Danmarks Tekniske Universitet

Save this PDF as:

Størrelse: px
Starte visningen fra side:

Download "Danmarks Tekniske Universitet"


1 Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 26/ Kursus navn: Kursus nr Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle opgaver. Kursusansvarlig Thomas Nordahl Petersen

2 Side 2 of Eksamen Januar 2012 Dette sæt indeholder 5 opgaver (side 1-14) check at du har alle sider. Opgave 1 UniProt og genbank (15%) Opgave 2 DNA, læseramme og intron/exon (20%) Opgave 3 Bedste alignment (15%) Opgave 4 Parvis alignment (25%) Opgave 5 Genotype og fænotype (25%) En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan 6. Svar til opgavesættet kan skrives enten i rå tekst (fx i JEdit) eller i et tekstbehandlingprogram såsom Microsoft Word. Gyldige formater er.txt,.doc,.docx og.rtf. Vi foretrækker dog at du benytter Microsoft Word. Svaret skal uploades på CampusNet under kursus (under "Opgaver -> bioinformatik-eksamen2012"). Husk at gemme seneste version af dokumentet inden du uploader svaret. Når du afleverer får du en kode som skal skrives i feltet "Afleveringskode" nedenfor. VIGTIGT: Dit studienummer skal fremgå af filnavnet (fx. s doc eller s txt) og skal også stå i starten af dokumentet (fx: "Studienummer: s022717") Udfyld denne forside og aflever den til eksamensvagten. Navn: Studienummer: Afleveringskode:

3 Side 3 of 14 Ang. brug af Internettet Trådløst internet: Du skal koble dig på det helt normale DTU Wireless system. Online materialer: Linksamlingen til bioinformatik serverne findes via kursets lektionsplan. BEMÆRK: I er ikke begrænset til kun de links der findes her det er tilladt at søge information andetsteds. Det er IKKE tilladt at kommunikere med andre over nettet under eksamen. Sluk telefonen. Der vil blive taget stikprøver af netværkstrafikken for at sikre dette. Hvad gør man hvis en web-server ikke virker: 1) Verificer at input-data er i korrekt format. Forkert inputdata er i næsten alle tilfælde årsagen til problemet. 2) Prøv evt. at finde en alternativ server med samme funktion (Google). 3) Rapporter fejlen til eksamensvagten - den kursusansvarlige vil så blive tilkaldt. HUSK altid: Don t panic Held og lykke med eksamenen. -Thomas

4 Side 4 of 14 Opgave 1 UniProt og genbank (15%) Uniprot er en database som indeholder informationer om proteinsekvenser fra mange forskellige organismer. I det følgende skal du kun finde informationer for proteiner fra menneske (Kaldet: Human eller Homo sapiens ). 1. Find vha Uniprot databasen og søgemetoden Advanced Search ud af hvor mange proteiner som kommer fra organismen Homo sapiens (Taxonomy = 9606) og som har status som reviewed? 2. For det sæt af sekvenser du fandt i spørgsmål 1, dvs dem med status reviewed skal du skrive Entry name og sekvenslængde for henholdsvis det længste og korteste protein? 3. Fortsæt med de samme sekvenser fra spørgsmål 1 og benyt igen Advanced search til af finde ud af hvor mange proteinsekvenser der er annoteret med et signalpeptid? 4. Find nu sekvensen med Entry name AFAM_HUMAN og skriv 3- bogstavskoderne for de første fire aminosyrer i det modne protein (Engelsk: mature protein) dvs efter signalpeptidet er klippet fra? 5. Når man søger information om et protein benytter man uniprot databasen som i de foregående spørgsmål, mens man benytter databasen genbank for at få information om bla. DNA/mRNA nukleotidsekvenser. Genet under navnet NM_ koder for proteinsekvensen fra det foregående spørgsmål. Hvor mange exons er der i genet NM_001133?

5 Side 5 of 14 Opgave 2 DNA, læseramme og intron/exon (20%) 1. Både DNA og RNA består af hver 4 forskellige kernebaser. Tre af kernebaserne findes i både DNA og RNA. Skriv 1-bogstavskoderne for disse tre kernebaser. 2. En åben læseramme kaldes på engelsk Open Reading Frame (ORF), som er et genomisk stykke DNA som starter med et startkodon og slutter med et stopkodon, begge i samme læseramme. Skriv standard genetiske koder for startkodon og alle stopkodons. 3. Herunder er et hypotetisk stykke genomisk DNA som starter på position 1 og slutter på position 70. Indenfor disse grænser findes et enkelt hypotetisk gen. Du skal lede efter en åben læseramme kaldet en ORF og du skal kun kigge i positive læserammer. a. Hvad er den første position i ORF en og hvad er kodon? b. Hvad er den sidste position i ORF en og hvad er kodon? c. Hvilken læseramme findes genet i? NB! Som hjælp er positionen angivet oven over sekvensen således at position 10 er et A, 20 et G osv GTATGGTGGATACCCAGCTGGTTTGTGTGGAGAGGCGCCCAGGGGAATATACAGCGGAAATAGAGGTCGT

6 Side 6 of Der findes et enkelt intron indenfor den ORF du fandt i spørgsmål 3a og 3b. De første 2 nukleotider i et intron er næsten altid GT og kaldes et donor site (Figur 1) og de sidste to nukleotider i et intron er AG og kaldes et acceptor site (Figur 2). Sekvensen fra spørgsmål 3 er vist igen herunder. Figur 1 og 2 er vist på næste side GTATGGTGGATACCCAGCTGGTTTGTGTGGAGAGGCGCCCAGGGGAATATACAGCGGAAATAGAGGTCGT Man har fundet ud af at donor site er GT på positionerne 21 og 22. a. Hvor mange nukleotider er der i den kodende del af det første exon? Der er mange mulige positioner som starter med AG og dermed et potentielt acceptor site. Tre af dem (AC1, AC2 og AC3) er vist herunder: AC1: Acceptor site AG position 31 og 32 AC2: Acceptor site AG position 33 og 34 AC3: Acceptor site AG position 41 og 42 b. Hvilket ene acceptor site: AC1, AC2 eller AC3 kan være korrekt og hvorfor?

7 Side 7 of 14 Figur 1. Exon slutter på position -1 og intron starter fra position 0. Figur 2. Intron slutter på position -1 og exon starter fra position 0.

8 Side 8 of 14 Opgave 3 Bedste alignment (15%) Herunder er givet 2 alignments og du skal beregne alignmentscoren ved hjælp af en BLOSUM50 scoringsmatrix og værdierne herunder for første gap (Engelsk: Gap opening) og næste gap (Engelsk: Gap extension). Husk at skrive mellemregninger og ikke bare et enkelt tal. BLOSUM50 substitution matrix: A 5 R -2 7 N D C Q E G H I L K M F P S T W Y V A R N D C Q E G H I L K M F P S T W Y V Første gap: -10 Næste gap: -1 Alignment A: CTTHIKLMAAILLVY :: :: : :: CTSHI---KLML-VY 1. Hvad er alignmentscoren for Alignment A? Alignment B: CTTHIKLMAAILLVY :: ::::: ::: CTSHIKLM----LVY 2. Hvad er alignmentscoren for Alignment B? 3. Hvilken af de 2 alignments er bedst A eller B (begrund svaret)?

9 Side 9 of 14 Opgave 4 Parvis alignment (25%) Herunder er to proteinsekvenser sekvensa og sekvensb. >sekvensa RAYN >sekvensb KSWDP 1. Hvad kaldes det format ovenfor som sekvensa og sekvensb er skrevet i? Der findes overordnet 2 typer af alignment: lokal alignment og global alignment. I det følgende skal du benytte Blosum50 substitutionmatricen herunder og Figur 3 som er vist på næste side til at aligne de to sekvenser sekvensa og sekvensb. Alle gaps har en værdi på -2. BLOSUM50 substitution matrix: A 5 R -2 7 N D C Q E G H I L K M F P S T W Y V A R N D C Q E G H I L K M F P S T W Y V 2. Lav en global alignment to sekvenser ved at udfylde tabellen i Figur 3 (findes på næste side). Hvis du har word: Hvis du har åbnet dette dokument i word er det nemmest bare at udfylde tabellen som er vist i Figur 3.

10 Side 10 of 14 Hvis du ikke har word: Skrive alignmentscorerne i en lang liste med angivelse af hvilken celle i Figur 3 du udregner, hvor celle er (række,kolonne) f.eks. på denne måde: K R celle (1,1) = Alignmentscore K A celle (1,2) = Alignmentscore K Y celle (1,3) = Alignmentscore... P N celle (5,4) = Alignmentscore 3. Skriv det globale alignment samt alignmentscoren

11 Side 11 of 14 Figur 3 R A Y N O K -2 S -4 W -6 D -8 P -10

12 Side 12 of 14 Opgave 5 Genotype og fænotype (25%) I fremtiden bliver det måske almindeligt for et kommende forældrepar at genteste embryoer og benytte informationen til at udvælge drømmebarnet. Lad os i denne opgave se bort fra de etiske aspekter og forestille os, at vi for to embryoer har fået 3 korte diploide dna-sekvenser med tilhørende position- og kromosom-angivelse. De viste sekvenser er alle givet på plus-strengen. Den midterste kernebase i sekvensen repræsenterer en SNP (vist med fed skrift). I de tre nederste rækker er der lavet plads til at udfylde SNP-position og genotype (orienteret i forhold til hhv. plus- og minus-strengen) ud fra de to kopier af kromosomerne, der kommer fra hhv. moderen og faderen. For Embryo 1 s første SNP er position og genotype allerede udfyldt og sorteret alfabetisk (i forhold til genotypen er det ikke relevant, hvilken forælder kernebasen kommer fra) for at matche genotyperne i fænotypetabel Udfyld SNP-position, genotype (på plus-streng) og genotype (på minus-streng) i skemaerne nedenfor. Embryo 1: kromosom: position: kopi fra mor: 5 -CAGGGGCTACA-3 5 -CTGACTGAGAG-3 5 -CACCACAGCCT-3 kopi fra far: 5 -CAGGGACTACA-3 5 -CTGACCGAGAG-3 5 -CACCACAGCCT-3 SNP-position: genotype (på plus-streng): Genotype (på minus-streng): A;G C;T Embryo 2: kromosom: position: kopi fra mor: 5 -CAGGGGCTACA-3 5 -CTGACCGAGAG-3 5 -CACCAGAGCCT-3 kopi fra far: 5 -CAGGGACTACA-3 5 -CTGACCGAGAG-3 5 -CACCAGAGCCT-3

13 Side 13 of 14 SNP-position: genotype (på plus-streng): genotype (på minus-streng): Du skal nu sammenholde de to embryoers genotyper med de tre fænotyper vist i fænotypetabel 1, 2 og 3 og svare på spørgsmål 2 og 3. Du bedes forholde dig til alle tre fænotyper for begge embryoer. Hint: Vær opmærksom på at genotyperne i fænotypetabellerne er angivet på den streng, der står ud for Streng (dbsnp). Position er altid givet i forhold til plus-strengen. 2. Hvilke mulige fænotyper har embryo 1? Forklar. 3. Hvilke mulige fænotyper har embryo 2? Forklar. 4. Begge forældre vurderes til at være normalt begavede og raske, men kunne en eller begge tænkes at være bærer af rs variationen, der er kædet sammen med Tay-Sachs sygdom?

14 Side 14 of 14 Fænotypetabel 1. Evne til at nedbryde laktose. Kromosom 2 Streng (dbsnp) minus Position Genotype Effekt rs (c;c) Muligvis laktose-intolerant rs (c;t) Kan fordøje mælk rs (t;t) Kan fordøje mælk Fænotypetabel 2. Muskler optimeret til eskplosiv udfoldelse eller udholdende Kromosom 11 Streng (dbsnp) plus Position Genotype Effekt rs (c;c) Muligvis øget sprinter-præstationsevne rs (C;T) Blanding af sprint- og udholdenhedsmuskler rs (T;T) Muligvis øget udholdenhed Fænotypetabel 3. Tay-Sachs sygdom: Udviklingshæmmelse, paralyse, blindhed og død i alderen 2-4 år. Kromosom 15 Streng (dbsnp) minus Position Genotype Effekt rs (c;c) Normal rs (c;g) Bærer af varianten relateret til Tay-Sachs sygdom rs (g;g) Lider sandsynligvis af Tay-Sachs sygdom

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 16 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 13 Danmarks Tekniske Universitet Skriftlig prøve, den 22/2-2013 Kursus navn: Introduktion til SystemBiologi Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle opgaver. Kursusansvarlig

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 af 1 Danmarks Tekniske Universitet Side 1 af 11 sider Skriftlig prøve, den 27/5-2010 Kursus navn: Kursus nr. 27611 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved

Læs mere

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side 1 af 14 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik Danmarks Tekniske Universitet Løsningsforslag til Øvelse i Immonologisk Bioinformatik Indledning De følgende sider giver en gennemgang af de øverlser i har lavet under jeres besøg på DTU, som en del af

Læs mere

Immunologisk bioinformatik

Immunologisk bioinformatik Immunologisk bioinformatik Øvelsesvejledning Introduktion til øvelsen Når man i dagligdagen taler om influenza, bliver virussen ofte forbundet med forbigående og ufarlig sygdom. Som regel har mennesker

Læs mere

Vejledning til opbygning af hjemmesider

Vejledning til opbygning af hjemmesider Side 1 af 9 Vejledning til opbygning af hjemmesider Hvis du er inde på din klubs hjemmeside, fx på forsiden, kan du nu gå i gang med at redigere. For at få redigeringsværktøjet frem, skal du klikke på

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 af 8 Danmarks Tekniske Universitet Side 1 af 8 sider Skriftlig prøve, den 29/5-2009 Kursus navn: Kursus nr. 27611 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved

Læs mere

I denne manual kan du finde en hurtig introduktion til hvordan du:

I denne manual kan du finde en hurtig introduktion til hvordan du: VORES NORDSJÆLLAND HURTIGT I GANG MANUAL 01: Bruger HVAD INDEHOLDER DENNE MANUAL? I denne manual kan du finde en hurtig introduktion til hvordan du: 1. Finder Vores Nordsjælland hjemmesiden 2. Opretter

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 15 Danmarks Tekniske Universitet Skriftlig prøve, den 2/3-2012 Kursus navn: Introduktion til SystemBiologi Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle opgaver. Kursusansvarlig

Læs mere

Struktur og funktion af gener

Struktur og funktion af gener Molekylærbiologi og genetik S4, F2008 f Malene Munk Jørgensen Emne: Struktur og funktion af gener Link: undervisningsplanen for S4-molekylærbiologi og genetik MMJ, VI niversity ollege Bioanalytikeruddannelsen

Læs mere

Nye funktioner i FamilySearch FamilyTree

Nye funktioner i FamilySearch FamilyTree Nye funktioner i FamilySearch FamilyTree Login og få nye funktioner til rådighed Hvis du tidligere har haft et login til FamilySearch (http://familysearch.org), kan du umiddelbart tage de nye funktioner

Læs mere

BørneIntra hjemmesidekursus

BørneIntra hjemmesidekursus BørneIntra hjemmesidekursus hjemmesidekursus Januar 2012 Indhold 1 Introduktion... 5 1.1 Kursets formål... 5 1.2 Hjemmesiden opbygges i PersonaleIntra... 5 2 Hjemmesidens indhold... 6 2.1 Hjemmesidens

Læs mere

Qbrick s krav til video filtyper

Qbrick s krav til video filtyper Indhold Qbrick s krav til video filtyper... 1 Krav til ordningen/området... 1 Qbrick s krav til video leverandør... 1 Video og billede størrelser i WCM:... 1 Upload en video... 2 Trin 1: Mediefiler...

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

Moltrup-sogn.dk - Vejledning i redigering af undersider, og oprettelse af nye sider.

Moltrup-sogn.dk - Vejledning i redigering af undersider, og oprettelse af nye sider. Indholdsfortegnelse Moltrup-sogn.dk - Vejledning i redigering af undersider, og oprettelse af nye sider.... 2 Brugernavn og kodeord.... 2 Selve tekstbehandleren... 3 Indsættelse af billeder... 4 Metadata...

Læs mere

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Isa Kirk Biotech Academy Institut for Systembiologi, Danmarks Tekniske Universitet 2. november 2010 1 Indhold 1 Introduktion

Læs mere

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Per Tøfting 23. september 2008 Speciale i softwarekonstruktion IT-Vest Aarhus Universitet Agenda Formål microrna Strategien

Læs mere

Version august 2012 Side 1 af 7

Version august 2012 Side 1 af 7 Side 1 af 7 Indholdsfortegnelse Indholdsfortegnelse... 2 7. Valgmuligheder ved skriftlige prøver... 3 8.Generelle regler vedrørende skriftlige prøver... 3 9. Specifikke regler vedrørende elektronisk aflevering

Læs mere

SNP håndtering og datavalidering. Kevin Byskov

SNP håndtering og datavalidering. Kevin Byskov SNP håndtering og datavalidering Kevin Byskov Disposition Principperne bag genotypning Kontrolprocedurer: Kontrol af Sample ID Mendel Error Check Kontrol af omtypede dyr Cytosin (C) Guanin (G) Homologe

Læs mere

Computer og print ved skriftlige prøver på Laursens Realskole forår 2017

Computer og print ved skriftlige prøver på Laursens Realskole forår 2017 Forudsætninger for at anvende it til prøverne: 1. HUSK at genstarte din computer kort tid før prøverne begynder. Dermed får du hentet opdateringer, som evt. kan være afgørende for, om du kan logge på det

Læs mere

Byg web sider. Introduktion:

Byg web sider. Introduktion: Introduktion: Du kender nu nogle enkle HTML tags, så nu er det på tide, at du kommer i gang med at lave din første side! Når du har nogle HTML-sider klar skal du have dem lagt op, så dine venner kan se

Læs mere

Genetiske afstande og afstandsmatricer

Genetiske afstande og afstandsmatricer Genetiske afstande og afstandsmatricer Denne vejledning indeholder en række små øvelser og opgaver der illustrerer, hvordan man ud fra genetiske sekvenser kan udregne en gennemsnitlig evolutionær afstand

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

Bioinformatik Open Source Software i biologiens tjeneste

Bioinformatik Open Source Software i biologiens tjeneste Bioinformatik Open Source Software i biologiens tjeneste Kenneth Geisshirt kneth@silex.dk Silex Science ApS Bioinformatik p.1/19 Om Silex Science ApS Grundlagt maj 2002 Ejeren er Cortex Holding Fokusområderne

Læs mere

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer)

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer) Elevvejledning til det Virtuelle Kræftlaboratorium Det Virtuelle Kræftlaboratorium stiller krav til en grundig forståelse af det centrale dogme inden for molekylærbiologien, hvordan DNA oversættes til

Læs mere

Rapport generator til Microsoft C5

Rapport generator til Microsoft C5 Generelt Rapportgeneratoren til C5 kan benyttes sammen med alle versioner af C5 og kræver INGEN tillægsmoduler eller tilkøb af C5. Den kører på: C5 version 1.5x, 1.6x, 2.x, 3.x, 4.x, 2008, 2010 og 2012.

Læs mere

WEB kursus I. Grundkursus i CMS

WEB kursus I. Grundkursus i CMS WEB kursus I Grundkursus i CMS 1 Link til manual på intranet: http://intranet.regionsyddanmark.dk/cmsmanual Nyttig information Support telefonnummer: 65 41 32 25 Support e-mail: websupport@regionsyddanmark.dk

Læs mere

Retningslinjer for studerende som skal til skriftlig eksamen på Samfundsvidenskab

Retningslinjer for studerende som skal til skriftlig eksamen på Samfundsvidenskab Retningslinjer for studerende som skal til skriftlig eksamen på Samfundsvidenskab September 2013 Bemærk at denne vejledning er et tillæg til SDU s regelsæt for brug af computer ved skriftlige stedprøver.

Læs mere

Brugermanual til Assignment Hand In

Brugermanual til Assignment Hand In Brugermanual til Assignment Hand In Indhold: Undervisere:... 2 Hvor finder jeg Assignment hand in?... 2 Opret en opgave... 3 Slet en opgave... 4 Rediger en opgave... 4 Hvor finder jeg de afleverede filer?...

Læs mere

Vejledning På bordene ligger omslag til din besvarelse, med dit navn på. Sæt dig ved bordet med dit omslag.

Vejledning På bordene ligger omslag til din besvarelse, med dit navn på. Sæt dig ved bordet med dit omslag. Vejledning 2017 Eksamen Indhold: 1. Ved prøvens begyndelse 2. Under prøven 3. Aflevering af din besvarelse 4. Regler for eksamen generelt 5. Brug af computer 6. Brug af ordbøger 7. Udeblivelse og snyd

Læs mere

IT-Brugerkursus. Modul 1 - Introduktion til skolens netværk og FC. Modul 1 - Introduktion til FC og Lectio. Printvenligt format. Indholdsfortegnelse

IT-Brugerkursus. Modul 1 - Introduktion til skolens netværk og FC. Modul 1 - Introduktion til FC og Lectio. Printvenligt format. Indholdsfortegnelse Modul 1 - Introduktion til FC og Lectio IT-Brugerkursus Modul 1 - Introduktion til skolens netværk og FC Printvenligt format Indholdsfortegnelse Formål og opbygning Opgave Vejledning til intranettet Åbne

Læs mere

Elev-manual til Køreklar e-læring

Elev-manual til Køreklar e-læring Version 2.0 September 2016 Elev-manual til Køreklar e-læring Nyt Juridisk Forlag Gothersgade 137 1123 København K 39 13 55 00 koreklar@koreklar.dk 2 Indhold 1. Første gang du logger dig på Køreklar e-læring...

Læs mere

Manual til administration af online booking

Manual til administration af online booking 2016 Manual til administration af online booking ShopBook Online Med forklaring og eksempler på hvordan man konfigurerer og overvåger online booking. www.obels.dk 1 Introduktion... 4 1.1 Formål... 4 1.2

Læs mere

xgalleri Mulige filtyper Installation web-version

xgalleri Mulige filtyper Installation web-version xgalleri xgalleri opstod ud fra ønsket om at lægge en større samling billeder på nettet. Der findes mange programmer, som kan bruges til at lægge datafiler på nettet; men de fungerer typisk på den måde,

Læs mere

Patient Database - Manual

Patient Database - Manual Patient Database - Manual Side 1 af 36 Adgang til systemet... 4 Glemt brugernavn og kode... 4 Opret projekt (kun System Administrator)... 6 Klik på NYT PROJEKT -knappen øverst til venstre.... 6 Udfyld

Læs mere

Konvertering af DADAS data til Dansk Supermarked VI-skema

Konvertering af DADAS data til Dansk Supermarked VI-skema Konvertering af DADAS data til Dansk Supermarked VI-skema GS1 Denmark Version 5 November 2012 1 Konvertering af DADAS data til alternativt vareindmeldelsesskema Skal man konvertere data fra SINFOS/DADAS

Læs mere

Velkommen Immunologisk Bioinformatik

Velkommen Immunologisk Bioinformatik Velkommen Immunologisk Bioinformatik EduForce undervisere: Hvem er vi? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvem er I? 3 DTU Systembiologi, Danmarks Tekniske Universitet Dagens Program Kl.

Læs mere

Brug af IT-udstyr ved skriftlig eksamen

Brug af IT-udstyr ved skriftlig eksamen Brug af IT-udstyr ved skriftlig eksamen Ved brug af skolens IT-udstyr til skriftlig eksamen skal du: Medbringe dit UNI-login Oprette sidehoved/-fod til dine dokumenter (skolen har en færdig skabelon, som

Læs mere

Introduktion til de praktiske øvelser

Introduktion til de praktiske øvelser Introduktion til de praktiske øvelser Vi vil i dag fokusere på tre forskellige online so4ware 6l SNP analyser snptree NDtree CSIphylogony Introduktion til SNP analyser h@p://cge.cbs.dtu.dk/services/all.php

Læs mere


SÅDAN BRUGER DU TEKST- BEHANDLING INTRODUKTION SÅDAN BRUGER DU TEKST- BEHANDLING INTRODUKTION I vejledningen bruger vi det gratis program Writer fra OpenOffice som eksempel til at vise, hvordan man bruger nogle helt grundlæggende funktioner i tekstbehandling.

Læs mere

Vejledning 2015. På bordene ligger omslag til din besvarelse, med dit navn på. Sæt dig ved bordet med dit omslag.

Vejledning 2015. På bordene ligger omslag til din besvarelse, med dit navn på. Sæt dig ved bordet med dit omslag. Vejledning 2015 Eksamen Indhold: 1. Ved prøvens begyndelse 2. Under prøven 3. Aflevering af din besvarelse 4. Regler for eksamen generelt 5. Brug af computer 6. Brug af ordbøger 7. Udeblivelse og snyd

Læs mere

Brug af IT-udstyr ved skriftlig eksamen

Brug af IT-udstyr ved skriftlig eksamen Brug af IT-udstyr ved skriftlig eksamen Ved brug af skolens IT-udstyr til skriftlig eksamen skal du: Medbringe dit UNI-login Oprette sidehoved/-fod til dine dokumenter (skolen har en færdig skabelon, som

Læs mere

Computer og print ved skriftlige prøver på Laursens Realskole

Computer og print ved skriftlige prøver på Laursens Realskole Forudsætninger for at anvende it til prøverne: 1. Ved nogle skriftlige prøver er det tilladt at bruge it-udstyr. It-udstyr betyder en computer + en smartphone og/eller en tablet. FLY-funktionen SKAL være

Læs mere

Inholdsfortegnelse: 1. Allel-skema

Inholdsfortegnelse: 1. Allel-skema Stamtræsøvelse Inholdsfortegnelse: 1. Allel-skema 2. Hvem er far til Thor? 3. Saml stamtræet 4. Hvilke mænd skal Thor vælge til faderskabstesten? 5. Faderskabstesten 6. Ordforklaringer Du skal nu hjælpe

Læs mere

Vejledning til redigering via iserasuaat.gl/typo3 - både frontend og backend

Vejledning til redigering via iserasuaat.gl/typo3 - både frontend og backend Iserasuaat.gl Vejledning til redigering via iserasuaat.gl/typo3 - både frontend og backend Indhold Om kategorier en central del af Iserasuaat... 2 Frontend redigering... 3 Fanen Generelt... 4 Linke til

Læs mere

Biologi opgave Opsamling: Cellebiologi (Bioanalytiker modul3)

Biologi opgave Opsamling: Cellebiologi (Bioanalytiker modul3) 1 Delphine Bonneau Biologi opgave Opsamling: Cellebiologi 1-6 Pelle har spist en kæmpe stor kage, og efterfølgende stiger hans blodsukker. Derfor sender kroppen besked til de endokrine kirtler i bugspytkirtlen

Læs mere


INSTITUT FOR DATALOGI, AARHUS UNIVERSITET INSTITUT FOR ATALOGI, AARHUS UNIVERSITET Science and Technology EKSAMEN Algoritmer og atastrukturer (00-ordning) Antal sider i opgavesættet (incl. forsiden): (elleve) Eksamensdag: Fredag den. august 0,

Læs mere

Start med at downloade app en Youtube via App Store.

Start med at downloade app en Youtube via App Store. APP #7 Youtube I denne uge kigger vi på Youtubes app. På Youtube kan du finde næsten alt! Youtube bliver brugt til alt fra gamle tv-klip fra hele verden til musikvideoer til folk der lave video-blogs (de

Læs mere

Vejledning til. LearnSpace

Vejledning til. LearnSpace Vejledning til LearnSpace Version 13. 08. 2015 Indholdsfortegnelse Om LearnSpace... 2 Oprette et nyt kursus i egen afdeling... 3 Aktivere selvtilmelding til et kursus... 5 Tilmelde undervisere der må redigere

Læs mere

1. Hvad er kræft, og hvorfor opstår sygdommen?

1. Hvad er kræft, og hvorfor opstår sygdommen? 1. Hvad er kræft, og hvorfor opstår sygdommen? Dette kapitel fortæller om, cellen, kroppens byggesten hvad der sker i cellen, når kræft opstår? årsager til kræft Alle levende organismer består af celler.

Læs mere

Digital Eksamen Når du er logget ind i Digital Eksamen, bliver du mødt med en oversigt som vist nedenfor:

Digital Eksamen Når du er logget ind i Digital Eksamen, bliver du mødt med en oversigt som vist nedenfor: Bedømmerguide til Digital Eksamen Indhold Bedømmerguide til Digital Eksamen... 1 Oversigten... 1 Prøven... 2 Download og upload af besvarelserne... 4 Annoteringsværktøjet... 6 Noter og feedback... 8 Oversigten

Læs mere

Det Naturvidenskabelige Fakultet. Introduktion til Blackboard (Øvelser) Naturvidenskabeligt Projekt 2006 Prøv at forske

Det Naturvidenskabelige Fakultet. Introduktion til Blackboard (Øvelser) Naturvidenskabeligt Projekt 2006 Prøv at forske Det Naturvidenskabelige Fakultet Introduktion til Blackboard (Øvelser) Naturvidenskabeligt Projekt 2006 Prøv at forske Indholdsfortegnelse Introduktion til Blackboard Content System...3 Øvelse 01 individuel:

Læs mere

Opsætning af klient til Hosted CRM

Opsætning af klient til Hosted CRM Opsætning af klient til Hosted CRM Dette dokument beskriver, hvordan der oprettes forbindelse til en Hosted CRM løsning hos TDC Hosting A/S Morten Skovgaard, 24. april 2006 1 Indledning... 2 2 Konfiguration

Læs mere

Mini brugermanual CMD 5.1

Mini brugermanual CMD 5.1 Mini brugermanual CMD 5.1 Kom i gang For at tilgå CMD skal du åbne en web browser og indtaste URL en på dit CMD website i adressefeltet, hvorefter dialogboksen til log in vises. 1. Indtast dit brugernavn

Læs mere

Databasesøgning med BLAST

Databasesøgning med BLAST Databasesøgning med BLAST Denne vejledning giver en introduktion til databasesøgning med forskellige programmer i BLAST-familien. Vejledningen indeholder først en grundig introduktion og gennemgang af

Læs mere

Mini-guide for opdatering af hjemmesiden for. SOIF www.soif.dk

Mini-guide for opdatering af hjemmesiden for. SOIF www.soif.dk Mini-guide for opdatering af hjemmesiden for SOIF www.soif.dk Senest opdateret: 03-07-2009 Indholdsfortegnelse 2 Indholdsfortegnelse 2 Lidt generelt om KlubCMS 3 Brugere/Brugergrupper 3 Sideopbygning:

Læs mere

Axiell Danmark. facebib. en vejledning

Axiell Danmark. facebib. en vejledning Axiell Danmark facebib en vejledning 20. marts 2013 Indhold 1 Introduktion... 4 1.1 Forudsætninger... 4 2 Hvad kan man på facebib?... 5 2.1 Link til forsiden... 6 2.2 Linksamling (Leksikon)... 6 2.3 Link

Læs mere

Google Apps. Lær at oprette, organisere, dele og slette dokumenter. Udarbejdet af PLC, version 2013!!!!!!! Side 1 af 9

Google Apps. Lær at oprette, organisere, dele og slette dokumenter. Udarbejdet af PLC, version 2013!!!!!!! Side 1 af 9 Lær at oprette, organisere, dele og slette dokumenter. Udarbejdet af PLC, version 2013!!!!!!! Side 1 af 9 Arbejde i faner Google Apps arbejder i faner, derfor er det vigtigt, du er bekendt med det. Mappen

Læs mere

Opsætningsvejledning efter opdatering (ghostning) af hybriderne

Opsætningsvejledning efter opdatering (ghostning) af hybriderne Opsætningsvejledning efter opdatering (ghostning) af hybriderne Indholdsfortegnelse Login til Windows... 2 Aktivering af Office 365... 3 Kom i gang med Office 365 og OneDrive for Business... 4 Opsætning

Læs mere

SDU Assignment - undervisere

SDU Assignment - undervisere SDU Assignment - undervisere SDU Assignment giver mulighed for såvel anonym, som ikke anonym opgaveaflevering. Der kan afleveres flere filer på en gang. De studerende får en kvittering for afleveringen

Læs mere

1. Lactase tilhører enzymklassen hydrolase

1. Lactase tilhører enzymklassen hydrolase Arvelig immundefekt a. Immundefekt skyldes en arvelig gendefekt eller mutation i generne. Det kan ramme begge køn, som et slags usynligt handicap, og kan, hvis det ikke bliver behandlet, være dødeligt.

Læs mere

Manual til Den Elektroniske Portefølje i Almen Medicin Tutorlægens udgave

Manual til Den Elektroniske Portefølje i Almen Medicin Tutorlægens udgave Manual til Den Elektroniske Portefølje i Almen Medicin Tutorlægens udgave Til Tutorlægen Velkommen til den elektroniske portefølje. Den er blevet til i dialog mellem Dansk selskab for almen medicin og

Læs mere

Fra Excel til Capture part

Fra Excel til Capture part e-service Fra Excel til Capture part Side 1 af 5 Fra Excel til Capture part Note skrevet af : Nordcad Systems Technical Support Revision : Maj 2003, Release 14.2/9.2.3, 2003 Denne tekniske note gennemgår

Læs mere

Redaktørvejledning for www.bredstrup-pjedsted.dk Skriv en artikel

Redaktørvejledning for www.bredstrup-pjedsted.dk Skriv en artikel Arbejdsgang - Skriv artiklens tekst - Gør billeder klar - Log-in på hjemmesiden - Opret ny artikel - Vælg kategori - Skriv overskrift - Indsæt tekst - Tilføj billeder - Gennemgå artiklens indstillinger

Læs mere

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold:

Manual til Wordpress. 1. Log ind på din Wordpress-side. Indhold: Manual til Wordpress Sådan opdaterer du din hjemmeside i Wordpress: Dette er en manual til de mest grundlæggende ting, så du selv kan redigere indholdet eller tilføje nyt på din hjemmeside. Guiden er skrevet

Læs mere

Information til studerende som skal til skriftlig eksamen på Samfundsvidenskab

Information til studerende som skal til skriftlig eksamen på Samfundsvidenskab Information til studerende som skal til skriftlig eksamen på Samfundsvidenskab Bemærk at disse retningslinjer er et tillæg til SDU s regelsæt for brug af computer ved skriftlige stedprøver Når du tilmelder

Læs mere

Her ser du dit arbejde i preview undervejs og udgiver dit arbejde når du er færdig. (se side 4)

Her ser du dit arbejde i preview undervejs og udgiver dit arbejde når du er færdig. (se side 4) Sitecore vejledning Hvad er det? Sitecore er det program, den officielle del af Spejdernet laves i. Sitecore er et Content Management System, dvs. indholds-håndteringssystem til hjemmesider. Hvordan starter

Læs mere

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et:

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: F2011-Opgave 1. En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: Forward primer: 5 CC ATG GGT ATG AAG CTT TGC AGC CTT

Læs mere

Rottefængeren fra Hameln Word 2010

Rottefængeren fra Hameln Word 2010 Åbn for et nyt Word dokument og gem det som Rottefængeren.docx. Sagnet om rottefængeren fra Hameln skal laves som en lille folder med fire sider. Skift til fanebladet Sidelayout og venstreklik på værktøjet

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Træning øger genbrug i museceller. Er det derfor, at motion er

Læs mere

DI Online løsning: Quick guide til oprettelse af oprindelsescertifikater

DI Online løsning: Quick guide til oprettelse af oprindelsescertifikater DI Online løsning: Quick guide til oprettelse af oprindelsescertifikater Dette dokument er en introduktion til Dansk Industris online løsning til oprettelse og bestilling af oprindelsescertifikater. Dokumentet

Læs mere

Karens vejledning til WordPress, september 2014 1

Karens vejledning til WordPress, september 2014 1 Karens vejledning til WordPress, september 2014 1 Karens WordPress vejledning september 2014 INDHOLD Hvad er WordPress 1 Generelt om WordPress 2 Frontend og backend 2 Skrive en blog-tekst (indlæg/post)

Læs mere

NR. 92 PDF-formularer med OpenOffice DEN 4. MARTS 2015

NR. 92 PDF-formularer med OpenOffice DEN 4. MARTS 2015 NR. 92 PDF-formularer med OpenOffice DEN 4. MARTS 2015 PDF-formularer med OpenOffice til LUDUS Web Målet med dette Tips & Tricks er at beskrive, hvordan man laver PDF-formularer til brug i LUDUS Web. Læs

Læs mere

VELKOMMEN 3. KOM GODT I GANG 4 Log ind 5 Kontrolpanel 6 Tilpas profil 7 Tilknyt hold 8 Tilknyt fag 9

VELKOMMEN 3. KOM GODT I GANG 4 Log ind 5 Kontrolpanel 6 Tilpas profil 7 Tilknyt hold 8 Tilknyt fag 9 VEJLEDNING 1.0 Indhold VELKOMMEN 3 KOM GODT I GANG 4 Log ind 5 Kontrolpanel 6 Tilpas profil 7 Tilknyt hold 8 Tilknyt fag 9 SÅDAN OPRETTER DU EN QUIZ 10 Quiz info 11 Tilføj spørgsmål 12 Tilføj formel til

Læs mere

Vejledning til effektmåling af Arbejdsmarkedsuddannelser under De systemfælles redskaber www.viskvalitet.dk. - til efteruddannelsesudvalg

Vejledning til effektmåling af Arbejdsmarkedsuddannelser under De systemfælles redskaber www.viskvalitet.dk. - til efteruddannelsesudvalg Vejledning til effektmåling af Arbejdsmarkedsuddannelser under De systemfælles redskaber www.viskvalitet.dk - til efteruddannelsesudvalg November 2005 2 1 Introduktion...5 2 Her finder du adressen på Internettet,

Læs mere


DATALOGISK INSTITUT, AARHUS UNIVERSITET DATALOGISK INSTITUT, AARHUS UNIVERSITET Det Naturvidenskabelige Fakultet EKSAMEN Grundkurser i Datalogi Antal sider i opgavesættet (incl. forsiden): 6 (seks) Eksamensdag: Fredag den 25. juni 200, kl. 9.00-.00

Læs mere

Billeder på hjemmeside

Billeder på hjemmeside Billeder på hjemmeside Indholdsfortegnelse Emne 1. Billedredigering (Microsoft Picture Manager) Side 3 a. Komprimer billeder b. Beskæring af billeder 3 9 2. Billeder og tekst ved hjælp af en skabelon (Template

Læs mere

Kom godt i gang med DLBR Webdyr

Kom godt i gang med DLBR Webdyr Kom godt i gang med DLBR Webdyr Kom godt i gang med DLBR Webdyr Udgivet Februar 2011 Redaktør Tryk Videncentret for Landbrug Videncentret for Landbrug Udgiver Videncentret for Landbrug, KvægIT, 8740 5000

Læs mere

Introduktion til de praktiske øvelser

Introduktion til de praktiske øvelser Introduktion til de praktiske øvelser Vi vil i dag fokusere på tre forskellige online software til SNP analyser snptree NDtree CSIphylogony Introduktion til SNP analyser http://cge.cbs.dtu.dk/services/all.php

Læs mere

Kom godt i gang med OneDrive

Kom godt i gang med OneDrive Kom godt i gang med OneDrive Office365 er en mulighed for lærere og elever at bruge en office-pakke på egne enheder - man kan downloade det til brug på pc - mac - tablets og smartphones, i alt op til 5

Læs mere


5 ARBEJDE MED EDITOREN 5 ARBEJDE MED EDITOREN Editor (eller Rich Tekst Editor) er et indbygget indholdsredigerings værktøj, hvor man uden nogen kendskab til HTML kodning kan skrive tekst, indsætte billeder, videoer og links.

Læs mere

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner Generne bestemmer Niveau: 8. klasse Varighed: 12 lektioner Præsentation: Generne bestemmer er et forløb om genernes indflydelse på individet. I forløbet kommer vi omkring den eukaryote celle, celledeling,

Læs mere

vejledning sådan ARBejdeR du i ebg s RAppoRTvæRKTøj

vejledning sådan ARBejdeR du i ebg s RAppoRTvæRKTøj vejledning sådan arbejder du i ebg s rapportværktøj Vejledning for 2013/2014 Sådan arbejder du i EBG's rapportværktøj www.business-games.dk Indholdsfortegnelse: Forord... 2 Login... 2 Rapportværktøjet...

Læs mere

Procesbeskrivelse - Webprogrammering

Procesbeskrivelse - Webprogrammering Procesbeskrivelse - Webprogrammering Indholdsfortegnelse Forudsætninger... 1 Konceptet... 2 Hjemmesiden... 2 Server-side... 3 Filstrukturen... 3 Databasehåndtering og serverforbindelse... 4 Client-side...

Læs mere



Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Termin Maj-juni 2014-2015 Institution Favrskov Gymnasium Uddannelse Fag og niveau Lærer Hold stx Biologi C Jeppe Lund (JL) 2a bic Oversigt over gennemførte undervisningsforløb

Læs mere

Når du har logget dig ind, ser du Randers Kommunes byvåben midt på siden. I venstre side er der en række mapper:

Når du har logget dig ind, ser du Randers Kommunes byvåben midt på siden. I venstre side er der en række mapper: DXP vejledning Generelt: DXP er et værktøj til at fremstille præsentationsmaterialer (foldere, brochurer, løbesedler mv.) DXP egner sig kun til mindre brochurer og lign., da den største skabelon kan rumme

Læs mere

Lav din egen hjemmeside/blog. Dag 1 22-10-2015. Agenda d. 25. oktober 2015. Pc ere på nettet. Præsentation. Hvad er WordPress? Hvad er WordPress?

Lav din egen hjemmeside/blog. Dag 1 22-10-2015. Agenda d. 25. oktober 2015. Pc ere på nettet. Præsentation. Hvad er WordPress? Hvad er WordPress? Agenda d. 25. oktober 2015 Lav din egen hjemmeside/blog Dag 1 Præsentation af underviser og deltagere Pc erepå nettet Hvad er WordPress? Og hvad er forskellen på en blog og en hjemmeside Hej verden Kvik

Læs mere

Gem dine dokumenter i BON s Content Management System (CMS)

Gem dine dokumenter i BON s Content Management System (CMS) 24. august 2007 Gem dine dokumenter i BON s Content Management System (CMS) INDHOLDSFORTEGNELSE 1. Indledning... 2 2. Se indholdet i dit Content Management System... 3 3. Tilgå dokumenterne i My Content

Læs mere

Fremtidens menneske det perfekte menneske? (da-bio)

Fremtidens menneske det perfekte menneske? (da-bio) Fremtidens menneske det perfekte menneske? (da-bio) Jeg har valgt at beskæftige mig med fremtidens menneske. For at belyse dette emne bedst muligt har jeg valgt fagene biologi og dansk. Ud fra dette emne,

Læs mere