Da mennesket blev til

Størrelse: px
Starte visningen fra side:

Download "Da mennesket blev til"

Transkript

1 12 Da mennesket blev til - oprindelsen af Homo sapiens De sidste par årtiers intensive forskning har kastet nyt lys over spørgsmålet om oprindelsen af det moderne menneske. Peter K. A. Jensen vil i to artikler se på, hvad henholdsvis fossilerne og de nye genetiske undersøgelser fortæller os. Af Peter K. A. Jensen n Spørgsmålet om oprindelsen af det moderne menneske er det ældste og samtidig det mest kontroversielle af alle inden for det konfliktfyldte felt, der beskæftiger sig med menneskets udviklingshistorie. I virkeligheden har spørgsmålene, om hvor, hvornår og specielt hvordan moderne mennesker først opstod, været genstand for betydelig debat blandt naturfilosoffer og teologer længe inden, det første human-fossil blev erkendt. Og interessen for disse spørgsmål er i dag lige så aktuel som i 1856, hvor det første human-fossil af meget høj alder blev fundet i Neandertal i Tyskland. To skoler Det fælles grundlag for denne debat er det faktum, at mennesker, der fundamentalt set var»moderne«i såvel anatomisk som i kulturel og adfærdsmæssig henseende, fandtes i alle regioner af den Gamle Verden (Afrika og Eurasien) for mindst år siden. Kontroversen drejer sig om, hvad der skete i perioden umiddelbart før denne tid - i intervallet fra ca år til år før nu, hvor det moderne menneske blev formet. Igennem størstedelen af dette århundrede har spørgsmålet om det moderne menneskes biologiske og geografiske oprindelse delt det videnskabelige samfund i to skoler, der nu som før, står stejlt over for hinanden. Den ene skoles synspunkt kaldes den Multiregionale Model, mens den anden teori kaldes Fortrængningsmodellen (figur 1 og 2). Oprindelsen af det moderne menneske er et kontroversielt og omdiskuteret emne. Den multiregionale model Den multiregionale model blev oprindeligt lanceret i 1940'rne af Franz Weidenreich, der især er kendt for sin udforskning af "Peking-mennesket". Ifølge den multiregionale model, der også går under navnet Canderlabermodellen, har humane populationer i alle regioner af den Gamle Verden gennemgået en mere eller mindre parallel udvikling, der er forløbet over den sidste million år eller mere. Ifølge den Multiregionale Model må anatomisk moderne mennesker således forventes at optræde blandt fossilerne på nogenlunde samme tidspunkt overalt i den Gamle Verden. Tilhængere af den Multiregionale Model hævder, at overgangen til moderne Homo sapiens er sket lokalt og gradvist med Homo ergaster/erectus som udgangspunkt. Overgangsformer mellem Homo ergaster/ erectus og Homo sapiens findes ikke blot i Afrika, men også i Europa, Østasien og Australasien (Indonesien, Australien og Ny Guinea). Dette er kendt som begrebet om regional eller lokal kontinuitet. Det genetiske grundlag for de moderne europæere er således i væsentlig grad nedarvet fra neandertalerne, mens H. erectus-populationer i Kina og på Java er forfædre til henholdsvis moderne kinesere og Foto: Jens Kjeldsen

2 13 australasiere. Carleton Coon fremførte den mest ekstreme variant af den Multiregionale Model i sin bog The Origin of Races (1962), hvori han hævdede, at fem separate populationer af Homo erectus uafhængigt af hinanden havde udviklet sig parallelt til Homo sapiens. I dag er synspunktet det, at der gennem tiderne har været tilstrækkelig kontakt og opblanding, og deraf resulterende gen-flow (udveksling af gener) mellem disse geografisk spredte populationer, til at sikre et ensartet mønster i udviklingen hen mod moderne Homo sapiens inden for alle regionerne. På samme tid har disse populationer også været tilstrækkeligt isolerede til at sikre en tilpasning til det lokale miljø. På denne måde er variationerne (racerne) blandt moderne mennesker blevet udviklet over lange tidsrum, uden at dette dog har resulteret i dannelsen af nogen reproduktiv barriere: Hele populationen er bevaret som én og samme art. Fortrængningsmodellen Fortrængningsmodellen er i sin nuværende form af nyere dato; den har i dag en meget stor skare af tilhængere, ikke mindst blandt genetikere (molekylærantropologer), men også blandt fysiske antropologer og arkæologer. Hovedsynspunktet i Fortrængningsmodellen er, at anatomisk moderne mennesker kun udvikledes ét sted på Jorden, i en afgrænset region i den Gamle Verden, hvorfra de senere spredtes ud over hele kloden. Hvor de kom frem, fortrængte de den lokale, arkaiske (gamle) population uden væsentlig opblanding med disse. De arkaiske populationer neandertalerne i Europa og H. erectus/soloensis i Sydøstasien - har ifølge Fortrængningsmodellen således slet ikke, eller kun i meget ringe omfang, bidraget til nulevende menneskers genetiske udrustning. Tilhængerne af Fortrængningsmodellen anser Afrika for at være oprindelsesstedet for H. sapiens, idet de hævder, at både de senere års palæontologiske forskning samt genetiske undersøgelser af nulevende mennesker peger herpå. Af denne grund går Fortrængningsmodellen også under navnet Out of Africa -modellen (afrikansk monogenese). I følge denne model fandt overgangen fra arkaiske til moderne former af Homo sapiens sted i Afrika, og tilhængere af modellen mener ikke, at der eksisterer holdbare vidnesbyrd om kontinuitet fra arkaisk til moderne Homo sapiens andre steder. Hybridiseringsmodellen Man støder nogle gange på en tredje model, der kan opfattes som en slags kompromis mellem de to hovedskoler. Grundlaget for denne kompromismodel er formuleret af G. Bräuer, der som tilhængerne af Fortrængningsmodellen hævder, at det moderne menneske er opstået fra arkaiske menneskeformer i Afrika, hvorfra det har spredt sig til Europa og formentlig også til Asien. Men i modsætning til, hvad der forudsættes i Fortrængningsmodellen, mener Bräuer, at det moderne menneske ikke opstod som følge af biologisk speciering (artsdannelse), men at de ekspanderende moderne populationer optog en vis portion arkaiske gener i deres genpuljer; derfor var de arkaiske populationers forsvinden i Eurasien et resultat af fortrængning og opblanding. Af denne grund kaldes Bräuers model nogle gange for Hybridiseringseller Gen flow-teorien. Det dominerende element i Bräuers teori er dog, som i Fortrængningsmodellen, udvandring af afrikansk-afledte moderne populationer til resten af den Gamle Verden, ikke lokal kontinuitet. Det skal bemærkes, at en eventuelt sporadisk og minimal opblanding formentlig aldrig vil kunne spores, hverken i fossilerne eller ved genetiske analyser. Det er således åbenbart, at nogle ser talrige overgangsformer, hvor andre kun ser geografisk variation, mens atter andre ser hybrider. Europa Afrika Asien Europa Afrika Asien FORTRÆNGNINGSTEORIEN FORTRÆNGNINGSTEORIEN Udviklingen af Homo sapiens er sket ét sted: I Afrika DEN MULTIREGIONALE TEORI Figur 1. To teorier for oprindelsen af det moderne menneske. Fortrængningsteorien anser Afrika for oprindelsesstedet, hvorfra Homo sapiens koloniserede verden og fortrængte alle ældre mennesketyper. Den Multiregionale Teori anser oprindelsen for at have fundet sted flere steder i den Gamle Verden; enheden er bevaret ved opblanding. Tidsrammen for udviklingen af Homo sapiens er mindre end år De ældste anatomisk moderne fossiler findes i Afrika Overgangsformer mellem arkaiske og moderne former findes kun i Afrika Der er ingen sammenhæng mellem karaktertræk hos moderne og arkaiske mennesker fra samme geografiske region (undtagen Afrika) Arkaiske former har ikke eller kun i ringe grad bidraget til den genetiske udrustning af Homo sapiens De racemæssige variationer er opstået for mindre end år siden. Homo sapiens er grundstammen Figur 2. DEN MULTIREGIONALE TEORI Parallel udvikling frem mod Homo sapiens fandt sted flere steder i verden Tidsrammen for udviklingen af Homo sapiens er næsten 2 millioner år Meget tidlige fossiler af anatomisk moderne mennesker findes på alle kontinenter i den Gamle Verden Overgangsformer mellem arkaiske og moderne former findes både i Afrika, Asien og Europa På alle kontinenter kan træk hos nulevende mennesker spores tilbage til forfædrene, der levede i samme region Artens enhed er sikret ved opblanding på tværs af kontinenterne, men samtidig har den geografiske isolation været tilstrækkelig til, at de racemæssige variationer har kunnet dannes De racemæssige variationer har dybe rødder, og kan føres tilbage til den første udvandring fra Afrika (Homo ergaster)

3 14 Dar-es soltan/ Témara Jebel Irhoud Qafzeh/Skhul Singa Jebel Irhoud (~ år) Abdur Omo-Kibish 1 Omo-Kibish 2 Qafzeh (~ år) Guomde Anatomisk moderne (Homo sapiens) Overgangsformer (Homo helmei) Laetoli (Ngaloba) Klasies River Mouth (~ år) Florisbad Hoedjiespunt Langebaan Die Kelders Border Cave Howieson's Poort Klasies River Mouth Herold's Bay Omo-Kibish 1 (~ år) Figur 3. De ældste anatomisk moderne fossiler er alle fundet i Afrika. Ligeledes er det kun i Afrika, at der med sikkerhed er fundet overgangsformer mellem de klart arkaiske og de klart moderne fossiler. Overgangsformerne samles undertiden under artsbetegnelsen, Homo helmei. Alderen på overgangsfossileme er år (Florisbad dog år). Alderen på de anatomisk moderne fossiler er år og derunder. De ældste anatomisk moderne fossiler er fundet i Afrika Fossiler af anatomisk moderne mennesker fra Afrika syd for Sahara og fra Mellemøsten er markant ældre end fossiler fra resten af verden (figur 3 og 4). F.eks. er et kranium (Omo- Kibish 1) fra det sydlige Etiopien mellem og år gammelt, mens fossiler fra det sydlige Afrika (Klasies River Mouth) er lidt yngre, omkring år gamle. Et andet kranium fra det sydlige Afrika (Border Cave) er måske mere end år gammelt (nogle undersøgelser har dog antydet en væsentlig yngre alder af Border Cave fossilet). I hulerne ved Skhul og Qafzeh i Israel er der gjort talrige fossilfund, der alle er bestemt til at være anatomisk moderne. Nye aldersbestemmelser har vist en alder tæt på år. Anatomisk moderne fossiler fra resten af verden er betydeligt yngre. Et fund fra en hule ved Liujiang i Kina er blevet regnet for det ældste uden for Afrika og Mellemøsten. Det blev oprindeligt bestemt til at være omkring år gammelt, men dateringen er ikke foretaget på selve fossilet, men på stalagmitter (drypsten) i hulen. Meget tænkeligt er fossilet betydeligt yngre, end hvad alderen på drypstenene lader antyde. Det ældste moderne fossil fra Kina, hvor aldersbestemmelsen er sikker, er ca år gammelt (fra Zhoukoudian-hulen ved Beijing). Både arkæologiske fund samt helt nye fossilfund fra Australien antyder stærkt, at det moderne menneske nåede dette kontinent for omkring år siden. Et fossil fra Niah-hulen på Borneo er ca år gammelt. De ældste moderne fossiler fra Europa er af samme alder. Hvor finder vi overgangsformer? En glidende overgang i de anatomiske træk fra de arkaiske til de moderne former repræsenterer en hjørnesten i den Multiregionale Model. Faktisk var det den tilsyneladende forekomst af overgangsformer i Fjernøsten, der ledte førnævnte Franz Weidenreich til at formulere den Multiregionale Model for et halvt århundrede siden. Tilhængere af teorien mener at kunne skelne sådanne overgangsformer, ikke blot i Fjernøsten, men også i Mellemøsten, Afrika og Europa. De fleste er dog enige om, at der ikke er nogen forbindelse mellem de arkaiske og moderne fossiler fra Kina, mens fortolkningen af de sydøstasiatiske fossiler giver anledning til større uenighed. Centralt i debatten om regional kontinuitet i Sydøstasien har været et ekstremt kontroversielt kranium (WLH 50) fra Willandra Lakes distriktet i det sydlige Australien. Alle er enige om, at kraniet er moderne, og derfor repræsenterer H. sapiens. Tilhængerne af den Multiregionale Model ser i WLH 50 klare relationer til arkaiske sydøstasiatiske kranier (de såkaldte Ngandong fossiler), mens tilhængere af Fortrængningsmodellen ikke ser sådanne relationer. De mener derimod, at kraniet udviser mange lighedspunkter med tidligt moderne kranier fra Afrika og Levanten. Fossiler fra Israel støtter Fortrængningsmodellen I Mellemøsten (Israel), hvor udgravningerne startede i 1930'erne, er der fundet fossiler af både neandertalere (ved Tabun, Kebara og Amud) og anatomisk moderne mennesker (Skhul og Qafzeh). Indtil for få år siden var det almindeligt antaget, at neandertal-fossilerne var ældre end de moderne (hen-

4 15 holdsvis og år); neandertalerne ansås derfor at være forfædre til de moderne i overensstemmelse med forudsigelserne i den Multiregionale Model. Men nye aldersbestemmelser foretaget i begyndelsen af 1990'rne viser et mere kompliceret billede (figur 5). Kebara og Amud synes at være ca år gamle, mens Tabun-fossilerne er omtrent dobbelt så gamle. Mere interessant er det, at de moderne fossiler fra Skhul og Qafzeh nu er bestemt til at være ca år gamle. Derfor kan det simple billede af forfader-efterkommer ikke længere opretholdes. Det forholder sig ydermere således, at de moderne fossiler frembyder legemsproportioner, der er i overensstemmelse med en nylig indvandring fra det varme, tropiske Afrika. Derfor giver fossilerne fra Israel mere støtte til Fortrængningsmodellen end til den Multiregionale Model. Neandertalere og moderne mennesker i Europa De arkaiske mennesker i Europa repræsenteres ved neandertalerne, der foruden i Europa også var udbredte til det sydvestlige Asien. Den såkaldte neandertal-æra omfatter sidste mellemistid (Eem) og det meste af Weichsel-istiden (perioden fra år til ca år før nu). For ca får siden begynder den klassiske neandertaler at forsvinde fra Europa, først i øst, siden i vest. De sidste overlevende neandertalere er lidt under år gamle. Anatomisk moderne fossiler kan følges på en lignende østvest bane i Europa. De ældste fossiler er år gamle, og er fundet i en hule ved Bacho Kiro, Bulgarien, mens kroatiske fund fra Velíka Pecina er år gamle. De klassiske Cro-Magnon fossiler fra det sydvestlige Frankrig er år gamle. Nøje analyser af fossilerne viser, at de anatomisk moderne fossiler fra Europa har langt flere træk tilfælles med anatomisk moderne fossiler fra Afrika, end Det moderne menneskes kendetegn Nedenfor er anført nogle anatomiske og adfærdsmæssige karakteristika for Homo sapiens. Det er ved samme karakteristika, at Homo sapiens adskiller sig fra arkaiske menneskeformer. Anatomiske karakteristika 1. Gracilt skelet med lange, lige rørknogler 2. Hjernekassen høj og hvælvet med parallelle sider 3. Afrundet nakkeregion 4. Svagt udviklede øjenbrynsbuer 5. Ansigtsskelettet fladt og tilbagetrukket under hjernekassen 6. Distinkt hageparti Omo-Kibish (Ethiopien) ~ de har med neandertalerne. Cro-Magnon fossilerne (fællesbetegnelse for tidligt moderne europæere) viser en varme-tilpasset kropsform (høje, gracile og langlemmede), der står i skærende kontrast til de firskårne, kulde-tilpassede neandertalere. De europæiske fossiler støtter derfor klart Fortrængningsmodellen. Glidende overgang i Afrika Tilbage står, at der kun i Afrika syd for Sahara tegner sig et klart billede af en glidende overgang fra arkaiske fossiler over mellemformer til de anatomisk moderne mennesker. De arkaiske former, der af mange samles under artsbetegnelsen H. heidelbergensis, udgøres bl.a. af Skhul/Qafzeh (Israel), Klasies River Mouth (Sydafrika) Border Cave (Sydafrika) Liuziang (Kina) ~ År før nu Adfærdsmæssige karakteristika 1. Redskabsteknologi, der sikrer optimal udnyttelse af råmaterialet 2. Redskaber repareres og genbruges 3. Redskaber i ben, tak, horn m.m. 4. Fremstilling af dekorative ting 5. Smykker, der bæres 6. Hulekunst 7. Store og komplekse bopladser 8. Rituelle begravelser 9. Specialiseret jagt på udvalgte større dyr 10. Fiskeri 11. Socialt netværk inden for og mellem stammer SKHUL QAFZEH AMUD TABUN KEBARA Ældste fossiler fra Europa samt Niah-hulen (Borneo) Zhoukidian -hulen (Kina) Figur 4. Fossiler af anatomisk moderne mennesker fra Afrika og Mellemøsten er markant ældre end fund fra resten af verden. AMUD KEBARA SKHUL QAFZEH TABUN År før nu Figur 5. Tidlige aldersbestemmelser af neandertalerne fra Levanten (de grønne felter) antydede, at disse kunne være forfædre for de moderne mennesker i regionen (de røde felter), men senere aldersbestemmelser har kompliceret billedet betydeligt.

5 16 Aldersbestemmelse Det er helt afgørende for rekonstruktionen af menneskets evolution, at der findes pålidelige metoder til aldersbestemmelse af fossilerne. Dateringsmetoderne falder i to hovedkategorier: relative og absolutte. 1. Med relative metoder er det muligt at bestemme, hvorvidt et fossil er ældre, yngre eller ligeså gammelt som et andet. Et eksempel herpå er såkaldt lithostratigrafi, hvor man på baggrund af de geologiske lags kronologiske orden (vurderet ud fra bjergarternes rent fysiske og strukturelle fremtræden) kan afgøre, om et fossil fundet i et bestemt lag, er yngre eller ældre end fossiler fundet i andre lag. En tilsvarende metode er biostratigrafi, men her er det de geologiske lags indhold af karakteristiske fossiler, som bruges til at afgøre, om et geologisk lag er ældre eller yngre end et andet. 2. Med absolutte (kronometriske) metoder er det muligt at fastlægge alderen i faktiske antal år. En hovedgruppe er radiometriske metoder, som er baseret på målinger af forholdet mel- lem forskellige radioaktive isotoper. Man udnytter her, at enhver radioaktiv isotop har en bestemt halveringstid (den tid, det tager at halvere antallet af den radioaktive isotops atomer). Eksempler på radiometriske metoder er Kalium/ argon-datering, Argon/argon-datering, Uranium-datering, Kulstof-14- datering, Termoluminescens, Elektron-spin-resonans. Det kan nævnes, at det ved hjælp af såkaldt single crystal laser fusion er muligt at udføre Argon/argon-datering på enkelte mineralkorn, hvilket giver en hidtil uset præcision i dateringen. Der findes også andre typer af absolutte dateringsmetoder f.eks.: Dendrokronologi, hvor antallet og karakteristika af årringe i træer kan udnyttes til at datere begivenheder specielt klimatiske i fortiden. Palæomagnetisme, hvor man udnytter det forhold, at Jordens magnetfelt skifter retning med faste intervaller. Magnetfeltet fastfryses blandt andet i vulkanske bjergarter, og dets retning på dannelsestidspunktet kan derfor aflæses i dag, selvom bjergarterne er mange millioner år gamle. fossilerne fra Elands-fontein (Sydafrika), Kabwe (Zambia) og Bodo (Etiopien). Overgangsformene, der nogle gange samles under artsbetegnelsen H. helmei omfatter bl.a. kraniet fra Florisbad (Sydafrika), fossiler fra Ngaloba (Tanzania), Omo- Kibish 2 (Etiopien) og flere fossiler fra Jebel Irhoud (Marokko). De fuldt moderne former er nævnt ovenfor. De arkaiske fossiler er alle mere end år gamle, mens overgangsformerne er fra til år gamle (Florisbad-fossilet er dog år), og de moderne er yngre end år. Hvis man derfor skal sammenfatte, hvad fossilerne fortæller om oprindelsen af det moderne menneske, peger de relativt klart på Fortrængningsmodellen frem for den Multiregionale Model. I næste nummer af Aktuel Naturvidenskab skal vi se på, hvordan molekylærgenetiske undersøgelser kan bidrage til afklaring af spørgsmålet om oprindelsen af det moderne menneske. (Artiklen fortsættes i næste nr) Om forfatteren Peter K.A. Jensen er adm. overlæge ved Klinisk genetisk Afdeling, Århus Universitetshospital Universitetsparken, Bartholinbygn Århus C Tlf.: Yderligere læsning Peter K.A. Jensen. Menneskets oprindelse og udvikling. Gads forlag, (Ny opdateret udgave udkommer efteråret 2001.) Johanson D, & Edgar, B. From Lucy to language. Simon & Schuster, 1996.

Poul Erik Lindelof. Homo Erectus, den længst eksisterende menneskeart, men den, hvorom vi ved mindst.

Poul Erik Lindelof. Homo Erectus, den længst eksisterende menneskeart, men den, hvorom vi ved mindst. Poul Erik Lindelof Afdelingen for Forhistorisk Arkæologi Saxo Instituttet, Københavns Universitet Homo Erectus, den længst eksisterende menneskeart, men den, hvorom vi ved mindst. I den arkæologiske litteratur

Læs mere

Da mennesket blev til 2. del genetiske undersøgelser

Da mennesket blev til 2. del genetiske undersøgelser 4 Da mennesket blev til 2. del genetiske undersøgelser Biaka pygmæ Nye molekylær-genetiske undersøgelser har kraftigt forøget vor viden om slægtskabet mellem de nulevende befolkningsgrupper og deres fælles

Læs mere

Moesgaards kulturarv. Moesgaard Museum har udover udstillinger også aktiviteter og events for publikum samt møde- og konferencefaciliteter

Moesgaards kulturarv. Moesgaard Museum har udover udstillinger også aktiviteter og events for publikum samt møde- og konferencefaciliteter Moesgaards kulturarv Moesgaard Museum er en kulturhistorisk museumsoplevelse i unikke rammer med enestående arkitektur midt i et skønt naturområde. Museet rummer arkæologiske og etnografiske udstillinger

Læs mere

Foredragsarrangement på Statens Naturhistoriske Museum d. 30.4.2013 Spørgsmål & svar. Hans Christian Petersen: De tidligste menneskeknogler i Danmark

Foredragsarrangement på Statens Naturhistoriske Museum d. 30.4.2013 Spørgsmål & svar. Hans Christian Petersen: De tidligste menneskeknogler i Danmark DE FØRSTE DANSKERE Foredragsarrangement på Statens Naturhistoriske Museum d. 30.4.2013 Spørgsmål & svar Hans Christian Petersen: De tidligste menneskeknogler i Danmark Ved man, hvorfor mænd havde bredere

Læs mere

De første mennesker. Titel. Forfatter. Hvad forestiller forsidebilledet? Hvad fortæller bagsideteksten om bogen?

De første mennesker. Titel. Forfatter. Hvad forestiller forsidebilledet? Hvad fortæller bagsideteksten om bogen? A FØR JEG LÆSER BOGEN Fakta om bogen Titel _ Forfatter Hvornår er bogen udgivet? _ På hvilken side findes Indholdsfortegnelse? _ Stikordsregister? Bøger og www? Hvor mange kapitler er der i bogen? Hvad

Læs mere

Ny viden om tamkattens oprindelse

Ny viden om tamkattens oprindelse Ny viden om tamkattens oprindelse Af Tommy Asferg Hvor stammer tamkatten fra? Det ligefremme svar er, at den stammer fra vildkatten. Men det er langtfra et udtømmende svar, for vildkatten findes i et antal

Læs mere

CRO MAGNON- MENNESKET

CRO MAGNON- MENNESKET 1 CRO MAGNON- MENNESKET Hvor kom det fra? Rolf Kenneth Myhre www.visdomsnettet.dk 2 CRO MAGNON-MENNESKET Hvor kom det fra? Af Rolf Kenneth Myhre (Oversættelse Ebba Larsen) Kom Cro Magnon mennesket fra

Læs mere

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer Eksamensspørgsmål til biobu maj 2013 1. Afrikansk plante med mulig gavnlig virkning på diabetes type II Forklar hvordan insulin er opbygget, dets dannelse og virkemåde. Hvad er årsagen til diabetes type

Læs mere

Oprindelsen af HOMO SAPIENS

Oprindelsen af HOMO SAPIENS Oprindelsen af HOMO SAPIENS (MOLEKYLÆR ANTROPOLOGI) 1 MONOGENESE MENNESKEHEDENS ENHED 2 3 ACCGTAAAGTTTGACCCAGATAGAGATTTTTTAAACGGGCCATAGCACACACACAGTCAGATAGAGATCAAAATGGGCCGTGGAAACCCGGGTTAAAAAAGTGCGT GTGTAAACACACACACACACACACAGTGTTGFACCAAAGTACAGATAGGATACACAGATAGCAGTAGACAGTAGATTTAGACAAAGTTTGCAGTTTGACCCAGATAG

Læs mere

Stonehenge i England har måske en længere historie end tidligere antaget

Stonehenge i England har måske en længere historie end tidligere antaget Studiekreds 2015-3 Sidste gang beskæftigede vi os primært med de relativt ny-opdagede (1994) megalit-anlæg i det anatolske område i det sydøstlige Tyrkiet. Selvom anlæggenes akse-orienteringer tydeligvis

Læs mere

700.000 ÅR GAMMELT DNA

700.000 ÅR GAMMELT DNA Spørgsmål & svar 700.000 ÅR GAMMELT DNA Foredragsarrangement på Statens Naturhistoriske Museum d. 9.10.2013 Morten Allentoft: Fossilt DNA - et vindue til fortiden Når man sammenligner arters slægtskab

Læs mere

Neandertalere i Danmark?

Neandertalere i Danmark? 30.04.2014 Neandertalere i Danmark? - Lillebæltsområdet Ph.d. Trine Kellberg Nielsen Aarhus Universitet farktnielsen@cas.au.dk 1 Lidt om mig og mit arbejde 2 Evolution og tidlig kolonisering ca. 800.000

Læs mere

DEN NY VERDEN 2008:3 Udviklingssamarbejde anno 2020

DEN NY VERDEN 2008:3 Udviklingssamarbejde anno 2020 DEN NY VERDEN 2008:3 Udviklingssamarbejde anno 2020 1 Stig Jensen Boganmeldelse Klaus Winkel: Hvorfor er det så svært for Afrika? København 2008: Geografforlaget og Mellemfolkeligt Samvirke Forventningerne

Læs mere

Millioner år. H. sapiens. Pt. verus. Pt. vellerosus. Pt. paniscus. Pt. schweinfurthii. Pt. troglodytes

Millioner år. H. sapiens. Pt. verus. Pt. vellerosus. Pt. paniscus. Pt. schweinfurthii. Pt. troglodytes udvekslingsmuligheder, som benytter sig af alle mulige tricks lige fra øgede mutationsfrekvenser i de enkelte aminosyrer over større udskiftninger af DNA-stumper til kæmpe omstruktureringer i hele genomet.

Læs mere

Geologi 2009 Bogen Geografi C s Hvad hedder teorien om universets dannelse og hvornår menes det at have fundet sted?

Geologi 2009 Bogen Geografi C s Hvad hedder teorien om universets dannelse og hvornår menes det at have fundet sted? Geologi 2009 Bogen Geografi C s. 9 27 Spørgsmål til teksten besvares under læsningen. Jordens dannelse og sporene efter liv 1. Hvorfor kan de geologiske processer ikke eftervises i laboratorium forsøg?

Læs mere

Kulstof-14 datering. Første del: Metoden. Isotoper af kulstof

Kulstof-14 datering. Første del: Metoden. Isotoper af kulstof Kulstof-14 datering Første del: Metoden I slutningen af 1940'erne finder et team på University of Chicago under ledelse af Willard Libby ud af, at man kan bruge det radioaktive stof kulstof 14 ( 14 C),

Læs mere

Historisk geologi 2. Kvarter Palæozoikum

Historisk geologi 2. Kvarter Palæozoikum Historisk geologi 2. Kvarter Palæozoikum DEN KAMBRISKE EKSPLOSION Den kambriske eksplosion Hovedgruppernes opståen ud fra geologiske vidnesbyrd Doushantuo Formation, Kina Fund senest dateret til 570 mio.

Læs mere

1. Hvorfor kan de geologiske processer ikke eftervises i laboratorium forsøg?

1. Hvorfor kan de geologiske processer ikke eftervises i laboratorium forsøg? Grundbogstekst: Tomas Westh Nørrekjær m.fl.: " Naturgeografi C, s. 8-27 Spørgsmål til teksten besvares under læsningen. Jordens dannelse og sporene efter liv 1. Hvorfor kan de geologiske processer ikke

Læs mere

(Farve)Genetik hos katte

(Farve)Genetik hos katte Genetikserie del 4 (Farve)Genetik hos katte Kattegenetik baseret på farver og mønstre [Wb ] / [ wb ] Wide band Indledningsvis må jeg sige, at dette gen endnu ikke er bekræftet eller fundet, men alle forhold

Læs mere

Mellemøsten før 1400. Persere, arabere og tyrkere. Perserriget. Romerriget. Vidste du, at.. De arabiske storriger. Arabisk kultur og sprog.

Mellemøsten før 1400. Persere, arabere og tyrkere. Perserriget. Romerriget. Vidste du, at.. De arabiske storriger. Arabisk kultur og sprog. Historiefaget.dk: Mellemøsten før 1400 Mellemøsten før 1400 Mellemøstens historie før 1400 var præget af en række store rigers påvirkning. Perserriget, Romerriget, de arabiske storriger og det tyrkiske

Læs mere

Velkommen! Held og lykke! Redaktionen. Redaktionen består af: Karl Kristian Obling Knudsen Rasmussen. Malthe Carl Hougaard Vang. Alfred Hald Buksti

Velkommen! Held og lykke! Redaktionen. Redaktionen består af: Karl Kristian Obling Knudsen Rasmussen. Malthe Carl Hougaard Vang. Alfred Hald Buksti 1 2 Indholdsfortegnelse Side 4 Leder Side 5 Evolution Hvad er det? Side 6-7.. En lang og kroget vej Side 8-9 Mennesket De bedste til at tilpasse sig Side 11-13.Derfor blev Homo sapiens den dominerende

Læs mere

Lars Andersen: Anvendelse af statistik. Notat om deskriptiv statistik, χ 2 -test og Goodness of Fit test.

Lars Andersen: Anvendelse af statistik. Notat om deskriptiv statistik, χ 2 -test og Goodness of Fit test. Lars Andersen: Anvendelse af statistik. Notat om deskriptiv statistik, χ -test og Goodness of Fit test. Anvendelser af statistik Statistik er et levende og fascinerende emne, men at læse om det er alt

Læs mere

O V E R L E V E L S E N S A B C

O V E R L E V E L S E N S A B C Lærervejledning Charles Darwins evolutionsteori om artsdannelse bygger på begreberne variation og selektion og er et fundamentalt emne, da den er teorigrundlaget for hele videnskabsfaget biologi. Det er

Læs mere

www.share-project.dk Resultater fra 50+ i Europa undersøgelsen

www.share-project.dk Resultater fra 50+ i Europa undersøgelsen www.share-project.dk Resultater fra 50+ i Europa undersøgelsen Hvad skal der ske fremover? Det næste der skal ske med 50+ i Europa, er at tidligere interviewede personers livshistorie skal tilføjes den

Læs mere

SBM983 Kildebjerg Etape II Bygherrerapport

SBM983 Kildebjerg Etape II Bygherrerapport SBM983 Kildebjerg Etape II Bygherrerapport Dover sogn, Hjemslev Herred, tidl. Skanderborg Amt. Stednummer: 16.02.03. sb. nr. 263 Ved en arkæologisk undersøgelse af et ca. 400 meter langt vejtracé og en

Læs mere

Hvad ved vi om HC i Kina?

Hvad ved vi om HC i Kina? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Kinesisk Huntingtons Chorea-netværk lanceret Kinesisk HC-netværk er blevet lanceret. En god nyhed

Læs mere

Positiv effekt af omstridt pointsystem på dansk forskningsproduktion Ingwersen, Peter; Larsen, Birger

Positiv effekt af omstridt pointsystem på dansk forskningsproduktion Ingwersen, Peter; Larsen, Birger university of copenhagen University of Copenhagen Positiv effekt af omstridt pointsystem på dansk forskningsproduktion Ingwersen, Peter; Larsen, Birger Published in: Videnskab.dk Publication date: 2014

Læs mere

PJ 2014. Geologisk datering. En tekst til brug i undervisning i Geovidenskab A. Philip Jakobsen, 2014

PJ 2014. Geologisk datering. En tekst til brug i undervisning i Geovidenskab A. Philip Jakobsen, 2014 Geologisk datering En tekst til brug i undervisning i Geovidenskab A Philip Jakobsen, 2014 Spørgsmål og forslag til forbedringer sendes til: pj@sg.dk 1 Indledning At vide hvornår noget er sket er en fundamental

Læs mere

Massespektrometri og kulstof-14-datering

Massespektrometri og kulstof-14-datering Massespektrometri og kulstof-14-datering Opgavehæfte AMS 14 C Daterings Center Institut for Fysik og Astronomi, Aarhus Universitet JO\ AUG 2004 BP\FEB 2010 Opgaverne 5,6 og 7 er hentet eller modificeret

Læs mere

Uran i Universet og i Jorden

Uran i Universet og i Jorden Uran i Universet og i Jorden Leif Thorning; uddannet i England og Danmark som geofysiker, forhenværende statsgeolog, fra GEUS (De Nationale Geologiske Undersøgelser for Danmark og Grønland) Har i 40 år,

Læs mere

MENNESKET er et dyr. - Jeg har ANTROPOLOGI AF DORTHE LA COUR

MENNESKET er et dyr. - Jeg har ANTROPOLOGI AF DORTHE LA COUR ANTROPOLOGI AF DORTHE LA COUR MENNESKET er et dyr At mennesket og de andre aber er i familie med hinanden, kan ses med det blotte øje. Antropologisk psykolog Jill Byrnit har arbejdet med slægtskabet i

Læs mere

Fremtidens menneske det perfekte menneske? (da-bio)

Fremtidens menneske det perfekte menneske? (da-bio) Fremtidens menneske det perfekte menneske? (da-bio) Jeg har valgt at beskæftige mig med fremtidens menneske. For at belyse dette emne bedst muligt har jeg valgt fagene biologi og dansk. Ud fra dette emne,

Læs mere

Basis for yderligere guldefterforskning på Storø i Grønland

Basis for yderligere guldefterforskning på Storø i Grønland Nuuk, 25.april 2006 Meddelelse nr. 8/2006 Basis for yderligere guldefterforskning på Storø i Grønland Resultaterne af NunaMinerals kerneboringer på Storø i 2005 viser, at de guldførende strukturer findes

Læs mere

O V E R L E V E L S E N S A B C

O V E R L E V E L S E N S A B C Lærervejledning Charles Darwins evolutionsteori om artsdannelse bygger på begreberne variation og selektion og er et fundamentalt emne, da den er teorigrundlaget for hele videnskabsfaget biologi. Det er

Læs mere

Lærervejledning danskedinosaurer.dk

Lærervejledning danskedinosaurer.dk Lærervejledning danskedinosaurer.dk Af Henrik Nørregaard, Naturfagskonsulent Indhold, lærervejledning: Bag om danskedinosaurer.dk Emne og målgruppe Fælles Mål Anvendelighed i forhold til klassetrin Forslag

Læs mere

Livets leksikon åbner Danske forskere bag ny hjemmeside med alt om livets udvikling

Livets leksikon åbner Danske forskere bag ny hjemmeside med alt om livets udvikling Pressemeddelelse fra Aarhus Universitet og Københavns Universitet Livets leksikon åbner Danske forskere bag ny hjemmeside med alt om livets udvikling Klausul: Historien må først offentliggøres søndag aften,

Læs mere

Kulturstyrelsen H. C: Andersens Boulevard København V 14/10/2014 KNV Kildevej KUAS j. nr /KNV-0031

Kulturstyrelsen H. C: Andersens Boulevard København V 14/10/2014 KNV Kildevej KUAS j. nr /KNV-0031 Kulturstyrelsen H. C: Andersens Boulevard 2 1553 København V 14/10/2014 KNV00247-02-62 Kildevej KUAS j. nr. 2014-7.24.02/KNV-0031 Vedr: Arkæologisk undersøgelse forud for udstykning ved Havdrup Vest Museum

Læs mere

Kulturhistorisk rapport for arkæologisk undersøgelse ved Kirkebjerggård

Kulturhistorisk rapport for arkæologisk undersøgelse ved Kirkebjerggård Kulturhistorisk rapport for arkæologisk undersøgelse ved Kirkebjerggård Journalnr.: SIM 32/2010 Sted og sb. nr.: 130303-211 KUAS j.nr.: 2009-7.24.02/SIM-0009 Sted: Kirkebjeggård Matr. nr.: 1an og 19bd

Læs mere

STATSBORGERSKAB OG HERKOMST I ÅRHUS KOMMUNE PR. 1. JAN. 1997

STATSBORGERSKAB OG HERKOMST I ÅRHUS KOMMUNE PR. 1. JAN. 1997 Nr. 1.03 April 1997 STATSBORGERSKAB OG HERKOMST I ÅRHUS KOMMUNE PR. 1. JAN. 1997 x Informationen omfatter en opgørelse over antallet af borgere med henholdsvis udenlandsk statsborgerskab og udenlandsk

Læs mere

STATSBORGERSKAB OG HERKOMST I ÅRHUS KOMMUNE PR. 1. JULI 1998

STATSBORGERSKAB OG HERKOMST I ÅRHUS KOMMUNE PR. 1. JULI 1998 Nr. 1.10 Sept. 1998 STATSBORGERSKAB OG HERKOMST I ÅRHUS KOMMUNE PR. 1. JULI 1998. x Informationen omfatter en opgørelse over antallet af borgere med henholdsvis udenlandsk statsborgerskab og udenlandsk

Læs mere

www.cfufilmogtv.dk Tema: Evolution Fag: biologi Målgruppe: 7.-9. kl. Titel: Menneskets opståen del 1+2 Opgaver Elev Darwins Farlige Tanker del 1+2

www.cfufilmogtv.dk Tema: Evolution Fag: biologi Målgruppe: 7.-9. kl. Titel: Menneskets opståen del 1+2 Opgaver Elev Darwins Farlige Tanker del 1+2 Tema: Evolution Fag: biologi Målgruppe: 7.-9. kl. Menneskets opståen 1+2 Darwins farlige tanker del 1+2" Alle billeder i denne pædagogiske vejledning er fra tv-udsendelserne. Elevopgaver til del 1 Tv-udsendelserne

Læs mere

11. november 2016 Verden investerer vedvarende i vedvarende energi Side 1 NOVEMBER Verden investerer vedvarende i vedvarende energi

11. november 2016 Verden investerer vedvarende i vedvarende energi Side 1 NOVEMBER Verden investerer vedvarende i vedvarende energi 11. november 2016 Verden investerer vedvarende i vedvarende energi Side 1 NOVEMBER 2016 Verden investerer vedvarende i vedvarende energi 11. november 2016 Verden investerer vedvarende i vedvarende energi

Læs mere

Skriveråd til webnyheder

Skriveråd til webnyheder Skriveråd til webnyheder Webnyheders anatomi: Klar, informativ og fængende rubrik Underrubrik med artiklens vigtigste budskaber skrevet letlæseligt. Læseren skal kunne nøjes med rubrik og underrubrik for

Læs mere

Karakteristik af stemmeberettigede EU-borgere

Karakteristik af stemmeberettigede EU-borgere Karakteristik af stemmeberettigede EU-borgere Af Teis Bay Andersen, TEBA@kl.dk Dato: 10. oktober 2017 Sags ID: SAG-2017-01647 Dok. ID: 2414787 Analysens hovedkonklusioner E-mail: TEBA@kl.dk Direkte: 3370

Læs mere

Præstebakken Ramløse GIM 3964 Sb UDGRAVNINGSRAPPORT v. Kjartan Langsted

Præstebakken Ramløse GIM 3964 Sb UDGRAVNINGSRAPPORT v. Kjartan Langsted Præstebakken Ramløse GIM 3964 Sb. 010109-155 UDGRAVNINGSRAPPORT v. Kjartan Langsted Fig.1 Placering af udgravningsområdet(markeret med rød plet). Fig. 2 I området ud mod Ramløse Å er der flere lokaliteter

Læs mere

Digital på gravning en anden etnografi i felten

Digital på gravning en anden etnografi i felten Når arkæologisk viden bliver til af Jette Rostock Københavns Universitet 2009 Digital på gravning en anden etnografi i felten Under min etnografiske undersøgelse i forbindelse med den arkæologiske udgravning

Læs mere

BRITISK EUROSKEPSIS ER MERE ØKONOMISK END DEN DANSKE

BRITISK EUROSKEPSIS ER MERE ØKONOMISK END DEN DANSKE BRITISK EUROSKEPSIS ER MERE ØKONOMISK END DEN DANSKE Kontakt: Forskningschef, Catharina Sørensen +45 21 54 88 21 cas@thinkeuropa.dk RESUME Den britiske afstemning om EU-medlemskabet har affødt lignende

Læs mere

&' ( & &'& % ( & &'&'& ))! & &'&'" ( * &'&'+, ( $ &'" - ( "" &'"'&! ))! "" &'"'"! ( ". &'"'+,! ( "/

&' ( & &'& % ( & &'&'& ))! & &'&' ( * &'&'+, ( $ &' - (  &''&! ))!  &''! ( . &''+,! ( / " $ % &' ( & &'& % ( & &'&'& & &'&'" ( * &'&', ( $ &'" - ( "" &'"'& "" &'"'" ( ". &'"', ( "/ &' ( Pendleranalyserne gennemføres forud for fire surveys med henholdsvis beboere i bycentre, beboere i landdistrikter,

Læs mere

Skabelsesberetninger

Skabelsesberetninger Troels C. Petersen Niels Bohr Instituttet Big Bang til Naturvidenskab, 7. august 2017 Skabelsesberetninger 2 Tidlig forestilling om vores verden 3 13.8 milliarder år siden Big Bang 4 Universets historie

Læs mere

Rapport fra arkæologisk undersøgelse i Kongens Tisted Kirke, Gislum Herred, Aalborg Amt, d. 21. juli og 5. august 2009.

Rapport fra arkæologisk undersøgelse i Kongens Tisted Kirke, Gislum Herred, Aalborg Amt, d. 21. juli og 5. august 2009. Rapport fra arkæologisk undersøgelse i Kongens Tisted Kirke, Gislum Herred, Aalborg Amt, d. 21. juli og 5. august 2009. J. 549/2009 Stednr. 12.02.08 Rapport ved museumsinspektør Hans Mikkelsen d. 25. november

Læs mere

KØN I HISTORIEN. Agnes S. Arnórsdóttir og Jens A. Krasilnikoff. Redigeret af. Aar h u s Uni v e r sit e t s forl a g

KØN I HISTORIEN. Agnes S. Arnórsdóttir og Jens A. Krasilnikoff. Redigeret af. Aar h u s Uni v e r sit e t s forl a g KØN I HISTORIEN Redigeret af Agnes S. Arnórsdóttir og Jens A. Krasilnikoff Aar h u s Uni v e r sit e t s forl a g Køn i historien Køn i historien Redigeret af Agnes S. Arnórsdóttir & Jens A. Krasilnikoff

Læs mere

Skruedyrenes evolution

Skruedyrenes evolution Skruedyrenes evolution Materialer: 8 forskellige søm og skruer per hold. Formål: At tegne et slægtskabstræ udfra morfologiske karaktertræk Når arterne er blevet indsamlet og identificeret, skal de systematiseres.

Læs mere

Geo-Nyt 82. september Geografilærerforeningen for gymnasiet og HF

Geo-Nyt 82. september Geografilærerforeningen for gymnasiet og HF Geo-Nyt 82 september 2014 Geografilærerforeningen for gymnasiet og HF Af Ole Bay, Aalborg Katedralskole Om metode i naturgeografi Jeg har selv oplevet fremgangsmåden i min undervisning geografi som at

Læs mere

Verdens fattige flytter til byen

Verdens fattige flytter til byen Verdens fattige flytter til byen Af Henrik Valeur, 2010 Om 20 år vil der være to milliarder flere byboere end i dag. Den udviklingsbistand, verden har brug for, er derfor byudviklingsbistand. FN forventer,

Læs mere

Darwin som geolog og palæontolog. Resuméer af foredrag

Darwin som geolog og palæontolog. Resuméer af foredrag Darwin som geolog og palæontolog Resuméer af foredrag Møde i Dansk Geologisk Forening 17. december 2009 Program 17.00 Velkomst ved Bent Lindow 17.05 Hanne Strager (SNM): Darwins videnskabelige karriere

Læs mere

Kig efter det gule på de kinesiske skarver

Kig efter det gule på de kinesiske skarver Kig efter det gule på de kinesiske skarver Af Ole Friis Larsen Vi kan se to underarter af Storskarven i Danmark. Det er ikke let at se forskel på dem, for de er næsten ens, men det kan lade sig gøre at

Læs mere

Skive Museum. Bygherrerapport SMS 972 A Sæbyvej Harre herred, Viborg amt Sted nr. 13.02.05

Skive Museum. Bygherrerapport SMS 972 A Sæbyvej Harre herred, Viborg amt Sted nr. 13.02.05 Skive Museum Bygherrerapport SMS 972 A Sæbyvej Harre herred, Viborg amt Sted nr. 13.02.05 Peter Birkedahl * 2007 1. Indledning Skive Museum har i januar 2007 foretaget udgravning af et bopladsområde fra

Læs mere

Dansk-historieopgaven (DHO) skrivevejledning

Dansk-historieopgaven (DHO) skrivevejledning Dansk-historieopgaven (DHO) skrivevejledning Indhold Formalia, opsætning og indhold... Faser i opgaveskrivningen... Første fase: Idéfasen... Anden fase: Indsamlingsfasen... Tredje fase: Læse- og bearbejdningsfasen...

Læs mere

Neandertalerne. videnskaben i almindelighed. Dette skyldes, at neandertalerne var de første fossile fortidsmennesker,

Neandertalerne. videnskaben i almindelighed. Dette skyldes, at neandertalerne var de første fossile fortidsmennesker, 10 A k t u e l N a t u r v i d e n s k a b 6 2 0 0 6 Neandertalerne - istidens hårdføre menneske-art For 150 år siden så det første fund af en uddød menneskeart neandertaleren dagens lys. Ingen viste på

Læs mere

(bogudgave: ISBN , 2.udgave, 4. oplag)

(bogudgave: ISBN , 2.udgave, 4. oplag) Videnskabsteori 1. e-udgave, 2007 ISBN 978-87-62-50223-9 1979, 1999 Gyldendalske Boghandel, Nordisk Forlag A/S, København Denne bog er beskyttet af lov om ophavsret. Kopiering til andet end personlig brug

Læs mere

Abemennesker. og jagten på. menneskets oprindelse. En oversigtsartikel. besvare sådanne spørgsmål. De racemæssige skel anses alle for at være

Abemennesker. og jagten på. menneskets oprindelse. En oversigtsartikel. besvare sådanne spørgsmål. De racemæssige skel anses alle for at være Abemennesker og jagten på menneskets oprindelse En oversigtsartikel besvare sådanne spørgsmål. De racemæssige skel anses alle for at være overfladiske variationer inden for arten Homo sapiens. Men hvad

Læs mere

Skriftlig genre i dansk: Kronikken

Skriftlig genre i dansk: Kronikken Skriftlig genre i dansk: Kronikken I kronikken skal du skrive om et emne ud fra et arbejde med en argumenterende tekst. Din kronik skal bestå af tre dele 1. Indledning 2. Hoveddel: o En redegørelse for

Læs mere

LP-HÆFTE 2010 - SOCIAL ARV

LP-HÆFTE 2010 - SOCIAL ARV LP-HÆFTE 2010 - SOCIAL ARV Indhold Indledning... 1 Forståelsen af social arv som begreb... 1 Social arv som nedarvede sociale afvigelser... 2 Arv af relativt uddannelsesniveau eller chanceulighed er en

Læs mere

Fastlæggelse af indvandringsomfanget i Befolkningsfremskrivning 2016

Fastlæggelse af indvandringsomfanget i Befolkningsfremskrivning 2016 Bilag 3: Notat om metode for indregning af flygtninge i landsfremskrivningen og i den kommunale fremskrivning 26. april 2016 Fastlæggelse af indvandringsomfanget i Befolkningsfremskrivning 2016 De seneste

Læs mere

Diskussionspapir 17. november 2014

Diskussionspapir 17. november 2014 Diskussionspapir 17. november 2014 Tema 1: Langsigtede udviklingstræk fra industri til service og fra land til by Forberedt for Ministeriet for By, Bolig og Landdistrikter til konferencen Industrien til

Læs mere

Dansk og/eller Samtidshistorieopgaven

Dansk og/eller Samtidshistorieopgaven Dansk og/eller Samtidshistorieopgaven I skal i løbet af 2. år på HH skrive en større opgave i Dansk og /eller Samtidshistorie. Opgaven skal i år afleveres den 7/12-09 kl. 12.00 i administrationen. I bekendtgørelsen

Læs mere

Fuglehåndbogen på Nettet (BBJ) (vs.1.1:04.09.2015) Gærdesmutte

Fuglehåndbogen på Nettet (BBJ) (vs.1.1:04.09.2015) Gærdesmutte Gærdesmutte Videnskabeligt navn: Troglodytes troglodytes (L) I Danmark yngler en art af slægten Troglodytes, der er en del af gærdesmuttefamilien. Gærdesmuttefamilien som omfatter godt 80 arter, fordelt

Læs mere

1.søndag efter trinitatis, den 2. juni 2013 Vor Frue Kirke kl. 10. Tekst: Luk 16,19-31 Salmer: 745, 434, 696, 614, 292, 685 v.

1.søndag efter trinitatis, den 2. juni 2013 Vor Frue Kirke kl. 10. Tekst: Luk 16,19-31 Salmer: 745, 434, 696, 614, 292, 685 v. 1 1.søndag efter trinitatis, den 2. juni 2013 Vor Frue Kirke kl. 10 Jesper Stange Tekst: Luk 16,19-31 Salmer: 745, 434, 696, 614, 292, 685 v.4, 375 Gud, lad os leve af dit ord Som dagligt brød på denne

Læs mere

Gudstjeneste og sabbat hører sammen. Sabbatten er dagen for gudstjeneste. Når der derfor i en bibelsk sammenhæng tales om sabbatten, må gudstjenesten

Gudstjeneste og sabbat hører sammen. Sabbatten er dagen for gudstjeneste. Når der derfor i en bibelsk sammenhæng tales om sabbatten, må gudstjenesten I. Indledning Gudstjeneste og sabbat hører sammen. Sabbatten er dagen for gudstjeneste. Når der derfor i en bibelsk sammenhæng tales om sabbatten, må gudstjenesten tænkes med. Sabbatten spiller en stor

Læs mere

Appetitvækkende rollespil om verdens uligheder. Uretfærdig middag

Appetitvækkende rollespil om verdens uligheder. Uretfærdig middag Appetitvækkende rollespil om verdens uligheder Uretfærdig middag Befolkning Vand Verdens befolkning har meget forskellige levevilkår. Du mærkede nogle af forskellene på din egen krop ved den uretfærdige

Læs mere

1. Indledning. Hvad er folkesundhed?

1. Indledning. Hvad er folkesundhed? 1. Indledning Det er hensigten med denne bog om folkesundhed i Grønland at give en samlet fremstilling af en række større sundhedsproblemer. Den umiddelbare årsag til at bogen skrives netop nu er, at Hjemmestyret

Læs mere

Historien om HS og kræft

Historien om HS og kræft Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Hvad er sammenhængen mellem Huntingtons Sygdom og kræft? HS-patienter har mindre risiko for at

Læs mere

Få hindringer på de nære eksportmarkeder

Få hindringer på de nære eksportmarkeder ERHVERVSØKONOMISK ANALYSE Juni 215 Få hindringer på de nære eksportmarkeder Danske virksomheder oplever få hindringer ved salg til nærmarkederne, mens salg til udviklingslande og emerging markets uden

Læs mere

Gråkrage/Sortkrage. Fuglehåndbogen på Nettet (BBJ) (vs.1.0:24.02.2016) Videnskabelige navne Gråkrage (Corvus cornix) (L) Sortkrage (Corvus corone) (L)

Gråkrage/Sortkrage. Fuglehåndbogen på Nettet (BBJ) (vs.1.0:24.02.2016) Videnskabelige navne Gråkrage (Corvus cornix) (L) Sortkrage (Corvus corone) (L) Gråkrage/Sortkrage Øverst gråkrage, nederst sortkrage, som dog har spor af gråkrage i sig Videnskabelige navne Gråkrage (Corvus cornix) (L) Sortkrage (Corvus corone) (L) 1 Status og udbredelse Gråkragen

Læs mere

50 pct. flere ikke-vestlige efterkommere dømmes for kriminalitet sammenlignet med personer med dansk baggrund

50 pct. flere ikke-vestlige efterkommere dømmes for kriminalitet sammenlignet med personer med dansk baggrund Nyt fra April 5 5 pct. flere ikke-vestlige efterkommere dømmes for kriminalitet sammenlignet med personer med dansk baggrund Efterkommere af ikke-vestlige indvandrere er mere kriminelle end danskere. Når

Læs mere

Tegning/Todimensionale billeder

Tegning/Todimensionale billeder Tegning/Todimensionale billeder - TEGNETEKNIKKER, REDSKABER OG OPGAVER At tegne er en proces, en måde at skildre på. Hemmeligheden ved en vellykket tegning er en omhyggelig iagttagelse, en forenkling af

Læs mere

Kulturhistorisk rapport

Kulturhistorisk rapport NORDJYLLANDS HISTORISKE MUSEUM Kulturhistorisk rapport Gunderup syd for Mariager Velbevaret hustomt fra overgangen mellem bronze- og jernalder. J.nr. ÅHM 6495 December 2015 Ved Arkæolog Karen Povlsen Telefon:

Læs mere

QuizzEuropa - et brætspil om et andet Europa

QuizzEuropa - et brætspil om et andet Europa HistorieLab http://historielab.dk QuizzEuropa - et brætspil om et andet Europa Date : 5. april 2016 Bliv udfordret på din sammenhængsforståelse for Europas historie, kulturelle mangfoldighed og politiske

Læs mere

Fremstillingsformer i historie

Fremstillingsformer i historie Fremstillingsformer i historie DET BESKRIVENDE NIVEAU Et referat er en kortfattet, neutral og loyal gengivelse af tekstens væsentligste indhold. Du skal vise, at du kan skelne væsentligt fra uvæsentligt

Læs mere

3.4 TERRITORIER MED SÄRSKILD STATSRÄTTSLIG

3.4 TERRITORIER MED SÄRSKILD STATSRÄTTSLIG 3.4 TERRITORIER MED SÄRSKILD STATSRÄTTSLIG STATUS 3.4.1 FORVALTNING I GRØNLAND. MELLEM NATIONALSTAT OG KOMMUNE. ANNE SKORKJÆR BINDERKRANTZ Et ofte overset aspekt i nordisk forvaltningsforskning drejer

Læs mere

Landskabskarakterbeskrivelse. Landskabsvurdering. Anbefalinger til planlægningen SYDVEST MORS

Landskabskarakterbeskrivelse. Landskabsvurdering. Anbefalinger til planlægningen SYDVEST MORS Landskabskarakterbeskrivelse Landskabsvurdering Anbefalinger til planlægningen SYDVEST MORS Sydvest Mors Landskabskarakterbeskrivelse Beliggenhed og afgrænsning Landskabskarakterområdet Sydvestmors omfatter

Læs mere

Indledning. Pædagogikkens væsen. Af Dorit Ibsen Vedtofte

Indledning. Pædagogikkens væsen. Af Dorit Ibsen Vedtofte Forord Pædagogik for sundhedsprofessionelle er i 2. udgaven gennemskrevet og suppleret med nye undersøgelser og ny viden til at belyse centrale pædagogiske begreber, der kan anvendes i forbindelse med

Læs mere

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer Eksamensspørgsmål til biobu juni 2012 1. Afrikansk plante med mulig gavnlig virkning på diabetes type II Forklar hvordan insulin er opbygget, dets dannelse og virkemåde. Hvad er årsagen til diabetes type

Læs mere

Vesthimmerlands Museum

Vesthimmerlands Museum Vesthimmerlands Museum Bygherrerapport for VMÅ 2466 Øster Ørbæk Hustomt fra ældre bronzealder Bygherrerapport for VMÅ 2466 Øster Ørbæk Indholdsfortegnelse 1. Indledning...3 2. Landskabet og kulturhistorien...3

Læs mere

Eksponentielle sammenhænge

Eksponentielle sammenhænge Eksponentielle sammenhænge 0 1 2 3 4 5 6 7 8 9 10 11 12 13 Indholdsfortegnelse Variabel-sammenhænge... 1 1. Hvad er en eksponentiel sammenhæng?... 2 2. Forklaring med ord af eksponentiel vækst... 2, 6

Læs mere

Supplerende materialer

Supplerende materialer Myrthuegård Natur- & Kulturformidlingscenter Supplerende materialer KLIMAREJSEN 2011 en rejse i tid Istiderne Danmark under sidste istid Weichsel-istiden Igennem de sidste 2 millioner år har klimaet skiftet

Læs mere

Side 1 af 5 Lyset for enden af tunnellen er ikke et modkørende eksprestog 30. marts 2012 - Af Jesper Lund, Delfin Invest A/S Jesper Lund har i sin portefølje, "Den tekniske investeringsportefølje", skaleret

Læs mere

Etablering og ekspansion på det tyske marked.

Etablering og ekspansion på det tyske marked. NORDKRON GmbH, Hamburg, 2013 Etablering og ekspansion på det tyske marked. Tyskland er et af Danmarks vigtigste ekportmarkeder; et nærmarked med stort potentiale og lige syd for grænsen. NORDKRON er en

Læs mere

ET STÆRKERE SOCIALT EU SPLITTER DANSKERNE

ET STÆRKERE SOCIALT EU SPLITTER DANSKERNE ET STÆRKERE SOCIALT EU SPLITTER DANSKERNE Kontakt: Forskningschef, Catharina Sørensen +45 54 88 cas@thinkeuropa.dk RESUME En ny måling foretaget af YouGov for Tænketanken EUROPA viser, at danskerne er

Læs mere

Dansk Clearinghouse for Uddannelsesforskning

Dansk Clearinghouse for Uddannelsesforskning DANSK CLEARINGHOUSE FOR UDDANNELSESFORSKNING ARTS AARHUS UNIVERSITET Dansk Clearinghouse for Uddannelsesforskning Institut for Uddannelse og Pædagogik (DPU) Arts Aarhus Universitet Notat om forskningskvalitet,

Læs mere

Årsplan 2013/2014 for biologi i 8. klasse

Årsplan 2013/2014 for biologi i 8. klasse Årsplan 2013/2014 for biologi i 8. klasse Lærer: khaled zaher Formål for faget biologi Formålet med undervisningen i biologi er, at eleverne tilegner sig viden om organismer, natur, miljø og sundhed med

Læs mere

Presseguide. 1. Forslag til pressearbejde før uddelingen den 11. september

Presseguide. 1. Forslag til pressearbejde før uddelingen den 11. september Presseguide Det lokale arbejde med pressen skaber opmærksomhed, der rækker ud over morgeneventen. Jeres indsats for at tiltrække god presseomtale er derfor et vigtigt bidrag til kampagnens succes. Denne

Læs mere

Indkredsning af de grundlæggende normative principper for økologisk jordbrug. Hugo F. Alrøe & Erik Steen Kristensen

Indkredsning af de grundlæggende normative principper for økologisk jordbrug. Hugo F. Alrøe & Erik Steen Kristensen Indkredsning af de grundlæggende normative principper for økologisk jordbrug Hugo F. Alrøe & Erik Steen Kristensen Forskningscenter for Økologisk Jordbrug www.foejo.dk Email: hugo.alroe (a) agrsci.dk www.alroe.dk/hugo

Læs mere

Årsplan for Biologi i 7. klasse

Årsplan for Biologi i 7. klasse Årsplan for Biologi i 7. klasse Undervisningen i biologi i 7. klasse, er bygget op som en blanding af klasseundervisning, gruppearbejde og individuel arbejde. Elevernes er medspiller og undervisningen

Læs mere

Demografi - Spørgsmål til teksten

Demografi - Spørgsmål til teksten Demografi - Spørgsmål til teksten Teksten kan hentes her http://www.frberg-hf.dk/otto/geografi/demografi/demografi-2016-side-1-18.pdf Befolkningsproblemet 1. Hvornår var der 1 mia. mennesker hvornår 2.

Læs mere

katalysatorer f i g u r 1. Livets undfangelse på et celluært plan.

katalysatorer f i g u r 1. Livets undfangelse på et celluært plan. Fra det øjeblik vi bliver undfanget i livmoderen til vi lukker øjnene for sidste gang, er livet baseret på katalyse. Livets undfangelse sker gennem en række komplicerede kemiske reaktioner og for at disse

Læs mere

Tyskland trækker væksten i SMV-eksporten 1 : SMV-eksportstatistikken opdateret med 2014-tal.

Tyskland trækker væksten i SMV-eksporten 1 : SMV-eksportstatistikken opdateret med 2014-tal. Tyskland trækker væksten i SMV-eksporten 1 : SMV-eksportstatistikken opdateret med 2014-tal. Eksportrådets statistik over SMV-eksporten er nu opdateret med 2014-tal. Eksportstatistikken, der er udviklet

Læs mere

Justitsministeriet Direktoratet for Kriminalforsorgen Straffuldbyrdelseskontoret Maj 2011

Justitsministeriet Direktoratet for Kriminalforsorgen Straffuldbyrdelseskontoret Maj 2011 Justitsministeriet Direktoratet for Kriminalforsorgen Straffuldbyrdelseskontoret Maj 2011 Opgørelse af indsatte og klienters etniske baggrund pr. 2. november 2010. Den nyeste opgørelse af indsatte og klienters

Læs mere