bakterierne opformeres Miniprep DNA For at kunne anvende plasmiderne i et gær-2-hybridsystem, er det nødvendigt først og fremmest at undersøge om disse indeholder NDRG2-L172D. Dette kan undersøges ved en skæring, men først må plasmiderne oprenses fra bakteriecellerne ved metoden Miniprep DNA. I dette tilfælde benyttes et GenElute Plasmid Miniprep Kit. For at få plasmiderne på ren form ud af bakterierne er lysering*, en opløsning af cellemembranen, nødvendig. Der tilsættes en basisk opløsning kaldet lysis solution, som består af natrium dodecyl sulfat (SDS) og natriumhydroxid. 16

25 Dette opløser cellemembranen og denaturerer proteiner og DNA i cellen, inklusiv plasmidet. Når en neutraliserende væske, Neutralization Solution, tilsættes, vil opløsningen blive mindre basisk, og plasmid DNA renatureres i modsætning til det kromosomale DNA. Dette skyldes, at plasmider er mindre end det kromosomale DNA og derfor har lettere ved at renaturere. Når blandingen spinnes vil SDS og cellerester, såsom proteiner, lipider og kromosomalt DNA, bundfælde. På denne måde er de rene plasmider separeret fra celleresterne. Plamid-DNA et opsamles i en collection tube, hvor det renses fra de sidste urenheder og salte [Sigma-Aldrich, 2011] Skæring af pgbkt7-ndrg2-l172d For at teste indsættelsen af NDRG2-L172D i vektoren skæres denne med restriktionsenzymer. pgbkt7-ndrg2-l172d skæres med HindIII. De forventede fragmentstørrelser er således (udledt af Figur 12): HindIII (738) HindIII (2655): 1917 bp HindIII (2655) HindIII (7593): 4938 bp HindIII (7593) HindIII (738): 1498 bp Desuden skæres vektoren pgbkt7 uden NDRG2-L712D med HindIII til sammenligning. Denne forventes at have følgende fragmentstørrelser (udledt af Figur 10): HindIII (738) HindIII (1606): 868 bp HindIII (1606) HindIII (6544): 4938 bp HindIII (6544) HindIII (738): 1498 bp På Figur 13 er restriktionsfragmenter fra pgbkt7-nrdg2-l172d kørt i brønd 1 til 5 og 7 til 11. Ved disse brønde, undtagen brønd 9, ses det, at fragmenterne har de forventede størrelser på cirka 1500, 1900 og 5000 bp. Det kan derfor udledes, at disse skårede plasmider indeholder fragmentet NDRG2-L172D. I brønd 6 køres pgbkt7-fragmenterne til sammenligning, hvorved det ses, at de har de forventede størrelser på knap 900, 1500 og 5000 bp. I brønd 12 er pgbkt7 skåret med NcoI og SalI, som tidligere beskrevet ikke kunne ligeres. Det ses, at HindIII tilsyneladende ikke har skåret dette fragment, men hvorfor vides ikke. Plasmiderne i brønd 3 og 4 udvælges til at bruges i gær-2-hybridsystemet. Resultater fra transformation af gærceller, formering af gærceller samt gær-2-hybridsystemet angives fælles for forsøg 1 og forsøg 2, se afsnit

26 Figur 13 Gelektroforese af GBKT7-NDRG2-L172D skåret med HindIII. Alle brøndene viser tre tydelige bånd. Da fragmenterne har den forventede størrelse antages det, at mutationen L172D er indført 12.2 Forsøg 2: S305X Site-directed mutagenese I forsøg 2 benyttes metoden QuickChange II site-directed mutagenese til at indføre mutation S305X i NDRG2. Metoden tager udgangspunkt i et dobbelt-strenget methyleret* plasmid, markeret med sort i Figur 14. Dette plasmid kaldes pgbkt7-ndrg2, og indeholder således Gal4-BD og NDRG2. Mutationen S305X inkorporeres i genet ved hjælp af oligonukleotider*, som er korte kæder enkeltstrenget DNA. I dette tilfælde er de 32 nukleotider langt og benævnes top og bottom. De fungerer som primere og indeholder den mutation der ønskes indført. Disse er markeret som blå prikker på Figur 14 og Figur 15.a. Figur 14 pgbkt7-ndrg2 (sort) med oligonukleotider (blå). Den øverste primer kaldes for top, og starter med baserne CGA og slutter med GAC. Den nederste primer kaldes bottom og starter med GCT og slutter med CTG. Baserne mellem disse er hverken indført for top eller bottom. Læserammen for hver af oligonukleotiderne er ligeledes indført. Deoxyribonukleotider kan ved hjælp af DNA-polymerase forlænge de to oligonukleotider, hvilket ses på Figur 15.b. Disse hæftes dog ikke sammen i enderne hvorved der opstår små huller mellem DNA-strengene - såkaldte nicks. Da disse er placeret forskudt af hinanden, som illustreret på 18

27 Figur 15.c, vil strengene alligevel forblive sammen cirkulært, og på denne måde danne et nyt cirkulært plasmid. For at processen kan forløbe, gennemgår blandingen opvarmning og nedkøling i cykler. Reaktionen minder om en PCR-reaktion* og foretages ligeledes i en PCR-maskine. Det er dog udelukkende de originale methylerede DNA-strenge, der fungerer som skabelon, og der er derfor snarere tale om en lineær amplifikation. Ved lineær amplifikation dannes i princippet to lineære enkeltstrengede DNA-stykker for hvert plasmid. Når processen er forløbet, tilsættes restriktionsenzymet DpnI, som nedbryder de methylerede DNA-strenge, som det ses på Figur 15.c. På denne måde bør alle resterende plasmider indeholde den ønskede mutation. På Figur 15.d ses det, at plasmidet optages i en bakteriecelle ved transformation, hvor DNA-strengene hæftes sammen af bakteriets eget ligase [Agilent Technologies, 2012]. Figur 15 Site-directed mutagenese, QuickChange II. a Oligonukleotider indeholdende mutationen bindes til komplementære, methylerede DNA-strenge (sorte). b Ved lineær amplifikation i en PCR-maskine forlænges DNA-strengene ved hjælp af DNApolymerase og deoxyribonukleotider. c Restriktionsenzymet DpnI tilsættes, og nedbryder det methylerede DNA. Tilbage er kun DNAstrenge, som indeholder mutationen (blå). DNA-strengene er ikke hæftet sammen i enderne, hvorved der opstår nicks. d Det dannede plasmid transformeres ind i en bakterie og får repareret de to nicks ved hjælp af bakteriens eget ligase [Egenproduktion, modificeret fra Agilent Technologies, 2012]. Da begge oligonukleotider skal transskriberes i læserammen 5 til 3, vil retningen af S305X bottom blive skrevet i den inverse retning. S305X top 5 GCTACATGGCCTAAGCTTGCATGACTCGCCTG 3 S305X bottom 5 CAGGCGAGTCATGCAAGCTTAGGCCATGTAGC 3 Baser markeret med fed, er de der muteres og dem markeret med gul, indikerer hvor der er muteret til et stopcodon. Baserne efter stopcodonet er da også muteret, hvormed der fremkommer en sekvens med baserne TAAGCTT. Baserne AAGCTT er et restriktionssite for restriktionsenzymet HindIII, som det ses i Figur 9. Det er grundet dette restriktionssite, at der i en restriktionsanalyse vil fremkomme fire fragmenter i pgbkt7-ndrg2-s305x i stedet for tre. Det er kun muligt at indføre baserne GCTT efter stopcodonet, da dette ikke transskriberes og dermed ikke ændrer det udtrykte protein. 19

28 Det dannede plasmid kaldes pgbkt7-ndrg2- S305X, og indeholder nu NDRG2-S305X i forlængelse af Gal4-BD. Denne ses på Figur 16. Om mutationen er indført kan først afgøres ved en restriktionsanalyse Transformation af E. coli Som i forsøg 1 transformeres E. coli XL 10-Gold celler, og denne gang med det dannede plasmid pgbkt7-ndrg2-s305x. Figur 16 pgbkt7-ndrg2-s305x (8353 bp). Vektoren indeholder NDRG2-S305X, Gal4-BD, kanamycinresistens, Kan(R), samt genet TRP1. Der er desuden fire restriktionssites for HindIII. Tabel 2 Transformation af E. coli XL 10-Gold celler med pgbkt7-ndrg2-s305x. pgbkt- NDRG2 (kontrol 1) pgbkt- NDRG2 (kontrol 2) pgbkt- NDRG2 (kontrol 3) pgbkt- NDRG2-S305X (100 µl) pgbkt- NDRG2- S305X (rest) Antal bakteriekolonier >100 Ingen > Kanamycin Resultaterne er som forventede. Kontrol 1 viser, at bakteriecellerne er kompetente og dermed kan optage plasmidet. Da der er kanamycin på pladen, viser kontrollen ligeledes, at plasmidet indeholder kanamycinresistens. At der ikke ses nogen vækst på kontrol 2 viser, at bakterierne ikke i sig selv indeholder kanamycinresistens, og at det tilsatte kanamycin virker. Kontrol 3 viser, at bakteriecellerne i sig selv fungerer. På de sidste to agarplader vokser bakteriecellerne med plasmidet pgbkt7-ndrg2-s305x syntesiteret ved site-directed mutagenese. Som forventet overlever cellerne, idet plasmidet indeholder kanamycinresistens. Som sikkerhed fremgår både en plade med 100 µl og en plade med resten af cellerne, i tilfældet at 100 µl ikke er tilstrækkeligt. Om mutationen er indført, kan afgøres ved en gelelektroforese. 20

29 Podning af E. coli Som i forsøg 1 podes enkelte bakteriekolonier, men mediet S.O.C. benyttes i stedet for LB medie Skæring af pgbkt7-ndrg2-s305x For at teste om S305X er inkorporeret korrekt i NDRG2 ved site-directed mutagenese, skæres pgbkt7-ndrg2-s305x med HindIII. Som det ses på Figur 16 indeholder S305X et ekstra skæringssted for HindIII, og der bør således dannes fire restriktionsfragmenter, og ikke tre, såfremt mutationen er indført. Fragmenterne bør have følgende størrelser (udledt af Figur 16): HindIII (738) HindIII (2204): 1466 bp HindIII (2204) HindIII (2655): 451 bp HindIII (2655) HindIII (7593): 4938 bp HindIII (7593) HindIII (738): 1498 bp Af gelelektroforesen på Figur 17 kan det udledes, at fragmenterne der er kørt i brønd 11, 12, 13 og 16 har de forventede størrelser. Dog er det svært at skelne fragmenterne på 1466 bp og 1498 bp fra hinanden, idet de tilsammen danner et lidt tykkere bånd. Til gær-2- hybridsystemet benyttes de plasmider, som er kørt i brønd 11 og Fælles procedurer for forsøg 1 og 2 I følgende afsnit gennemgås metoderne, der er foretaget fælles for forsøg 1 og Transformation af gærceller For at benytte plasmiderne pgbkt7-ndrg2-l172d og pgbkt7-ndrg2-s305x i et gær-2- hybridsystem transformeres de ind i gærceller. Til dette benyttes plasmider fra Miniprep 3 og 4 i forsøg 1 og Miniprep 11 og 12 i forsøg 2. Desuden er plasmidet pgadt7-api5, som indeholder Gal4-AD og Api5, allerede transformeret i en anden gærstamme. Metoden er stort set identisk med transformation af E. coli. Gærceller er dog ikke lige så skrøbelige som bakterieceller grundet deres tykkere cellevægge. Figur 17 Gelelektroforese af pgbkt7-ndrg2-s305x skåret med HindIII. Brønd 11, 12, 13 og 16 viser tre tydelige bånd. Båndende omkring knapt 1500 bp danner tilsammen ét tykt bånd. Da fragmenterne har den forventede størrelse antages det således, at mutationen S305X er indført. 21

30 For kun at opformere gærceller, som har optaget plasmiderne, udnyttes for alle pgbkt7- plasmider genet phosphoribosyl-anthranilate isomerase (TRP1). Dette gen koder for et enzym, der medvirker til syntesen af det essentielle næringsstof tryptofan. På agarpladerne udelades derfor tryptofan, således at kun gærceller med de inkorporerede plasmider, kan overleve. pgadt7-plasmider indeholder beta-isopropylmalat dehydrogenase (LEU2), som koder for et enzym, der medvirker til syntesen af leucin. Derfor udelades leucin på agarpladerne ved transformation af gærceller med alle pgadt7-plasmider. Ligeledes vil kun gærceller med inkorporerede plasmider overleve. Transformationen er vellykket, idet gærcellerne overlevede Formering af gærceller En metode til at indsætte plasmider fra forskellige gærstammer til den samme gærstamme, kaldes formeringsmetoden. Denne udnytter en kønnet formering af to gærstammer af typen a og α, hvormed en ny stamme, aα, dannes. En a-celle kan kun parres med en α-celle, og ikke med en af samme type som sig selv. a-celler udsender en a-faktor, som signalerer a-cellens tilstedeværelse til α- celler. Ligeledes udsender α-celler en α-faktor, der signalerer til a-celler. Dette gør, at cellerne udvides i retning mod hinanden og senere fusionerer [Alberts et al., 2008]. Figur 18 Resultaterne fra gær-2-hybridsystem på DDO pladen. Det ses at alle gærstammerne vokser, hvilket betyder at alle formeringerne er vellykkede. a-celler transformeres med pgbkt7-plasmider og α-celler transformeres med pgadt7- plasmider. Transformerede gærceller formeres som opstillet i Tabel 3. Der benyttes en double droupout-agarplade (DDO-agarplade), hvor både tryptofan og leucin udlades, for dermed at undersøge hvorvidt plasmiderne er indført i gærcellerne. Således vil kun gærceller indeholdende begge plasmider overleve. Som positiv kontrol i gær-2-hybridsystemet foretages formering af pgbkt7-p53 og pgadt7-tag, som med sikkerhed vil danne to interagerende fusionsproteiner. Figur 18 viser resultatet af DDO-pladen, og det ses at alle gærstammer vokser. Det kan derfor udledes, at alle formeringer er vellykkede. 22

31 Gær-2-hybridsystem Der foretages et dublikat af gær-2-hybridsystemet for at optimere validiteten af resultaterne. Da resultaterne var ens, er det ene kun repræsenteret. Det er via formeringen lykkedes at formere de gærceller, som skal benyttes i gær-2- hybridsystemet. Formeringerne pipetteres på en quadruple dropout-agaplade (QDOX-agaplade) med X-gal, men uden leucin, tryptofan, histidin og adenin. Kun gærceller med begge plasmider, og fusionsproteiner der interagerer, bliver blå og vokser på QDOX-pladen. Tabel 3 danner en oversigt over, hvilke resultater, der forventes på pladen. Tabel 3 Forventede resultater i gær-2-hybridsystemet på QDOX pladen. Blanke felter indikerer de undersøgte kompleksdannelser som ikke kan forudsiges. De negative forventes ikke at danne kompleks, mens de positive forventes at danne kompleks. De grå felter indikerer at de to plasmider ikke udnyttes sammen i gær-2-hybridsystemet. pgadt7 pgadt7-api5 pgadt7-tag pgbkt7 Negativ Negativ pgbkt7-ndrg2b Negativ Positiv pgbkt7-s305x (11) pgbkt7-s305x (12) pgbkt7-l172d (3) pgbkt7-l172s (4) Negativ Negativ Negativ Negativ pgbkt7-p53 Positiv I første kolonne af Tabel 3 mangler et eller flere fusionsproteiner, og der forventes derfor ingen kompleksdannelse. Dette gælder ligeledes for formerede gærceller med plasmiderne pgbkt7 og pgadt7-api5, idet der også her kun vil dannes ét fusionsprotein mellem Gal4-AD og Api5. Som tidligere beskrevet benyttes pgbkt7-p53 og pgadt7-tag som positiv kontrol, idet de som kendt interagerer og gærcellerne derfor vil vokse. De blanke felter angiver de uforudsigelige resultater, som er interessante for problemstillingen. Hvis der ingen kompleksdannelse forekommer og dermed ingen vækst af gærceller, betyder det at mutationen kan have interfereret ved et essentielt domæne for bindingsstedet mellem NDRG2 og Api5. På baggrund af hypotesen forventes enten pgbkt7-ndrg2-l127d og pgadt7-api5 eller pgbkt7-ndrg2-s305x og pgadt7-api5 at være negativ, og der dermed ikke dannes kompleks. Grå felter angiver, at der ikke eksperimenteres med de pågældende proteiner. Som ekstra kontrol foretages gær-2-hybridsystemet to gange. 23

32 Resultaterne i Figur 19 viser, at alle kontrollerne er lykkedes og er som forventede. Kompleksdannelsen mellem Api5 og de dannede proteiner fra Miniprep 3, 4, 11 og 12 er det væsentlige i det eksperimentelle arbejde. 3 og 4 er Miniprep fra forsøg 1, mens 11 og 12 er Miniprep fra forsøg 2. På figuren ses det, at Api5 danner kompleks med både 11 og 12, da de begge er blå og dermed stadig vokser. Dette indikerer, at det ikke er regionen efter / -hydrolase-domænet, der er essentiel for kompleksdannelsen mellem Api5 og NDRG2. Derimod danner Api5 hverken kompleks med 3 eller 4, da de ikke har overlevet og er derfor ikke blå. Hypotesen foreslår, at bindingsstedet mellem Api5 og NDRG2 enten er i regionen efter / -hydrolasedomænet eller i -helix 6 regionen. At Api5 danner kompleks med 3 og 4 indikerer, at bindingsstedet findes i -helix 6 regionen. Figur 19 Resultaterne fra gær-2-hybridsystem på QDOX pladen. Kontroller er som forventede. Det ses at NDRG2- S305X (11 og 12) og Api5 danner kompleks, da den er blå og dermed vokser. Dette indikerer at regionen efter / - hydrolase-domænet ikke er essentiel for kompleksdannelsen mellem Api5 og NDRG2. Det ses ydermere, at der ikke er kompleksdannelse mellem NDRG2-L172D (3 og 4) og Api5. Dette indikerer, at α-helix 6 er essentiel for kompleksdannelsen mellem Api5 og NDRG2. Forsøget blev udført to gange, men da resultaterne var ens for begge forsøg vises kun den ene agarplade. 24

33 13 Diskussion I følgende afsnit diskuteres projektets resultater og hvilke konklusioner, der heraf kan drages. Der vil i denne sammenhæng tages forbehold for væsentlige fejlkilder og usikkerheder ved det eksperimentelle arbejde, for dermed at undersøge validiteten af resultater og konklusioner. I projektet foretages et duplikat af gær-2-hybridsystemet. Resultaterne af de to forsøg er identiske, og ydermere benyttes to plasmider for hver mutation, der ligeledes viser samme resultater. Dette er en vigtig faktor, som øger pålideligheden af projektets resultater. Resultater fra gær-2-hybridsystemet viser, at α-helix 6 i NDRG2 sandsynligvis er essentiel for kompleksdannelsen med Api5. Domænet efter α/β-hydrolasedomænet i NDRG2 medvirker tilsyneladende ikke til interaktion med Api5. Da alle eksperimentets kontrolforsøg er som forventede, vurderes det, at resultaterne er valide. Ved eksperimentelt arbejde som dette vil der dog altid være en række usikkerheder, og de mange indledende forsøg inden selve gær-2- hybridsystemet øger denne usikkerhed. Netop derfor er der undervejs udført sikkerhedstjek i form af restriktionsanalyser, som påviser mutationernes indførelse. Gær-2-hybridsystemet udnytter gærcellers mange ligheder med humane celler, da gærceller er eukaryote og har mange af de samme cellulære processer som humane celler [Campbell et al., 2011]. Bakterieceller er lettere at arbejde med, da de vokser hurtigere. Men da de er prokaryote og dermed har langt simplere intracellulære processer, udgør de ikke et godt modelsystem for humane celler. Det er dog muligt at bruge bakterieceller under opformeringen af de ønskede plasmider og derved udnytte den høje vækstrate. I 2006 viste Morris og kolleger, at Api5 hæmmer E2F-induceret apoptose in vivo ved brug af bananfluen Drosophila [Morris et al., 2006]. Drosophila udgør et godt modelsystem for humane celler, som er let at arbejde med og derfor også er hyppigt brugt. Da det menneskelige genom er langt større end de nævnte modelsystemer, kan andre gener i humane celler have betydning for de intracellulære processer, eksempelvis kompleksdannelsen i dette projekt. Resultater fra modelsystemer kan derfor aldrig direkte overføres til at gælde for humane celler. Det kan således ikke med sikkerhed konkluderes, at NDRG2 og Api5 danner kompleks i humane celler. Trods mange fordele ved gær-2-hybridsystemet, vil det alligevel altid være forbundet med usikkerheder. Hvis en mutation i proteinet forårsager en strukturændring andet steds end ved mutationen, kan denne ændring forhindre en kompleksdannelse. Dette resultat vil være falsknegativt, og der bør henledes en opmærksomhed på, at det område, hvori mutationen er placeret, ikke endeligt kan konkluderes som værende essentielt for bindingsstedet. Det har i dette 25

34 projekt ikke været muligt at påvise eventuelle falsk-negative resultater, men det kan konkluderes at domænet sandsynligvis er essentielt for proteininteraktionen. For at udelukke en konformationsændring af andre regioner end α-helix 6, og dermed et falsk-negativt resultat, kunne videre undersøgelser klargøre 3D-strukturen af NDRG2-L127D. Dette kunne eksempelvis forsøges med en røntgenkrystallografi som Hwang og kolleger, eller ved at benytte en SWISS-MODEL. Dette er et webbaseret system, der ud fra aminosyresekvensen kan forudse proteinstrukturer [Swiss Institute of Biomechanics, 2011]. For at udelukke, at et falsk-negativt resultat skyldes manglende syntese af et eller flere fusionsproteiner, kan der foretages et Western Blot. Denne metode har til formål at undersøge, om proteinerne er udtrykt i gærcellerne, og om de har de forventede størrelser [Berg et al., 2001]. I gær-2-hybridsystemet dannes to fusionsproteiner, BD-NDRG2 og AD-Api5. Teoretisk set bør NDRG2 og Api5 bevare den sædvanlige struktur, idet Gal4-bindingsdomænerne og de undersøgte proteiner foldes uafhængigt af hinanden. Der er dog tale om kunstige proteiner og proteinstrukturen kan derfor modificeres. Dette kan forhindre en kompleksdannelse, som normalvis ville forekomme og dermed fås et falsk-negativt resultat. Da gær-2-hybridsystemet i dette projekt har vist positive resultater i kontrollen med AD-Api5 og BD-NDRG2, forventes dette ikke at være tilfældet. Yderligere er der som en ekstra sikkerhed foretaget en positiv kontrol med TAg og p53, som interagerer som forventet. Derudover kan falsk-negative resultater skyldes forskelle på posttranslationelle modifikationer af proteiner i henholdsvis gærceller og humane celler [Sobhanifar, 2003]. Der er således tale om modifikationer af de translaterede proteiner eksempelvis i form af kløvning, fosforylering eller glykolysering [Campbell et al., 2011]. I dette projekt benyttes metoden formering af gærceller frem for co-transformation. Ved cotransformation transformeres de to forskellige plasmider ind i én gærcelle. Ved formering transformeres de to plasmider ind i forskellige gærceller, som herefter formeres. Tiden kan have en afgørende betydning, da gærcellerne her har større mulighed for at syntetisere fusionsproteinerne. Ved formering parres gærcellerne først når fusionsproteinet i hver gærcelle er udtrykt. Dermed sikres det, at fusionsproteinerne med det samme kan danne kompleks og initiere transskriptionen af reportergenet. Gærcellerne når på denne måde ikke at dø, som det kan være tilfældet ved co-transformation. I co-transformation produceres fusionsproteinerne efter transformationen, og de essentielle næringsstoffer kan derfor i nogle tilfælde ikke nå at syntetiseres før cellen dør [Alberts et al., 2008]. Valget af metode kan derfor have stor betydning for resultaterne, og det vurderes på baggrund af de positive resultater, at formeringen har været optimal. 26

35 Der benyttes i forsøg 1 og forsøg 2 forskellige metoder til at danne plasmider, som indeholder de ønskede mutationer. I først omgang blev site-directed mutagenese forsøgt i begge tilfælde, men da dette ikke lykkedes for mutationen L172D, blev ligering benyttet til sammenføjning af den skårede vektor pgbkt7 og NDRG2-L127D. Ligering lader umiddelbart til at være en mere sikker metode end site-directed mutagenese, idet det allerede er påvist ved en sekventering, at mutationen er indført i NDRG2. Det er dog muligvis en mere omstændig metode, idet indledende forsøg er nødvendig til indførsel af mutationen i genet. Disse er ikke nævnt under resultater, da psdm er leveret på forhånd. Under selve ligeringen kan der også opstå fejl. En restriktionsanalyse af pgbkt7-ndrg2-l127d har påvist, at ligeringen er forløbet som forventet. På en gelelektroforese kan det eksakte antal basepar i NDRG2-L127D dog ikke aflæses, men kun skønnes. I nogle tilfælde ses det, at nukleaser* fra celler der stammer fra omgivelserne, eksempelvis hænderne, kan interferere ved ligering. Disse nedbryder enkelte basepar i DNA-fragmenter på en sådan måde, at ligering endnu er mulig. Der er derfor en sandsynlighed for, at NDGR2-L172D er en smule forkortet, og at dette ikke kan ses på en gelelektroforese. En sådan ændring kunne have betydning for foldning af proteinet, og dermed resultatet i gær-2-hybridsystemet. For at sikre denne mulige fejlkilde, kunne der foretages en sekventering af pgbkt7-ndrg2-l127d efter ligering. Det kan på baggrund af nuværende resultater ikke afgøres, hvorvidt α-helix 6 i NDRG2 er bindingssted for Api5. Videre studier bør således undersøge, om der er fremkommet falsk-negative resultater. Som beskrevet i hypotesen er der dog gode grunde til at antage α-helix 6 som værende bindingssted, og resultaterne indikerer, at dette sandsynligvis er tilfældet. 14 Konklusion Den hydrofobe aminosyre leucin i α-helix 6 domænet blev muteret til asparaginsyre, hvorved NDRG2 ikke dannede kompleks med Api5. Dette indikerer at α-helix 6 domænet er essentielt for NDRG2 s binding til Api5. Aminosyrerne efter α/β-hydrolase domænet vurderes ikke at være essentielle for bindingen, da en binding stadig var mulig efter stykket blev fjernet. 27

36 15 Perspektivering Projektets resultater giver anledning til videre undersøgelse med henblik på nye behandlingsmuligheder af cancer. Det næste skridt i processen kunne være, at finde det præcise bindingssted for NDRG2 til Api5, med hensigten om at skabe et kunstigt protein med samme bindingssted som NDRG2. Dermed kunne Api5 s antiapoptotiske funktion potentielt nedreguleres. Det kunne være interessant at undersøge præcis hvilke mekanismer, der ligger bag nedreguleringen af NDRG2 i flere cancertyper. Det er allerede kendt, at c-myc via Miz-1 kan hæmme NDRG2-ekspression og at c-myc desuden er opreguleret i adskillige cancertyper. Derudover kan hæmningen skyldes methylering af NDRG2-promoteren* eller mikrorna regulering [Lorentzen & Mitchelmore, 2012]. Hvorfor c-myc ofte er opreguleret i cancer, og hvilke mutationer dette eventuelt kan skyldes, kunne således være interessante at undersøge. Disse forskellige reguleringsmekanismer af NDRG2, samt sandsynligvis flere ukendte, kunne være gode mål for cancerbehandling. Såfremt det er muligt at forhindre en hæmning af NDRG2-ekspression, vil dette muligvis være en måde, hvorpå udviklingen af nogle cancertyper kan bremses. Ligeledes vil regulering af Api5 være et oplagt forskningsområde. Videre forskning af NDRG2 og dets interaktion med Api5 er nødvendig for at klargøre, hvilken rolle denne kompleksdannelse spiller i udviklingen af cancer. Det kunne blandt andet være interessant at undersøge, hvorledes E2F-induceret apoptose afhænger af niveauet af NDRG2. Morris og kolleger påviste Api5 s hæmning af E2F-induceret apoptose i humane celler, ved at dels lade cellerne vokse med et normalt niveau af E2F og dels en opregulering af E2F. Opreguleringen af E2F forårsagede apoptose, men ved en opregulering af Api5 formåede cellerne at vokse uden påvirkning af den E2F-inducerede apoptose [Morris et al., 2006]. Dermed kunne man tilføre en øget mængde NDRG2 og Api5 til celler med henholdsvis normalt niveau af E2F og celler med øget niveau af E2F. Hvis cellerne med et øget E2F-niveau ikke vokser uhæmmet, men derimod påvirkes af den E2F-inducerede apoptose, kan det påvises at NDRG2 inhiberer Api5 s antiapoptotiske funktion. Dette ville være en metode til at eftervise projektets model. 28

37 16 Referenceliste Agilent Technologies (2012): QuikChange II Site-Directed Mutagenesis Kits Details & Specifications. roductdata&pageid=384 (Set den ). Alberts, B., Johnson, A., Lewis. J., Raff, M., Roberts, K. & Walter, P. (2008): Molecular biology of the cell, 5. Udgave, Garland Science. Berg, J.M., Tymoczko, J.L. & Stryer, L. (2002): Biochemistry, 5. udgave, W. H. Freeman and Company. Campbell, N.A., Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V. & Jackson, R.B. (2011): Biology, 9. Udgave, Pearson. Chien, C.-T., Bartel, P. L., Sternglanz, R. & Fields, S. (1991): The two hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest, Proc. Natl. Acad. Sci. USA 88: Faye, A. & Poyet, J.-L. (2010): Targeting AAC-11 in cancer therapy. Expert Opin. Ther. Targets. 14(1): Griffiths, A.J.F., Wessler, S.R., Carroll, S.B. & Doebly, J. (2012): Introduction to Genetic Analysis, 10. udgave, W. H. Freeman and Company. Han, B.-G., Kim, K. H., Lee, S. J., Jeong, K.-C., Cho, J.-W., Noh, K. H., Kim, T. W., Kim, S.-J., Yoon, H.-J., Suh, S. W., Lee, S. & Lee, B. I. (2012): Helical repeat structure of apoptosis inhibitor 5 reveals protein-protein interaction modules, J. Biol. Chem., 287(14): Hummerich, L., Müller, R., Hess, J., Kokocinski, F., Hahn, M., Fürstenberger, G., Mauch, C., Lichter, P., & Angel, P. (2006): Identification of novel tumour-axssociated genes differentially expressed in the process of squamous cell cancer development, Oncogene 25(1): Hwang, J., Kim, Y., Kang, H.B., Jaroszewski, L., Deacon, A.M., Lee, H., Choi, W.C., Kim, K.J., Kim, C.H., Kang, B.S., Lee, J.O., Oh, T.K., Kim, J.W., Wilson, I.A. & Kim, M.H. (2011): Crystal Structure of the Human N-myc Downstream-regulated Gene 2 Protein Provides Insight into Its Role as a Tumor Suppressor, J. Biol. Chem. 286(14):

38 Kim, J. W., Cho, H. S., Kim, J. H., Hur, S. Y., Kim, T. E., Lee, J. M., Kim, I.-K., & Namkoong, S.E., (2000), AAC-11 Overexpression Induces Invasion and Protect Cervical Cancer Cells from Apoptosis, Laboratory Investigation 80(4): Kokame, K., Kato, H. & Miyata, T. (1996): Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes, J. Biol. Chem., 271(47): Krejci, P., Pejchalova, K., Rosenbloom, B.E., Rosenfelt, F.P., Tran, E.L., Laurell, H., & Wilcox, W.R., (2007), The antiapoptotic protein Api5 and its partner high molecular weight FGF2, are upregulated in B cell chronic lymphoid leukemia, J. Leukoc. Biol. 82: Kræftens bekæmpelse (2012): Kræft i tal.http://www.cancer.dk/hjaelp+viden/fakta+om+kraeft/ kraeft+i+tal (Set den ). Lee, D. C., Kang, Y. K., Kim, W. H., Jang, Y. J., Kim, D. J., Park, I. Y., Sohn B. H., Sohn, H. A., Lee, H. G., Lim, J. S., Kim, J. W., Song, E. Y., Kim, D. M., Lee, M. N., Oh, G. T., Kim, S. J., Park, K. C., Yoo, H. S., Choi, J. Y. & Yeom, Y. I. (2008): Functional and clinical evidence for NDRG2 as a candidate suppressor of liver cancer metastasis, Cancer Res. 68: Lorentzen, A.B. & Mitchelmore, C. (2012): NDRG2: A Candidate Tumor Suppressor Gene in Search of a Function, BioMed Best Ltd. 2(1):9-17. Melotte, V., Qu, X., Ongenaert, M., van Criekinge, W., de Bruïne, A.P., Baldwin, H.S., van Engeland & M. (2010): The N-myc downstream regulated gene (NDRG) family: diverse functions, multiple applications, FASEB J. 24(11): Morris E. J., Michaud W. A., Ji, J-Y., Moon, N-S., Rocco J. W., & Dyson, N. J. (2006): Functional identification of Api5 as a suppressor of E2F-dependent apoptosis in vivo, PLOS genetics 2(11): Nelson, D. L. & Cox, M. M. (2008): Principles of Biochemistry, 5. udgave, Lehninger. Park, Y., Shon, S. K., Kim, A., Kim, K. I., Yang, Y., Cho, D. H., Lee, M. S. & Lim, J. S. (2007): SOCS1 induced by NDRG2 expression negatively regulates STAT3 activation in breast cancer cells, Biochem. Biophys. Res. Commun. 363: Pingoud, A. & Jeltsch, A. (2001): Structure and function of type II restriction endonucleases, Nucleic Acids Res. 29(18):

39 Qu, X., Zhai, Y., Wey, H., Zhang, C., Xing, G., Yu, Y. & He, F. (2002): Characterization and expression of three novel differentiation-related genes belong to the human NDRG gene family, Mol. Cell. Biochem. 229(1-2): Rigou, P., Piddubnyak, V., Faye, A., Rain, J-C., Michel, L., Calvo, F., & Poyet J-L.(2009): The antiapoptotic protein AAC-11 interacts with and regulates Acinus-mediated DNA fragmentation, EMBO J. 28: Sasaki, H., Moriyama, S., Yukiue, H., Kobayashi, Y., Nakashima, Y., Kaji, M., Fukai, I., Kiriyama, M., Yamakawa, Y., & Fujii, Y., (2001): Expression of the antiapoptosis gene, AAC-11, as a prognosis marker in non-small cell lung cancer, Elsevier Science Lung cancer 34: Shaw, E., McCue, L.A., Lawrence, C.E. & Dordick, J.S. (2002): Identification of a Novel Class in the α/β-hydrolase Fold Superfamily: The N-myc Differentation-Related Proteins, PROTEINS: Structure, Function, and Genetics 47: Sigma-Aldrich (2011): GenElute TM Plasmid Miniprep Kit. (Set den ). Snyder, L. & Champness, W. (2007): Molecular Genetics of Bacteria, 3. Udgave, ASM Press. Sobhanifar, S. (2003): Yeast Two Hybrid Assay: A Fishing Tale, BioTeach J. 1: Swiss Institute of Biomechanics (2012): Swiss-Model, (Set den ) Van den Berghe, L., Laurell, H., Huez, I., Zanibellato, C., Prats, H., Bugler, B. (2000): FIF [Fibroblast Growth Factor-2 (FGF-2)-Interacting-Factor], a Nuclear Putatively Antiapoptotic Factor, Interacts Specifically with FGF-2, Mol. Endocrinol., 14(11): Wang, L., Liu, N., Yao, L., Li, F., Zhang, J., Deng, Y., Liu, J., Ji, S., Yang, A., Han, H., Zhang, Y., Zhang, J., Han, W., & Liu, X. (2008): NDRG2 is a new HIF-1 Target Gene Necessary for Hypoxia-Induced Apoptosis in A549 Cells, Cell. Physiol. Biochem. 21: Yao, L., Zhang, J. & Liu, X. (2008): NDRG2: a Myc-repressed Gene Involved in Cancer and Cell Stress, Acta Biochem. Biophys. Sin 40: Zhang, J., Li, F., Liu, X., Shen, L., Liu, J., Su, J., Zhang, W., Deng, Y., Wang, L., Liu, N., Han, W., Zhang, Jing., Ji, S., Yang, A., Han, H. & Yao, L. (2006): The Repression of Human Differentation- 31

40 related Gene NDRG2 Expression by Myc via Miz-1.dependent interaction with the NDRG2 Core Promoter, J. Biol. Chem. 281(51): Zhou, R.-H., Kokame, K., Tsukamoto, Y., Yutani, C., Kato, H. & Miyata, T. (2001): Characterization of the human NDRG gene family: a newly identified member, NDRG4, is specifically expressed in brain and heart, Genomics 73:

41 17 Appendix 17.1 Materialeliste Forsøg Materialer Site-directed mutagenese Pfu reaction (buffer x 10) dsdna template pgbkt7-ndrg2b (20 ng/µl) Mutagenic primer #1 (L172D og S305X) (100 ng/µl) Mutagenic primer #2 (L172D og S305X) (100 ng/µl) dntps (10 mm) ddh 2 O PfuUltra HF DNA polymerase (2.5 U/µl) DpnI (restriktionsenzym) (10 U/µl) Restriktionsskæring NEB2 (buffer x 10) Sal (buffer x 10) Plasmid DNA (psdm og pgbkt7) Xhol restriktionsenzym Ncol restriktionsenzym SalI restriktionsenzym HindIII restriktionsenzym H 2 O Ligering Transformation af E. coli XL 10-Gold celler Podning pgbkt7 vektor (skåret med SalI og Ncol og oprenset) NDRG2b-L172D fragment DNA-Ligase H 2 O Ligering (buffer x 5) Kompetente E. coli XL 10-Gold celler Plasmid med inkorporeret vektor S.O.C. medie Tørre agarplader Kanamycin LB medie/ S.O.C medie Kanamycin Miniprep DNA Gelelektroforese Resuspension Solution Lysis Solution Neutralization Solution Column Preperation Solution Bakterieceller med optagede plasmider Optional Wash Solution Wash Solution Elution solution Loading dye Agarosegel 33

42 Transformation af gærceller ssdna Kompetente gærceller (AH109) Sterilt PEG/LiAc opløsning Dimethyl sulfoxid YPDA/Kanamycin medie (x 0.5) DDO-agarplader uden Tryptofan Formering af gærceller YPDA (x 2) AH109 culture Y187 culture Gær-2-hybridsystem DDO plade (uden leucin og tryptofan) QDOX plade (med X-gal, uden leucin, tryptofan, histidin, adenin) 34

43 17.2 Forsøg 1 fremgangsmåde Følgende beskriver fremgangsmåden for forsøget med leucin mutationen, L172D. Fra psdmplasmidet skæres NDRG2-L172D stykket ud. Vektoren pgkbt7 skæres med NcoI og SalI hvori NDRG2-L172D fragmentet indsættes ved ligering. Skæring af psdm og pgbkt7 5 µl psdm plasmid skæres i en tube. Følgende tilsættes: - 4 µl NEB2 buffer - 29 µl H 2 O så den totale volumen bliver 40 µl - 1 µl Xhol restriktionsenzym - 1 µl Ncol restriktionsenzym (restriktionsenzymer tilsættes sidst) 5 µl pgbkt7 plasmid skæres i en tube. Følgende tilsættes: - 4 µl Sal buffer - 29 µl H 2 O så den totale volumen bliver 40 µl - 1 µl SalI restriktionsenzym - 1 µl Ncol restriktionsenzym (restriktionsenzymer tilsættes sidst) Der inkuberes i 2 timer ved 37 o C. Tuberne indeholdende de skårede DNA fragmenter sættes i brønde i en gelelektroforese, hvormed de fragmenter der skal ligeres, skæres ud af gelen. 35

44 Ligering I en tube tilsættes: - 2 µl 7,3 kb pgbkt7 vektor skåret med NcoI og SalI (7277 bp) - 10µl 1,1 kb NDRG2-L172D-fragment - 4 µl Ligeringsbuffer - 1 µl DNA-Ligase - 3 µl H 2 O tilsættes, således at opløsningen har en volumen på 20 µl. I en anden tube tilsættes som kontrol: - 2 µl 7,3 kb pgbkt7 skåret med NcoI og SalI (7277 bp) Ligeringerne inkuberes i præcis 5 minutter ved 20 o C og sættes derefter på is. 36

45 Transformation af E. coli XL 10-Gold celler Tuberne med DNA klargøres og sættes på is. Kompetente E. coli XL 10-Gold celler optøs umiddelbart før brug og sættes på is. I en tube tilsættes: - 10 μl af DNA (pgbkt7-ndrg2-l172d) μl E. coli XL 10-Gold celler Der blandes forsigtigt, og inkuberes på is i mindst 30 minutter. Blandingen gives et varmechok i vandkar ved 42 C i præcis 45 sekunder. Efter varmechokket overføres tuben direkte til is. 250 μl S.O.C. medie tilføjes til hver tube og blandingen rystes ved 37 C i cirka 2 timer. Derefter spinnes blandingen hurtigt. Kontrolforsøg er i dette projekt kun foretaget for forsøg 2, der plades følgende: - Test: 100 μl celler med pgbkt7-ndrg2-l172d - Rest: Celler med pgbkt7-ndrg2-l172d Podning I en stor tube tilsættes: - 35 ml LB medie - 35 μl kanamycin. Blandingen fordeles i 6 mindre tuber, med 5 ml i hver. Bakterier fra agarplader tilsættes ved at prikke en tandstikker i en koloni, som sættes ned i væsken i tuberne. Herefter rystes tuberne natten over ved 37 o C. 37

46 Miniprep DNA 2 ml af celleblandningen fra podning centrifugeres i 5 minutter, således at cellerne bundfælder og mediet ligger øverst og kan pipetteres væk. For at resuspendere cellerne tilsættes 200 μl Resuspension Solution, og blandingen pipetteres op og ned, så cellerne opløses. 200 μl Lysis Solution tilsættes, og tuberne vendes forsigtigt. 350 μl Neutralization Solution tilsættes indenfor 5 minutter. Tuben vendes 4-6 gange. Blandingen centrifugeres i 10 minutter for at dele celleresterne og plasmiderne. Lysat, som indeholder plasmiderne, opsamles med pipette og de bundfældede cellerester smides ud. I en collection tube tilsættes 500 μl Column Preparation Solution for at klargøre filteret, og blandingen spinnes i 1 minut, hvorefter overskydende væske hældes fra. Lysatblandningen tilsættes den klargjorte collection tube og spinnes i 1 minut hvorved DNA et indfanges i filteret. Overskydende væske fjernes. For at undgå nukleaser, der katalyserer nedbrydningen af DNA, tilsættes 500 μl Optional Wash Solution og tuben spinnes 1 minut, hvorefter overskydende væske hældes fra. 700 μl Wash Solution tilsættes, tuben spinnes 1 minut og overskydende væske hældes fra. Tuben spinnes 1 minut for at tørre, og filteret overføres til en ny collection tube. Derefter tilsættes 50 μl elution solution og efter 1 minut spinnes den i 1 minut. Plasmiderne er nu opsamlet i collection tuben og er klar til restriktionsskæring. 38

47 Skæring af plasmider med mutationer I en tube tilsættes: - 2 μl Miniprep DNA - 2 μl NEB2 buffer - 15 μl H 2 O - 1 μl HindIII enzym til sidst. Blandingen inkuberes i 2 timer ved 37 C For at øge succesraten kan man lave flere tuber. 5 μl loading dye tilsættes 12 μl af blandingen og en gelelektroforese køres. 39

48 Transformation af gærceller 10 mg/ml enkeltstrenget DNA denatureres ved at koge i 5 minutter og kommes herefter på is. Derefter blandes i en eppendorftube: - 10 µl ssdna - 2 µl plasmid DNA Det enkeltstrengede DNA medvirker til indførelsen af plasmid DNA i gærcellerne. Der tilføjes 600 µl sterilt PEG/LiAc opløsning, hvorefter dette rystes i 10 sekunder, og blandingen inkuberes ved 30 C i 30 minutter ved rystning under 200 rounds per minute (rpm). I mellemtiden opvarmes en varmeblok til 42 C. 70 µl DMSO tilsættes, hvorefter der blandes forsigtigt. Blandingen gives et varmechok i 15 minutter ved 42 C og nedkøles på is efterfølgende et par minutter. Til sidst spinnes tuberne i 30 sekunder ved højeste hastighed. Overskydende væske hældes fra og cellerne renatureres ved at tilsætte 200 µl YPDA/kanamycin medie. Der pipetteres op og ned for at sikre, at det hele er opløst. 100 µl af opløsningen plades ud på DDO-agarplader uden Tryptofan, kommes i plastikposer og herefter i varmeskab ved 30 C i 3-5 dage. 40

49 Formering af gærceller Fra de to agarplader podes gærkolonier og kommes i separate eppendorftuber indeholdende 1 ml YPDA blanding. I alt skal der laves 13 formeringer og der forberedes 13 tuber med 25 µl af hver gærkoloni, som skal formeres sammen med 150 µl YPDA blanding, 25 µl AH109 culture og 25 µl Y187 culture. Tuberne står under rystning natten over. Gær-2-hybridsystem Hver formering plades ud på 2 agarplader. En DDO plade uden leucin og tryptofan og en QDOX plade uden leucin, tryptofan, histidin og adenin, men med X-gal. Disse står 3-5 dage, hvorefter resultaterne kan aflæses (se afsnit ) 41

50 17.3 Forsøg 2 fremgangsmåde Følgende beskriver fremgangsmåden for forsøget med stop-codon-mutationen, S305X. Da det kun er mutagenesen, der ikke indgår i fremgangsmåden for forsøg 1, er denne den eneste, som beskrives nøjagtigt i dette afsnit. Afvigelser fra forsøg 1 er indført i et afsnit efterfølgende. Site-directed mutagenese Frosne stoffer tøs op og i en PCR tube blandes: - 5 μl Pfu reaction buffer - 3 μl dobbeltstrenget vektor (pgbki7-ndrg2) - 1,25 μl mutagenic primer 1 (top) - 1,25 μl mutagenic primer 2 (bund) - 1 μl dntps - 37,5 μl ddh 2 O, således at total volumen er på 50 μl - 1 μl PfuUltra HF DNA polymerase tilsættes til sidst Tuben spinnes i få sekunder, så blandingen falder til bunds. Enzymerne bliver først taget ud, lige inden de skal bruges, så de bliver holdt inaktive så længe som muligt. Derefter skal tuben i en PCR maskine: Første gang på 95 C i 30 sekunder, 18 gange igennem følgende: 30 sekunder på 95 C 1 minut på 55 C 8 minutter på 68 C For at nedbryde de originale methylerede DNAstrenge tilsættes 1 μl DpnI, som er et restriktionsenzym, og til sidst inkuberes der 1 time ved 37 C. 42

51 Afvigelser fra forsøg 1 Transformationen af E. coli XL 10-Gold celler: S.O.C. medie benyttes i stedet for LB medie. Følgende plader forberedes: - Kontrol 1: 100 μl celler og kanamycin - Kontrol 2: 100 μl celler med pgbkt7-ndrg2 og kanamycin - Kontrol 3: 100 μl celler uden kanamycin - Test: 100 μl celler med pgbkt7-ndrg2-s305x - Rest: Celler med pgbkt7-ndrg2-s305x Skæring af plasmider med mutationer: Der tilsættes 14.5 µl H 2 O i stedet for 15 µl og 0.5 µl HindIII restriktionsenzym i stedet for 1 µl. Der tilsættes dermed 3 µl DNA i stedet for 2 µl, for at den totale volumen stadig er 20 µl. I den udførte gelelektroforese tilsættes 1 µl loading dye i stedet for 5 µl og 5 µl DNA i stedet for 12 µl Sekventering af psdm Følgende er en sekventering af psdm med T7 primer. De tre baser markeret med gul, angiver mutationens indførelse. Sequence results > _T of sequence CGCGATTCGCCCTTCTCGAGACCATGGCGGAGCTGCAGGAGGTGCAGATCACAGAGGAGA AGCCACTGTTGCCAGGACAGACGCCTGAGGCGGCCAAGACTCACTCTGTGGAGACACCAT ACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCCAAACGCCCAGCGATCCTTA CCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCACTGTTTCAGTTCGAGG ACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATGCCCCTGGAATGGAAG AGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGGACCAGCTTGCAGACA TGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTGGAGTTGGTGTTGGAG CTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCGGACACTGTTGAAGGTCTTG TCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGATTGGGCAGCCCACAAGGATA CAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACATCTTTTCAGCCAGGAAGAGC TCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATTACACATGCACCCAACC TGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAGACCTGAACTTTGAGC GTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAGGAGACCAAGCACCTC ATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCCAGACCTCGTTCCTCA AGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCAAGCTGACCGAGGCCT TCAAGTACTTCCTGCAAGGCATGGGCTACATGGCCTCATCCTGCATGACTCGCCTGTCCC GGTCTCGTACAGCC 43

52 17.5 Mislykkede forsøg Forsøg 1: L172D I første omgang er L172D forsøgt inkorporeret ved brug af site-directed mutagenese, Quick Change II. Transformation af E. coli Da der ikke er nogen vækst på de sidste to plader, er enten mutagenesen eller transformationen mislykket. Da kontrolforsøgene er gået som forventet, er det sandsynligvis mutagenesen, som ikke er udført korrekt. Af denne grund laves forsøg 1 igen fra starten, uden kontrol. Tabel 3 Transformation af E. coli XL Gold celler over forsøg 1 pgbkt- NDRG2 + kanamycin (kontrol 1) pgbkt- NDRG2 +kanamycin (kontrol 2) pgbkt- NDRG2 kanamycin (kontrol 3) pgbkt-ndrg2- L172D (100 µl) + kanamycin pgbkt-ndrg2- L172D (rest) + kanamycin Bakteriekolonier Delvis vækst Ingen Markant vækst Ingen vækst Ingen vækst Ved andet forsøg går transformationen som forventet, da der er vækst på de sidste to plader. Første skæring af pgbkt7-ndrg2-l172d Fragmenterne bør have størrelserne som ses i afsnit Som det ses i Figur 20 har fragmenterne de forventede størrelser. Da det ikke herudfra kan afgøres, om mutationen er indført, sendes plasmiderne til sekventering. Figur 20 Forventede fragmentstørrelser. Brøndene 1-6 viser de forventede fragmentstørrelser for mutationen L172D. 44

53 Sekventering af pgbkt7-ndrg2-l172d Sekventering viser, at L172D ikke er indført i plasmidet, da CTA ikke er muteret til GAT. Dette er markeret med gul i følgende resultat. Sequencing Summary Template Primer Status LeftClip RightClip Length T7 PASSED T7 PASSED T7 PASSED T7 PASSED T7 PASSED T7 PASSED Fasta sequences: 10 1_T of sequence GAGCAGAGCTGATCTCAGAGGAGGACCTGCATATGGCCATGGCGGAGCTGCAGGAGGTGC AGATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACGCCTGAGGCGGCCAAGACTCACT CTGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCCAAAC GCCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCAC TGTTTCAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATG CCCCTGGAATGGAAGAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGG ACCAGCTTGCAGACATGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTG GAGTTGGTGTTGGAGCTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCGGACA CTGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGATTGGG CAGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACATCTTT TCAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATTA CACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAG ACCTGAACTTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAG GAGACCAAGCACCTCATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCC AGACCTCGTTCCTCAAGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCA AGCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGCATGGGCTACATGGCCTCATCCTGCA TGACTCGCCTGTCCCGGTCTCGTACAGCCTCTCTGACCAGTGCAGCATCCGTGATGGCA 10 2_T of sequence GGACAGAGCTGATCTCAGAGGAGGACCTGCATATGGCCATGGCGGAGCTGCAGGAGGTGC AGATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACGCCTGAGGCGGCCAAGACTCACT CTGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCCAAAC GCCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCAC TGTTTCAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATG CCCCTGGAATGGAAGAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGG ACCAGCTTGCAGACATGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTG GAGTTGGTGTTGGAGCTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCGGACA CTGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGATTGGG CAGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACATCTTT TCAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATTA CACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAG 45

54 ACCTGAACTTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAG GAGACCAAGCACCTCATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCC AGACCTCGTTCCTCAAGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCA AGCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGCATGGGCTACATGGCCTCATCCTGCA TGACTCGCCTGTCCCGGTCTCGTACAGCCTCTCTGACCAGTGCAGCATCCGTTGATGGCA ACCGGTCCCGCTCTCGCA 10 3_T of sequence GACAGAGCTGATCTCAGAGGAGGACCTGCATATGGCCATGGCGGAGCTGCAGGAGGTGCA GATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACGCCTGAGGCGGCCAAGACTCACTC TGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCCAAACG CCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCACT GTTTCAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATGC CCCTGGAATGGAAGAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGGA CCAGCTTGCAGACATGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTGG AGTTGGTGTTGGAGCTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCGGACAC TGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGATTGGGC AGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACATCTTTT CAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATTAC ACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAGA CCTGAACTTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAGG AGACCAAGCACCTCATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCCA GACCTCGTTCCTCAAGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCAA GCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGCATGGGCTACATGGCCTCATCCTGCAT GACTCGCCTGTCCCGGTCTCGTACAGCCTCTCTGACCAGTGCAGCATCCGTTGATGGCAA CCGGGTCCCGCTCT 10 4_T of sequence GAGCAGAGCTGATCTCAGAGGAGGACCTGCATATGGCCATGGCGGAGCTGCAGGAGGTGC AGATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACGCCTGAGGCGGCCAAGACTCACT CTGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCCAAAC GCCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCAC TGTTTCAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATG CCCCTGGAATGGAAGAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGG ACCAGCTTGCAGACATGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTG GAGTTGGTGTTGGAGCTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCGGACA CTGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGATTGGG CAGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACATCTTT TCAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATTA CACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAG ACCTGAACTTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAG GAGACCAAGCACCTCATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCC AGACCTCGTTCCTCAAGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCA AGCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGCATGGGCTACATGGCCTCATCCTGCA TGACTCGCCTGTCCCGGTCTCGTACAGCCTCTCTGACCAGTGCAGCATCCGTTGATGGCA CCGGTCCCGCTCTCGCA 10 5_T of sequence AGCAGAGCTGATCTCAGAGGAGGACCTGCATATGGCCATGGCGGAGCTGCAGGAGGTGCA GATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACGCCTGAGGCGGCCAAGACTCACTC TGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCCAAACG CCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCACT GTTTCAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATGC CCCTGGAATGGAAGAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGGA CCAGCTTGCAGACATGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTGG AGTTGGTGTTGGAGCTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCGGACAC TGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGATTGGGC AGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACATCTTTT CAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATTAC ACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAGA 46

55 CCTGAACTTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAGG AGACCAAGCACCTCATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCCA GACCTCGTTCCTCAAGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCAA GCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGCATGGGCTACATGGGCCTCATCCTGCA TGACTCGCCTGTCCCGGTCTCGTAC 10 6_T of sequence GGACAGAGCTGATCTCAGAGGAGGACCTGCATATGGCCATGGCGGAGCTGCAGGAGGTGC AGATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACGCCTGAGGCGGCCAAGACTCACT CTGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCCAAAC GCCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAGCCAC TGTTTCAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTGGATG CCCCTGGAATGGAAGAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCTCTGG ACCAGCTTGCAGACATGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATAATTG GAGTTGGTGTTGGAGCTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCGGACA CTGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGATTGGG CAGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACATCTTT TCAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATCATTA CACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGCCGAG ACCTGAACTTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTGGTAG GAGACCAAGCACCTCATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCCACCC AGACCTCGTTCCTCAAGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCAGGCA AGCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGCATGGGCTACATGGGCCTCATCCTGC ATGACTCGCCTGTCCCGGTCTCGTACAGCCTCTCTGACCAGTGCAGCATCCGTGA Anden skæring af pgbkt7-ndrg2-l172d NDRG2-L172D er indført i pgbkt7 ved ligering, da mutagenesen ikke fungerede. Plasmidet skæres i første omgang fejlagtigt med de forkerte enzymer, XhoI og NcoI, og ikke HindIII som det burde. XhoI og NcoI bruges til at skære psdm, og ikke pgbkt7. Figur 21: Skæring af pgbkt7-ndrg2-l172d med XhoI og NcoI. Fragmenterne er ikke som forventet (se afsnit ) Der skæres efterfølgende med HindIII (se afsnit ). 47

56 Forsøg 2: S305X Gelektroforese af pgbkt7-ndrg2-s305x På gelelektroforesen (se Figur 22) ses ikke de fire restriktionsfragmenter som forventet. HindIII har ikke skåret ved 2204 bp, og mutationen er derfor ikke indført. Der foretages igen podning, Miniprep DNA, skæring og gelelektroforese, som viser et positivt resultat (se afsnit 12.2). Figur 22 Gelelektroforese af pgbkt7-ndrg2-s305x. Det ses at mutationen ikke er indført, da der ikke ses fire fragmenter i hver brønd. 48

To modeller af NDRG2 proteinet: RCSB Protein Data Bank

To modeller af NDRG2 proteinet: RCSB Protein Data Bank 2009 Roskilde Universitet Naturvidenskabelige Basisstudium 4. Semesters Projekt To modeller af NDRG2 proteinet: RCSB Protein Data Bank Bassam Tawfik Florian Malte Hermann Kenneth Ege Jørgensen Lena de

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Navn: Forsøgsvejledning Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA sekvens,

Læs mere

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres.

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres. Epigenetik Men hvad er så epigenetik? Ordet epi er af græsk oprindelse og betyder egentlig ved siden af. Genetik handler om arvelighed, og hvordan vores gener videreføres fra generation til generation.

Læs mere

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod.

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod. Gå op i røg Hvilke konsekvenser har rygning? Udfordringen Denne udfordring handler om nogle af de skader, der sker på kroppen, hvis man ryger. Du kan arbejde med, hvordan kulilten fra cigaretter påvirker

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares.

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. Bioteknologi A Studentereksamen Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. frs111-btk/a-31052011 Tirsdag den 31. maj 2011 kl. 9.00-14.00

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Oprensning af genomisk DNA fra plantemateriale Manual Katalog nr. 166-5005EDU explorer.bio-rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, februar 2009

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

kampen mod kemoterapiresistens

kampen mod kemoterapiresistens Brystkræft kampen mod kemoterapiresistens Af Ph.d. Sidsel Petersen, Biologisk Institut, Dette kapitel giver en introduktion til brystkræft og til behandling af denne kræftsygdom. Ligesom andre kræftsygdomme

Læs mere

Isolering af DNA fra løg

Isolering af DNA fra løg Isolering af DNA fra løg Formål: At afprøve en metode til isolering af DNA fra et levende væv. At anvende enzymer.. Indledning: Isolering af DNA fra celler er første trin i mange molekylærbiologiske undersøgelser.

Læs mere

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det.

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Samarbejde mellem gymnasier og Aarhus Universitet Bioteknologiske eksperimenter Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Denne øvelse er baseret på øvelseskittet:

Læs mere

1. Hvad er kræft, og hvorfor opstår sygdommen?

1. Hvad er kræft, og hvorfor opstår sygdommen? 1. Hvad er kræft, og hvorfor opstår sygdommen? Dette kapitel fortæller om, cellen, kroppens byggesten hvad der sker i cellen, når kræft opstår? årsager til kræft Alle levende organismer består af celler.

Læs mere

Intra- og intermolekylære bindinger.

Intra- og intermolekylære bindinger. Intra- og intermolekylære bindinger. Dipol-Dipol bindinger Londonbindinger ydrogen bindinger ydrofil ydrofob 1. Tilstandsformer... 1 2. Dipol-dipolbindinger... 2 3. Londonbindinger... 2 4. ydrogenbindinger....

Læs mere

Fra spild til penge brug enzymer

Fra spild til penge brug enzymer Fra spild til penge brug enzymer Køreplan 01005 Matematik 1 - FORÅR 2010 Denne projektplan er udarbejdet af Per Karlsson og Kim Knudsen, DTU Matematik, i samarbejde med Jørgen Risum, DTU Food. 1 Introduktion

Læs mere

Fotosyntetisk produktion af hydrogen med genmodificerede mikroorganismer

Fotosyntetisk produktion af hydrogen med genmodificerede mikroorganismer Fotosyntetisk produktion af hydrogen med genmodificerede mikroorganismer Forskerspirer 2009 Hovedområde: NAT Niels Christian Sanden ncsanden@hotmail.com Forskerkontakt: Poul Erik Jensen Værtsinstitution:

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet?

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Lyn dine gener op! En baglæns besked, gemt i 'backup-dna'et'

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Træning øger genbrug i museceller. Er det derfor, at motion er

Læs mere

Manuskriptvejledning pr. 2015 Bachelorprisen

Manuskriptvejledning pr. 2015 Bachelorprisen Manuskriptvejledning pr. 2015 Bachelorprisen Fremsendelse af artikel Artikler skrevet på baggrund af bachelorprojekter, der er afleveret og bestået på det annoncerede tidspunkt, kan deltage i konkurrencen

Læs mere

Elevnavn: Elevnummer: Skole: Hold:

Elevnavn: Elevnummer: Skole: Hold: Folkeskolens afgangsprøve Maj 2011 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/23 B3 Indledning Bioteknologi Teknikker som for eksempel gensplejsning anvendes i

Læs mere

Komplementsystemets fysiologi og patofysiologi. Søren Hansen, Cancer og Inflammationsforskning, WP21-1, SHansen@health.sdu.dk

Komplementsystemets fysiologi og patofysiologi. Søren Hansen, Cancer og Inflammationsforskning, WP21-1, SHansen@health.sdu.dk Komplementsystemets fysiologi og patofysiologi C3 Søren Hansen, Cancer og Inflammationsforskning, WP21-1, SHansen@health.sdu.dk Detaljeret - aktiveringsmekanismer - opbygning - effektorfunktioner (incl.

Læs mere

Lærervejledning Til internet-spillet Kræftkampen og undervisningshæftet Hvorfor opstår kræft? Biologi 8.-9. klasse

Lærervejledning Til internet-spillet Kræftkampen og undervisningshæftet Hvorfor opstår kræft? Biologi 8.-9. klasse kraeftkampen.dk Kræftens Bekæmpelse Lærervejledning Til internet-spillet Kræftkampen og undervisningshæftet Hvorfor opstår kræft? Biologi 8.-9. klasse Hvorfor arbejde med Kræft? Erhvervsskolernes Forlag

Læs mere

Folkeskolens afgangsprøve August 2007 Biologi Facitliste

Folkeskolens afgangsprøve August 2007 Biologi Facitliste Folkeskolens afgangsprøve August 2007 1/23 B5 Indledning Den danske skov Ca. 12 % af Danmarks areal er dækket af skov. Det mest almindelige skovtræ er rødgran. Det skyldes, at de danske skove er produktionsskove,

Læs mere

Livets molekylære kode

Livets molekylære kode 4. ÅR R. 2 / 2006 Livets molekylære kode -kemi og biologi mødes D livets molekylære kode D findes i alle levende organismer og indeholder koden til organismen informationer, der afgør om organismen er

Læs mere

Folkeskolens afgangsprøve Maj 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B3

Folkeskolens afgangsprøve Maj 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B3 Folkeskolens afgangsprøve Maj 2012 B3 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B3 afgangsprøver maj 2012 Sæt 3 Levende organismers udvikling og livsytringer

Læs mere

Kemi Lærebog: H. Mygind, Kemi 2000 A-niveau 1 & 2

Kemi Lærebog: H. Mygind, Kemi 2000 A-niveau 1 & 2 Molekylær Biomedicin A 1. semester Seneste revision: september 2004 Kemi Lærebog: H. Mygind, Kemi 2000 A-niveau 1 & 2 1) Genkende det periodiske system og de vigtigste grundstoffer. 2) Angive vigtige salte,

Læs mere

Struktur og funktion af gener

Struktur og funktion af gener Molekylærbiologi og genetik S4, F2008 f Malene Munk Jørgensen Emne: Struktur og funktion af gener Link: undervisningsplanen for S4-molekylærbiologi og genetik MMJ, VI niversity ollege Bioanalytikeruddannelsen

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Sommereksamen 2015 Institution 414 Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold HFe Biologi B Torben

Læs mere

Studieplan for Naturvidenskabelig Faggruppe, 2015-16

Studieplan for Naturvidenskabelig Faggruppe, 2015-16 Studieplan for Naturvidenskabelig Faggruppe, 2015-16 Forløb 1: Intro & Metode Introduktion til Naturvidenskabelig Faggruppe, naturvidenskabelig metode og til fagene. Hvordan arbejder man naturvidenskabeligt?

Læs mere

Oste-kemi. Størstedelen af proteinerne i mælken findes som små kugleformede samlinger, kaldet miceller.

Oste-kemi. Størstedelen af proteinerne i mælken findes som små kugleformede samlinger, kaldet miceller. Man behøver ikke at sætte sig ind i de mere tekniske eller kemiske forhold for at lave ost selv, men for dem som gerne vil vide mere om hvad der grundlæggende sker ved forvandlingen af mælk til ost, så

Læs mere

Om nedarvede gener, der øger kræftrisikoen

Om nedarvede gener, der øger kræftrisikoen 11. Arv og kræft Om nedarvede gener, der øger kræftrisikoen Dette kapitel fortæller, at man kan være arveligt disponeret for at udvikle kræft at nedarvede mutationer kan øge risikoen for brystkræft at

Læs mere

How to do in rows and columns 8

How to do in rows and columns 8 INTRODUKTION TIL REGNEARK Denne artikel handler generelt om, hvad regneark egentlig er, og hvordan det bruges på et principielt plan. Indholdet bør derfor kunne anvendes uden hensyn til, hvilken version

Læs mere

- Få mest muligt ud af opgaveskrivningen!

- Få mest muligt ud af opgaveskrivningen! - Få mest muligt ud af opgaveskrivningen! En eksamensopgave Forarbejdet Opgaveformuleringen Disposition og layout Dokumentation Selvstændighed Abstract Vurderingskriterier Alle regler står i pjecen om

Læs mere

Spørgsmål nr.1. Evolutionsteorien fra Lamarck til Darwin. Spørgsmål nr.2. Menneskets evolution. Spørgsmål 3. Diabetes

Spørgsmål nr.1. Evolutionsteorien fra Lamarck til Darwin. Spørgsmål nr.2. Menneskets evolution. Spørgsmål 3. Diabetes Spørgsmål nr.1 Evolutionsteorien fra Lamarck til Darwin I din fremlæggelse skal du redegøre for Lamarck s og Darwins teori om livets udvikling. Fremhæv væsentlige forskelle imellem teorierne, nævn gerne

Læs mere

Syv transmembrane receptorer

Syv transmembrane receptorer Syv transmembrane receptorer Receptoren som kommunikationscentral Cellemembranen definerer grænsen mellem en celles indre og ydre miljø, der er meget forskelligt. Det er essentielt for cellens funktion

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold.

Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold. Vurdering af hygiejniseringseffekten af nedsivning af viral hæmorrhagisk septikæmi virus (VHSV) under eksperimentelle forhold. Juni 2011 Helle Frank Skall og Niels Jørgen Olesen Veterinærinstituttet, Danmarks

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

Kresten Cæsar Torp Supplerende materiale til Biokemibogen liv, funktion, molekyle

Kresten Cæsar Torp Supplerende materiale til Biokemibogen liv, funktion, molekyle BIOINFORMATIK Kresten Cæsar Torp Supplerende materiale til Biokemibogen liv, funktion, molekyle indhold DNA 2 Hvilke databaser skal man vælge? 2 Søgning på en nukleotidsekvens 2 Proteiner 4 Søgning på

Læs mere

Resultat af Ærteforsøg 2010

Resultat af Ærteforsøg 2010 Resultat af Ærteforsøg 2010 Ved et kursus på Institut for Jordbrug og Økologi, KU Life, blev dette ærteforsøg gennemført, med undervisning af Gunter Backes og Jihad Orabi. Skrevet af Søren Holt Frøsamlerne

Læs mere

May the force be with you

May the force be with you May the force be with you Esben Thormann, Department of Chemistry, Surface Chemistry, Royal Institute of Technology, Stockholm. Adam C. Simonsen og Ole G. Mouritsen, MEMPHYS-Center for Biomembran fysik,

Læs mere

BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER

BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER BIOZYMER ØVELSE 2 OPRENSNING AF PROTEINER FAGLIG BAGGRUND Det forudsættes, at den grundlæggende teori bag rekombinant protein ekspression og proteinopresning er bekendt. For dette henvises til undervisningsmateriale

Læs mere

Børsteormene Marenzelleria

Børsteormene Marenzelleria Børsteormene Marenzelleria - PCR optimering i forbindelse med identifikation af siblingearter Roskilde Universitet 2011 Bachelor projekt Safa Maarouf og Nanna Høegh Jensen. Samarbejde med Jasna Mozina

Læs mere

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse www.volvoxdk.dk C. Girnth-Diamba og B. Fahnøe, 2010 Claudia Girnth-Diamba og Bjørn Fahnøe Solrød Gymnasium, Solrød Center 2 DK 2680 Solrød Strand, Denmark E: sgcg@solgym.dk og sgbf@solgym.dk Plasmidoprensning

Læs mere

Folkeskolens afgangsprøve December 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B4

Folkeskolens afgangsprøve December 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B4 Folkeskolens afgangsprøve December 2012 B4 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B4 afgangsprøver december 2012 Sæt 4 Evolution og udvikling Det er cirka

Læs mere

Fødevarer er mere end mad

Fødevarer er mere end mad 10 A k t u e l N a t u r v i d e n s k a b 2 2 0 0 5 E R N Æ R I N G S B I O L O G I Fødevarer er mere end mad Fødevarer kan indeholde stoffer, der virker forebyggende på f.eks. kræft. Jagten på sådanne

Læs mere

Appendiks 6: Universet som en matematisk struktur

Appendiks 6: Universet som en matematisk struktur Appendiks 6: Universet som en matematisk struktur En matematisk struktur er et meget abstrakt dyr, der kan defineres på følgende måde: En mængde, S, af elementer {s 1, s 2,,s n }, mellem hvilke der findes

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Fosfodiesterase-hæmmere: nyt HSlægemiddel

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Fosfodiesterase-hæmmere: nyt HSlægemiddel Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Fosfodiesterase-hæmmere: nyt HSlægemiddel testes snart CHDI og Pfizer annoncerer spændende dyreforskning

Læs mere

Sådan indlægges nyheder på DSqF s hjemmeside trin for trin

Sådan indlægges nyheder på DSqF s hjemmeside trin for trin Sådan indlægges nyheder på DSqF s hjemmeside trin for trin Systemkrav For at kunne bruge Composite kræves: Windows 95 eller nyere (bemærk - kun Windows kan bruges) Browseren Internet Explorer 6.0 eller

Læs mere

Væskers bevægelse i kapillarrør

Væskers bevægelse i kapillarrør Væskers bevægelse i kapillarrør Morten Christensen & Adam Cohen Simonsen Januar 2011 Indledning Denne øvelsesvejledning beskriver 1 øvelse, der er en del af det tilbud der gives til Gymnasie-, HF- og HTXklasser

Læs mere

Multiresistente bakterier

Multiresistente bakterier Multiresistente bakterier en trussel mod mennesket Af molekylær biomedicin-studerende Lise Barlebo Ahlborn, videnskabsformidler Helle Blæsild og lektor Birthe B. Kragelund, Biologisk Institut. Tak til

Læs mere

De livsvigtige vitaminer og mineraler af John Buhl www.nomedica.dk

De livsvigtige vitaminer og mineraler af John Buhl www.nomedica.dk 5 Indholdsfortegnelse Forord 6 Indledninig 7 Lidt grundlæggende om vitaminer og mineraler 8 De enkelte vitaminer og mineraler 15 De fedtopløselige vitaminer (A, D, E og K) 16 A-vitamin 16 D-vitamin 19

Læs mere

MINDFULNESS KAN AFHJÆLPE STRESS

MINDFULNESS KAN AFHJÆLPE STRESS HVAD VIRKER? EVIDENS OM EFFEKTER NR. 01 2012 Artiklen bygger på denne Campbell forskningsoversigt: de Vibe, M., Bjorndal, A., Tipton, E., Hammerstrom, K., Kowalski, K.: Mindfulness Based Stress Reduction

Læs mere

5. Celler, der deler sig

5. Celler, der deler sig 5. Celler, der deler sig Kræft er en cellecyklussygdom Dette kapitel fortæller, hvad restriktionspunktet er hvorfor kræft kaldes en cellecyklussygdom hvorfor genterapi måske bliver fremtidens behandling

Læs mere

Effektiv søgning på web-steder

Effektiv søgning på web-steder Effektiv søgning på web-steder 7. maj 1998 Udarbejdet af DialogDesign ved Rolf Molich, Skovkrogen 3, 3660 Stenløse Indhold 1. Indledning 3 1.1. Model for søgning 3 2. Forskellige former for søgning 4 2.1.

Læs mere

De fremstillede transformerede kloner kan eventuel analyseres som beskrevet i punkt C.

De fremstillede transformerede kloner kan eventuel analyseres som beskrevet i punkt C. 11. juni UVM sags nr. 166.471.021 AT jnr. 20050002257 Aftale mellem Undervisningsministeriet og Arbejdstilsynet om retningslinjer for godkendte forsøg med genteknologi i henhold til Bekendtgørelse om genteknologi

Læs mere

CASPER DAUGAARD DESFEUX RYSLINGE ALLÉ 34 2770 KASTRUP 1.W, NØRRE GYMNASIUM

CASPER DAUGAARD DESFEUX RYSLINGE ALLÉ 34 2770 KASTRUP 1.W, NØRRE GYMNASIUM CASPER DAUGAARD DESFEUX RYSLINGE ALLÉ 34 2770 KASTRUP 1.W, NØRRE GYMNASIUM INDHOLDSFORTEGNELSE INDHOLDSFORTEGNELSE...SIDE 2 - Her er du nu! INDLEDNING...SIDE 3 - Her finder du en præsentation af, hvad

Læs mere

Studiespørgsmål til celler og væv

Studiespørgsmål til celler og væv Studiespørgsmål til celler og væv 1. Hvad er en celle og hvad vil det sige, at den har et stofskifte? 2. Tegn en figur af en celle og navngiv, på figuren, de vigtigste organeller. Hvad er navnet på den

Læs mere

Undervisningsbeskrivelse for STX 2m Kemi B

Undervisningsbeskrivelse for STX 2m Kemi B Undervisningsbeskrivelse for STX 2m Kemi B Termin Afslutning i juni skoleår 13/14 Institution Marie Kruses Skole Uddannelse Fag og niveau Lærer(e) Hold STX Kemi A valgfag Hasse Bonde Rasmussen 3gKE Denne

Læs mere

Nr 1. Fra gen til protein

Nr 1. Fra gen til protein Nr 1 Fra gen til protein Med udgangspunkt i vedlagte illustrationer bedes du besvare følgende: Hvordan er sammenhængen mellem DNA ets nukleotider og proteinets aminosyrer? Beskriv hvad der sker ved henholdsvis

Læs mere

Programmering C Eksamensprojekt. Lavet af Suayb Köse & Nikolaj Egholk Jakobsen

Programmering C Eksamensprojekt. Lavet af Suayb Köse & Nikolaj Egholk Jakobsen Programmering C Eksamensprojekt Lavet af Suayb Köse & Nikolaj Egholk Jakobsen Indledning Analyse Læring er en svær størrelse. Der er hele tiden fokus fra politikerne på, hvordan de danske skoleelever kan

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Dæmpning af immunsystemet hjælper HSmus

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Dæmpning af immunsystemet hjælper HSmus Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Dæmpning af immunsystemet hjælper HSmus CB2-aktiverende lægemiddel forbedrer overlevelse og symptomer

Læs mere

Seksuelle krænkeres barrierer

Seksuelle krænkeres barrierer Seksuelle krænkeres barrierer - mod at gennemføre et seksuelt overgreb på et barn Af psykolog Kuno Sørensen / Red Barnet Fire forhåndsbetingelser Det er en udbredt misforståelse, at seksuelle overgreb

Læs mere

Matematik i AT (til elever)

Matematik i AT (til elever) 1 Matematik i AT (til elever) Matematik i AT (til elever) INDHOLD 1. MATEMATIK I AT 2 2. METODER I MATEMATIK OG MATEMATIKKENS VIDENSKABSTEORI 2 3. AFSLUTTENDE AT-EKSAMEN 3 4. SYNOPSIS MED MATEMATIK 4 5.

Læs mere

Kemi Kulhydrater og protein

Kemi Kulhydrater og protein Kemi Kulhydrater og protein Formål: Formålet med forsøget er at vise hvordan man kan påvise protein, fedtstof, simple sukkerarter eller stivelse i forskellige fødevarer. Samtidig kan man få en fornemmelse

Læs mere

Roskilde Tekniske Gymnasium. Eksamensprojekt. Programmering C niveau

Roskilde Tekniske Gymnasium. Eksamensprojekt. Programmering C niveau Roskilde Tekniske Gymnasium Eksamensprojekt Programmering C niveau Andreas Sode 09-05-2014 Indhold Eksamensprojekt Programmering C niveau... 2 Forord... 2 Indledning... 2 Problemformulering... 2 Krav til

Læs mere

Gensplejsning af byg uden brug af selektionsgener

Gensplejsning af byg uden brug af selektionsgener Gensplejsning af byg uden brug af selektionsgener Genetisk modificerede planter indeholder som regel gener, som gør planten modstandsdygtig overfor enten et ukrudtsmiddel eller et antibiotikum. Disse gener,

Læs mere

Artikel 2: Kulhydratkemi

Artikel 2: Kulhydratkemi Artikel 2: Kulhydratkemi Kulhydrater dannes i planter ved hjælp af fotosyntese og er en vigtig kilde til ernæring for mennesket. Navnet kulhydrat dækker over en række forskellige sukkerarter, som inddeles

Læs mere

UNDERVISNINGSBESKRIVELSE

UNDERVISNINGSBESKRIVELSE UNDERVISNINGSBESKRIVELSE Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Juni, 14/15 Institution Horsens HF og VUC Uddannelse HF 2-årigt Fag og niveau Naturfag Biologi C Lærer(e)

Læs mere

MEDICINSK MIKROBIOLOGI OG INFEKTIONSPATOLOGI Biologisk del

MEDICINSK MIKROBIOLOGI OG INFEKTIONSPATOLOGI Biologisk del Studiespørgsmål Kapitel 2. Almen mikrobiologi 1 Nævn hvilke grupper der findes af humanpatogene organismer. 2 Hvilke af disse grupper er mikroskopiske? 3 Hvad er forskellen på eukaryote og prokaryote organismer?

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2014 Institution Uddannelse Fag og niveau Lærer Hold VUC Skive-Viborg HFe Kemi C Maria Ji Sigby-Clausen

Læs mere

Protein identifikation ved hjælp af Matrix- Assisted Laser Desorption Masse Spektrometri (MALDI-MS).

Protein identifikation ved hjælp af Matrix- Assisted Laser Desorption Masse Spektrometri (MALDI-MS). Teori til elevforløb på Institut for Biokemi og Molekylærbiologi på Syddansk Universitet: Protein identifikation ved hjælp af Matrix- Assisted Laser Desorption Masse Spektrometri (MALDI-MS). Peter Windfeldt

Læs mere

Mere energi med dette nye produkt fra Lifewave.

Mere energi med dette nye produkt fra Lifewave. Mere energi med dette nye produkt fra Lifewave. Mere energi, genopretter energi flowet i kroppen. Nem at placere, se brochure Resultater med det samme. Giver op til 20 % mere energi. Øger kroppens forbrænding.

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Termin maj-juni 13/14 Institution Favrskov Gymnasium Uddannelse Fag og niveau Lærer stx bic Hans Jørgen Madsen Hold 2.s Oversigt over gennemførte undervisningsforløb Titel 1 Titel

Læs mere

1. EN NY TIDS TEKNOLOGI... 3 2. NOVO GRUPPENS BRUG AF GENTEKNOLOGI... 3 Derfor anvender vi genteknologi... 4 Vigtig erfaring med genteknologi...

1. EN NY TIDS TEKNOLOGI... 3 2. NOVO GRUPPENS BRUG AF GENTEKNOLOGI... 3 Derfor anvender vi genteknologi... 4 Vigtig erfaring med genteknologi... . 1. EN NY TIDS TEKNOLOGI... 3 2. NOVO GRUPPENS BRUG AF GENTEKNOLOGI... 3 Derfor anvender vi genteknologi... 4 Vigtig erfaring med genteknologi... 4 Etiske overvejelser... 4 Dialog med omverdenen... 4

Læs mere

Kortlægning af interaktion mellem IFN λ3 og IL- 10R2

Kortlægning af interaktion mellem IFN λ3 og IL- 10R2 Kortlægning af interaktion mellem IFN λ3 og IL- 10R2 Et eksperimentelt bachelor projekt i molekylærbiologi Af Sanne Ea Jørgensen 20084660 Ved associated professor Rune Hartmann Molekylærbiologisk institut

Læs mere

Biotechnology Explorer GMO analyse Kit

Biotechnology Explorer GMO analyse Kit 1 Biotechnology Explorer GMO analyse Kit Katalog nr.166-2500edu www.biorad.com Oversat og bearbejdet af Birgit Sandermann Justesen december 2005 - revideret februar 2010 Bemærk: Kittet indeholder temperaturfølsomme

Læs mere

Folkeskolens afgangsprøve Maj 2010 Biologi - Facitliste

Folkeskolens afgangsprøve Maj 2010 Biologi - Facitliste Folkeskolens afgangsprøve Maj 2010 1/23 B3 Indledning Mennesket Menneskets krop består af forskellige organer, som er opbygget af levende celler. Organerne er afhængige af hinanden og påvirker hinanden

Læs mere

NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON

NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON De sidste 5 års store teknologiske gennembrud har gjort, at vi i dag nemt og økonomisk

Læs mere

Re- eksamen 2014. Det hæmatologiske system og immunsystemet Bacheloruddannelsen i Medicin/Medicin med industriel specialisering. kl. 09.00-11.

Re- eksamen 2014. Det hæmatologiske system og immunsystemet Bacheloruddannelsen i Medicin/Medicin med industriel specialisering. kl. 09.00-11. 1/10 Re- eksamen 2014 Titel på kursus: Uddannelse: Semester: Eksamensdato: Tid: Bedømmelsesform Det hæmatologiske system og immunsystemet Bacheloruddannelsen i Medicin/Medicin med industriel specialisering

Læs mere

Proteinelektroforese af GFP Suppleringskit til pglo

Proteinelektroforese af GFP Suppleringskit til pglo Proteinelektroforese af GFP Suppleringskit til pglo Katalognummer nr. 166 0013EDU www.bio rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, Nærum Hovedgade 30, 2850 Nærum Birgitjustesen@gmail.com

Læs mere

Aflevering og udformning af rapporter fra laboratoriekurser pa VUC A rhus

Aflevering og udformning af rapporter fra laboratoriekurser pa VUC A rhus Aflevering og udformning af rapporter fra laboratoriekurser pa VUC A rhus Aflevering af rapporter Antallet af rapporter, der skal afleveres varierer fra fag til fag, så dette vil I blive informeret om

Læs mere

3.g Titel 7 Infektionsbiologi, antibiotika, allergi og autoimmune sygdomme/diabetes

3.g Titel 7 Infektionsbiologi, antibiotika, allergi og autoimmune sygdomme/diabetes Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin August 2014 juni 2016 Institution Københavns tekniske Skole Htx-Vibenhus Uddannelse Htx Fag og niveau Valgfag

Læs mere

Ny karakterskala nye mål?

Ny karakterskala nye mål? Ny karakterskala nye mål? Workshop Camilla Rump Lene Møller Madsen Mål for workshoppen Efter workshoppen skal deltagerne kunne Lave en operationel mål- og kriteriebeskrivelse af 12-tallet og 2-tallet for

Læs mere

Emneopgave: Lineær- og kvadratisk programmering:

Emneopgave: Lineær- og kvadratisk programmering: Emneopgave: Lineær- og kvadratisk programmering: LINEÆR PROGRAMMERING I lineær programmering løser man problemer hvor man for en bestemt funktion ønsker at finde enten en maksimering eller en minimering

Læs mere

Projekt - Visual Basic for Applications N på stribe

Projekt - Visual Basic for Applications N på stribe Projekt - Visual Basic for Applications N på stribe Mikkel Kaas og Troels Henriksen - 03x 3. november 2005 1 Introduktion Spillet tager udgangspunkt i det gamle kendte 4 på stribe, dog med den ændring,

Læs mere

Test'af'EML4.ALK'fusion'i'lungeadenokarcinom.

Test'af'EML4.ALK'fusion'i'lungeadenokarcinom. Test'af'EML4.ALK'fusion'i'lungeadenokarcinom. Anbefalingerne udarbejdede af: Overlæge,Dr.Med.BirgitGuldhammerSkov.BispebjergHospital,PatologiskAfdeling. Professor,overlægeMogensVyberg.AalborgUniversitetshospital,PatologiskInstitut.

Læs mere

Dansk referat. Dansk Referat

Dansk referat. Dansk Referat Dansk referat Stjerner fødes når store skyer af støv og gas begynder at trække sig sammen som resultat af deres egen tyngdekraft (øverste venstre panel af Fig. 6.7). Denne sammentrækning fører til dannelsen

Læs mere

Maple. Skærmbilledet. Vi starter med at se lidt nærmere på opstartsbilledet i Maple. Værktøjslinje til indtastningsområdet. Menulinje.

Maple. Skærmbilledet. Vi starter med at se lidt nærmere på opstartsbilledet i Maple. Værktøjslinje til indtastningsområdet. Menulinje. Maple Dette kapitel giver en kort introduktion til hvordan Maple 12 kan benyttes til at løse mange af de opgaver, som man bliver mødt med i matematiktimerne på HHX. Skærmbilledet Vi starter med at se lidt

Læs mere

Betydning af revision af en DS/EN ISO standard

Betydning af revision af en DS/EN ISO standard By- og Landskabsstyrelsens Referencelaboratorium Betydning af revision af en DS/EN ISO standard Bestemmelser af total cyanid og fri cyanid i vand med flow analyse By- og Landskabsstyrelsen Rapport Juni

Læs mere

Slutrapport. Titel DNA-markører til forældreudvalg

Slutrapport. Titel DNA-markører til forældreudvalg Slutrapport Titel DNA-markører til forældreudvalg Projektansvarlig og deltagere Projektansvarlig: Hanne Grethe Kirk, Landbrugets Kartoffelfond (LKF), Grindstedvej 55, DK-7184 Vandel, tlf. +45 7588 5533,

Læs mere

Tak for kaffe! 17-10-2004 Tak for kaffe! Side 1 af 16

Tak for kaffe! 17-10-2004 Tak for kaffe! Side 1 af 16 Tak for kaffe! Jette Rygaard Poulsen, Frederikshavn Gymnasium og HF-kursus Hans Vestergaard, Frederikshavn Gymnasium og HF-kursus Søren Lundbye-Christensen, AAU 17-10-2004 Tak for kaffe! Side 1 af 16 Tak

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Juni 2014/15 Institution Horsens HF og VUC Uddannelse Fag og niveau Lærer(e) Hold Hfe Biologi B, Stx Marianne

Læs mere

Baggrundsnotat: Lærernes gymnasiekarakterer og elevernes eksamensresultater

Baggrundsnotat: Lærernes gymnasiekarakterer og elevernes eksamensresultater 17. december 2013 Baggrundsnotat: Lærernes gymnasiekarakterer og elevernes eksamensresultater Dette notat redegør for den økonometriske analyse af betydningen af grundskolelæreres gennemsnit fra gymnasiet

Læs mere

C V C. Vejledning i brug af Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014

C V C. Vejledning i brug af Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014 DOT131v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Side 1 af 7 Vejledning i brug af Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revision 2 Juli 2014 DOT131v1

Læs mere

Nonspecikke faktorer i terapeutisk behandling

Nonspecikke faktorer i terapeutisk behandling Nonspecikke faktorer i terapeutisk behandling Line Brink-Jensen kandidat i musikterapi, juni 2010. Kontakt: line.brink.jensen@gmail.com Fokus Denne artikel er baseret på mit kandidatspeciale (Brink-Jensen,

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Institution Uddannelse Fag og niveau Lærer(e) Termin hvori undervisningen afsluttes: Maj-juni 2012 ZBC Ringsted

Læs mere

Folkeskolens afgangsprøve December 2010 Biologi Facitliste

Folkeskolens afgangsprøve December 2010 Biologi Facitliste Folkeskolens afgangsprøve December 2010 Biologi Facitliste 1/23 B4 Indledning Pattedyr Pattedyrs krop består af levende celler. Blandt andet chimpanser, heste og mennesker hører til pattedyrene. Cellerne

Læs mere