Genomisk selektion ny teknologi, der virker i praksis

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Genomisk selektion ny teknologi, der virker i praksis"

Transkript

1 Genomisk selektion ny teknologi, der virker i praksis Mogens Sandø Lund Guosheng Su Bernt Guldbrandtsen Aarhus Universitet DJF Inst for Genetik og Bioteknologi Foulum Dansk Kvæg Kongres 23. Februar 2009

2 Avlsværdier Fra afstamningsinformation til sand avlsværdi Afstamningsindeks Far Mor Far Mor Mendelsk udspaltning Mendelsk udspaltning Afkomsundersøgelse -> 5 år Genomisk -> Ved fødsel

3 Fra DNA til genomisk avlsværdi

4 baser 30 kromosomer Hvert kromosom er et langt DNA molekyle

5 Gen 1 Gen 2 ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCTAGCTAGCTAGGTACCACATATAGATACATC sekvens : opskriften på en given egenskaben Gen = en sekvens (ORD) som påvirker egenskaben Omkring gener

6 Gen 1 Gen 2 Tyr 1 Tyr 2 ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCTAGCTAGCTAGGTACCACATATAGATACATC ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCTAGCTAGCTAGGTACCACATATAGATACATC Tyr 3 Tyr 4 ATGACTAGGTCTCGATCGTCGCTATAGGGCTAGCTAGCTAGCTAGGTACCACATATAGATACATC ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCTAGCTAGCTAGGTACCACATATAGATACATC SNP Avlsværdi 1-2 Million SNPer De fleste uden effekt Vi ved ikke hvilke

7 Gen 1 Tyr 1 Tyr 2 ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCT AGCTAGCTAGG GACCACATATAGATA ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCT AGCTAGCTAGG TACCACATATAGATA Tyr 3 Tyr 4 ATGACTAGGTCTCGATCGTCGCTATAGGGCTCGCT TGCTAGCTAGG GACCACATATAGATA ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCT AGCTAGCTAGG TACCACATATAGATA SNP Avlsværdi

8 Gen 1 Tyr 1 Tyr 2 ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCT AGCTAGCTAGG CACCACATATAGATA ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCT AGCTAGCTAGG AACCACATATAGATA Tyr 3 Tyr 4 ATGACTAGGTCTCGATCGTCGCTATAGGGCTCGCT TGCTAGCTAGG CACCACATATAGATA ATGACTAGGTCTCGATCGTAGCTATAGGGCTAGCT AGCTAGCTAGG AACCACATATAGATA SNP Vi har brug for jævnt fordelte SNPer Avlsværdi

9 kromosom

10 kromosom QTL

11 QTL Mange SNPer Hver SNP udtrykkes som 0 eller 1

12 Mange SNPer Hver SNP udtrykkes som 0 eller 1 Beregne forskellen mellem 0 og 1 (SNP effekt) Genomisk avlsværdi = sum af SNP effekterne

13 Genomisk avlsværdi SNP GAV = SNP 1 + SNP 2 + SNP SNP 54000

14 Genomisk avlsværdi SNP SNP Tyr = -11 Tyr = +15

15 Genomisk selektion Genomisk model Værdi af hver markør Reference-gruppe Stor, bred base, balanceret 2100 tyre SNPer Kandidater SNPer Avlsværdier Genomiske avlsværdier

16 Virker genomisk selektion i praksis?

17 2002 Genomisk model Værdi af hver markør Reference-gruppe 1800 tyre (->2002) SNPer Kandidater SNPer Avlsværdier Genomiske avlsværdier

18 2008 Genomisk model Værdi af hver markør Reference-gruppe 1800 tyre SNPer Kandidater SNPer Kandidater døtre Avlsværdier Genomiske avlsværdier? traditionelle avlsværdier

19 Sikkerhed på genomiske avlsværdier NAV avlsværdier Genomiske Avlsværdier

20 Egenskab Afstamningsindeks Øvrige Sygdomme Holdbarhed Frugtbarhed Kælvningsevne Fødselsindeks Lemmer Yversundhed Temperament Malkbarhed Malkeorganer M-indeks F-indeks P-indeks Y-indeks Sikkerheder GAV Afkomsundersøgelse

21 Egenskab Afstamningsindeks Sikkerheder GAV Afkomsundersøgelse Øvrige Sygdomme Holdbarhed Frugtbarhed Kælvningsevne Fødselsindeks Lemmer Yversundhed Temperament Malkbarhed Malkeorganer M-indeks F-indeks P-indeks Y-indeks

22 Egenskab Afstamningsindeks Sikkerheder GAV Afkomsundersøgelse Øvrige Sygdomme Holdbarhed Frugtbarhed Kælvningsevne Fødselsindeks Lemmer Yversundhed Temperament Malkbarhed Malkeorganer M-indeks F-indeks P-indeks Y-indeks

23 Egenskab Afstamningsindeks Sikkerheder GAV Afkomsundersøgelse Øvrige Sygdomme Holdbarhed Frugtbarhed Kælvningsevne Fødselsindeks Lemmer Yversundhed Temperament Malkbarhed Malkeorganer M-indeks F-indeks P-indeks Y-indeks

24 Egenskab Afstamningsindeks Sikkerheder GAV Afkomsundersøgelse Øvrige Sygdomme Holdbarhed Frugtbarhed Kælvningsevne Fødselsindeks Lemmer Yversundhed Temperament Malkbarhed Malkeorganer M-indeks F-indeks P-indeks Y-indeks

25 Egenskab Afstamningsindeks Sikkerheder GAV Afkomsundersøgelse Øvrige Sygdomme Holdbarhed Frugtbarhed Kælvningsevne Fødselsindeks Lemmer Yversundhed Temperament Malkbarhed Malkeorganer M-indeks F-indeks P-indeks Y-indeks

26

27 Egenskab Sikkerheder Afstamningsindeks GAV GAV + afstamning Øvrige Sygdomme Holdbarhed Frugtbarhed Kælvningsevne Fødselsindeks Lemmer Yversundhed Temperament Malkbarhed Malkeorganer M-indeks F-indeks P-indeks Y-indeks

28 Sammendrag Genomisk selektion virker Vi har allerede modeller til effektiv genomisk selektion Høj sikkerhed for funktionelle egenskaber Balanceret avlsfremgang (Nordisk profil) Løbende forbedringer

Genomisk Selektion Fra DNA til genomisk avlsværdi

Genomisk Selektion Fra DNA til genomisk avlsværdi Genomisk Selektion Fra DNA til genomisk avlsværdi præsenteret af Gert Pedersen Aamand Personalemøde 20-8-2010 Genomisk selektion historien kort 2008 50.000 genmarkører kan bestemmes for hvert dyr Første

Læs mere

Klik på ikonet for at tilføje et billede NAV blended indeks

Klik på ikonet for at tilføje et billede NAV blended indeks NAV blended indeks Gert Pedersen Aamand og Anders Fogh NAV Blended indeks 1. Hvilke dyr skal have blended indeks? 2. Bag om DGV og EBV 3. Metode 4. Eksempel - input data til beregning 5. Foreløbige resultater

Læs mere

Nyheder - NAV rutine evaluering 2. maj 2014

Nyheder - NAV rutine evaluering 2. maj 2014 Nyheder - NAV rutine evaluering 2. maj 2014 Den seneste NAV evaluering af ydelse, frugtbarhed, eksteriør, yversundhed, øvrige sygdomme, kælvningsevne, malketid, temperament, vækst, holdbarhed, klovsundhed

Læs mere

Nyheder - NAV rutine evaluering 2. november 2013

Nyheder - NAV rutine evaluering 2. november 2013 Nyheder - NAV rutine evaluering 2. november 13 Den seneste NAV evaluering af ydelse, frugtbarhed, eksteriør, yversundhed, øvrige sygdomme, kælvningsevne, malketid, temperament, vækst, holdbarhed, klovsundhed

Læs mere

Er avlsmålet robust? Jørn Pedersen Dansk Kvæg, Afdeling for Specialviden. Dansk Landbrugsrådgivning

Er avlsmålet robust? Jørn Pedersen Dansk Kvæg, Afdeling for Specialviden. Dansk Landbrugsrådgivning Er avlsmålet robust? Jørn Pedersen Dansk Kvæg, Afdeling for Specialviden S-indekset revurderet 2002 Baseret på: Økonomisk analyse Avlspolitisk vurdering Forventning til produktionsvilkår 5-15 år frem Kan

Læs mere

Tyrevalget påvirker ydelse, sundhed og frugtbarhed, så det kan mærkes!

Tyrevalget påvirker ydelse, sundhed og frugtbarhed, så det kan mærkes! Tyrevalget påvirker ydelse, sundhed og frugtbarhed, så det kan mærkes! Dansk Kvægs Kongres 2007 Mandag den 26. februar i Herning Kongrescenter V/ landskonsulent Ulrik Sander Nielsen Dansk Kvæg, Afdeling

Læs mere

VikingGenetics har kurs mod bedre frugtbarhed. Avlsleder Peter G. Larson, VikingGenetics

VikingGenetics har kurs mod bedre frugtbarhed. Avlsleder Peter G. Larson, VikingGenetics VikingGenetics har kurs mod bedre frugtbarhed Avlsleder Peter G. Larson, VikingGenetics Disposition Sædens befrugtningsevne Sædkvalitet Frugtbarheden med kønssorteret sæd Hunlig frugtbarhed Danske avlsværdital

Læs mere

NTM Nordic total Merit eller var det merværdi eller mareridt

NTM Nordic total Merit eller var det merværdi eller mareridt NTM Nordic total Merit eller var det merværdi eller mareridt Diskussionsmøde om avlsmål indenfor HF 21. januar 2010, Agerskov Kro Morten Kargo Sørensen 1 NTM et fælles nordisk avlsmål foar alle pr. race

Læs mere

Genmarkører i det praktiske avlsarbejde

Genmarkører i det praktiske avlsarbejde Genmarkører i det praktiske avlsarbejde Tema 3 Nye egenskaber og nye redskaber i avlsarbejdet Jørn Rind Thomasen, Kvægavlsforeningen Bernt Guldbrandtsen og Mogens Lund, Danmarks JordbrugsForskning ! Baggrund

Læs mere

Nyt fra Interbull og NAV udviklingsaktiviteter

Nyt fra Interbull og NAV udviklingsaktiviteter Nyt fra Interbull og NAV udviklingsaktiviteter Gert Pedersen Aamand og Anders Fogh Interbull møder seneste år Februar 2012 Verona, Italien teknisk workshop fokus GMACE Årsmøde Juni 2012 Cork, Irland Interbull

Læs mere

Nordisk Avlsværdivurdering status og planer

Nordisk Avlsværdivurdering status og planer Nordisk Avlsværdivurdering status og planer Direktør Gert Pedersen Aamand Nordisk Avlsværdivurdering Nordisk Avlsværdivurdering 1 Nordisk Avlsværdivurdering Stå for avlsværdivurdering af kvæg i Finland,

Læs mere

Der er beregnet internationale avlsværdital for de egenskaber og racer som er angivet i tabel 1.

Der er beregnet internationale avlsværdital for de egenskaber og racer som er angivet i tabel 1. Januar 2008 Til avlsledere og avlsrådgivere INTERBULL avlsværdital beregnet januar 2009 Der er beregnet internationale avlsværdital for de egenskaber og racer som er angivet i tabel 1. Tabel 1. Egenskaber

Læs mere

Beregningsprocedure og offentliggørelse af avlsværdital

Beregningsprocedure og offentliggørelse af avlsværdital Beregningsprocedure og offentliggørelse af avlsværdital Gert Pedersen Aamand og Anders Fogh Genomisk avlsværdivurdering Husk En helt ny metode - startet i 2008 Meget hurtig udvikling Meget hurtig flytning

Læs mere

Fordele ved Nordisk Avlsværdivurdering

Fordele ved Nordisk Avlsværdivurdering Fordele ved Nordisk Avlsværdivurdering Direktør Gert Pedersen Aamand Nordisk Avlsværdivurdering Nordisk Avlsværdivurdering 1 Nordisk Avlsværdivurdering Stå for avlsværdivurdering af kvæg i Finland, Sverige

Læs mere

Nyt fra NAV. Gert Pedersen Aamand. Nordisk Avlsværdi Vurdering Nordic Cattle Genetic Evaluation

Nyt fra NAV. Gert Pedersen Aamand. Nordisk Avlsværdi Vurdering Nordic Cattle Genetic Evaluation Nyt fra NAV Gert Pedersen Aamand Implementeret i 2014 Egenskab/indeks Dato Kommentar GEBV Februar 2014 Justering Holstein holdbarhed GEBV Marts 2014 US Jersey tyre inkluderet i ref population Yversundhed

Læs mere

Nye muligheder i insemineringsplan. Anders Glasius, Dansk Kvæg. Sumberegning på avlsstrateginiveau

Nye muligheder i insemineringsplan. Anders Glasius, Dansk Kvæg. Sumberegning på avlsstrateginiveau Nye muligheder i insemineringsplan Anders Glasius, Dansk Kvæg Sumberegning på avlsstrateginiveau Ideen til ændring af sumberegningen i insemineringsplanprogrammet kom af de begrænsninger der er i den nuværende

Læs mere

Godt i gang med nordisk total indeks (NTM) Hvordan beregnes økonomiske vægte

Godt i gang med nordisk total indeks (NTM) Hvordan beregnes økonomiske vægte Godt i gang med nordisk total indeks (NTM) Hvordan beregnes økonomiske vægte Om projektet og om økonomiske værdier generelt Den valgte model principperne Kort om forudsætninger og resultater Økonomisk

Læs mere

Endnu et år med masser af Service-tjek

Endnu et år med masser af Service-tjek Endnu et år med masser af Service-tjek Under indlægget sætter vi fokus på: Kvægbrugets økonomiske situation og udvikling Krydsningskalveprojekt Eksport Genomisk selektion Avlsplanen i dag og i fremtiden

Læs mere

Avlsværdital for klovsundhed

Avlsværdital for klovsundhed Avlsværdital for klovsundhed Jørn Pedersen Jan-Åke Eriksson Kjell Johansson Jukka Pösö Morten Kargo Sørensen Ulrik Sander Nielsen Gert Pedersen Aamand Anders Fogh Oversigt Generelt om klovsundhed registreringer

Læs mere

Nordisk skala betydning for avlsværditallene

Nordisk skala betydning for avlsværditallene Nordisk skala betydning for avlsværditallene "Nordisk avlsværdivurdering går i luften" torsdag d. 21-4 2005 Ulrik Sander Nielsen og Morten Kargo Sørensen Datagrundlag og vægte RDM SDM-DH Jersey DRH Y-indeks

Læs mere

NTM. Udarbejdet af: Nanna Hammershøj Mette Sandholm Anders Fogh. Se European Agricultural Fund for Rural Development (EAFRD)

NTM. Udarbejdet af: Nanna Hammershøj Mette Sandholm Anders Fogh. Se European Agricultural Fund for Rural Development (EAFRD) Udarbejdet af: Nanna Hammershøj Mette Sandholm Anders Fogh NTM Se European Agricultural Fund for Rural Development (EAFRD) STØTTET AF Dansk Holsteins fonde STØTTET AF mælkeafgiftsfonden Indledning EN KO

Læs mere

Anvendelse af DNA-information i kvægavlen -muligheder og faldgruber

Anvendelse af DNA-information i kvægavlen -muligheder og faldgruber KvægInfo nr.: 1416 Dato: 13-12-2004 Forfatter: Louise Dybdahl Pedersen,Peer Berg Af ph.d.-studerende Louise Dybdahl Pedersen og forskningsleder Peer Berg Afd. for Husdyravl og Genetik, Danmarks JordbrugsForskning

Læs mere

Er der behov for nye avlsmål for økologiske malkekøer?

Er der behov for nye avlsmål for økologiske malkekøer? AARHUS Er der behov for nye avlsmål for økologiske malkekøer? Økologi-Kongres 2015 Onsdag d. 25-11 Morten Kargo AARHUS Hvad er et avlsmål? Emner Hvad vil vi i SOBcows? Økologisk avlsmål baseret på beregninger

Læs mere

Nyhedsbrev NAV rutine avlsværdivurdering 1. november 2016

Nyhedsbrev NAV rutine avlsværdivurdering 1. november 2016 Nyhedsbrev NAV rutine avlsværdivurdering 1. november 2016 Den seneste NAV evaluering af ydelse, frugtbarhed, eksteriør, yversundhed, øvrige sygdomme, kælvningsevne, malketid, temperament, vækst, holdbarhed,

Læs mere

Holdbarhed er godt NTM er bedre Anders Fogh og Ulrik Sander Nielsen

Holdbarhed er godt NTM er bedre Anders Fogh og Ulrik Sander Nielsen Holdbarhed er godt NTM er bedre Anders Fogh og Ulrik Sander Nielsen En ung ko producerer oftest mindre mælk end køer i senere laktationer. Der er derfor penge i at have køer, som er længelevende, hvis

Læs mere

Avl for moderegenskaber

Avl for moderegenskaber Avl for moderegenskaber - Avl for levende grise dag 5 - Pattegrisens vitalitet - Avlsgennemslag i produktionsbesætninger So-produktivitet Fra Warentest 2008 Levende født pr. kuld (Ø=12,05) 13,63 11,43

Læs mere

IT-Solutions for Animal Production

IT-Solutions for Animal Production IT-Solutions for Animal Production 28. Februar 2017 Seite 1 IT-Solutions for Animal Production Sammenligning af avlsfilosofi for tysk RZG kontra dansk NTM Dr. Stefan Rensing Vereinigte Informationssysteme

Læs mere

Velkommen til områdemøde Viking Holstein

Velkommen til områdemøde Viking Holstein Velkommen til områdemøde Viking Holstein RGK Bob-datter MissDanmark fra Tirsvad 2013 Holstein - D Cresten datter fra Margit og Jørgen Døssing, Højslev Dagsorden Valg af dirigent Valg af stemmetællere Valg

Læs mere

Årsstatistik Avl 2014/15. Team Avlsværdivurdering SEGES Kvæg

Årsstatistik Avl 2014/15. Team Avlsværdivurdering SEGES Kvæg Årsstatistik Avl 2014/15 Team Avlsværdivurdering SEGES Kvæg 1 Forord Denne udgave af "Årsstatistik, Avl" fra Team Avlsværdivurdering er kun tilgængelig på internettet. Årsstatistikken indeholder engelske

Læs mere

INSEMINERINGSPLANER BRUGERVEJLEDNING AGROMEK 2002 VIBEKE CHRISTENSEN KRISTIAN SØBORG ANDERS GLASIUS DANSK KVÆG

INSEMINERINGSPLANER BRUGERVEJLEDNING AGROMEK 2002 VIBEKE CHRISTENSEN KRISTIAN SØBORG ANDERS GLASIUS DANSK KVÆG Insemineringsplaner Agromek 2002 Side 1. INSEMINERINGSPLANER BRUGERVEJLEDNING AGROMEK 2002 VIBEKE CHRISTENSEN KRISTIAN SØBORG ANDERS GLASIUS DANSK KVÆG Insemineringsplaner Agromek 2002 Side 2. Version

Læs mere

Avl til gavn for DIN bundlinje

Avl til gavn for DIN bundlinje Avl til gavn for DIN bundlinje Optimal udnyttelse af vores avlsredskaber Indsatser i avlsplanen Øget sikkerhed = LD projektet Generationinterval Tyre & kvier Tilpasning af tyrehold Igangsætning Ventetyre

Læs mere

Avlsplaner med eller uden genomisk selektion og afkomsundersøgelse. L.H. Buch, M.K. Sørensen, P. Berg, L.D. Pedersen og A.C.

Avlsplaner med eller uden genomisk selektion og afkomsundersøgelse. L.H. Buch, M.K. Sørensen, P. Berg, L.D. Pedersen og A.C. Avlsplaner med eller uden genomisk selektion og afkomsundersøgelse L.H. Buch, M.K. Sørensen, P. Berg, L.D. Pedersen og A.C. Sørensen Optimering af avlsplaner Maksimere årlig genetisk fremgang for det samlede

Læs mere

INDEKS FOR HUNLIG FRUGTBARHED FOR MALKERACETYRE

INDEKS FOR HUNLIG FRUGTBARHED FOR MALKERACETYRE INDEKS FOR HUNLIG FRUGTBARHED FOR MALKERACETYRE Jørn Pedersen Landskontoret for Kvæg Just Jensen Statens Husdyrbrugsforsøg Landbrugets Rådgivningscenter Maj 1996 1 2 Forord I dansk kvægavl bliver der beregnet

Læs mere

Status på data og avl

Status på data og avl Status på data og avl Avlsforum for RDM Brædstrup 9. december 2010 Anders Fogh Disposition Malketid Ny håndterminal Klovsundhed Data fra malkerobotter Afstamningsfejl Hvorfor er inddragelse af data fra

Læs mere

DanAvl - avlsfremgang og nye avlsmål Anders Strathe, ErhvervsPostDoc, PhD Tage Ostersen, Seniorprojektleder

DanAvl - avlsfremgang og nye avlsmål Anders Strathe, ErhvervsPostDoc, PhD Tage Ostersen, Seniorprojektleder DanAvl - avlsfremgang og nye avlsmål Anders Strathe, ErhvervsPostDoc, PhD Tage Ostersen, Seniorprojektleder Programmet Status på avlsarbejdet Avl mod ornelugt Avl for moderegenskaber Programmet Status

Læs mere

Kvægavl i fremtiden. - set med genetiske og etiske briller. Thomas Mark & Peter Sandøe. Det Biovidenskabelige Fakultet, Københavns Universitet

Kvægavl i fremtiden. - set med genetiske og etiske briller. Thomas Mark & Peter Sandøe. Det Biovidenskabelige Fakultet, Københavns Universitet Kvægavl i fremtiden - set med genetiske og etiske briller Thomas Mark & Peter Sandøe Det Biovidenskabelige Fakultet, Københavns Universitet Oversigt Avlsmål og gennemførsel DNA-information Registreringer

Læs mere

Fælles nordisk avlsværdivurdering og gennemslagskraft i forhold til INTERBULL

Fælles nordisk avlsværdivurdering og gennemslagskraft i forhold til INTERBULL Fælles nordisk avlsværdivurdering og gennemslagskraft i forhold til INTERBULL Direktør Gert Pedersen Aamand Nordisk avlsarbejde - internationalt ƒ Total økonomisk avlsmål ƒ Detaljerede registreringer (Leitch,

Læs mere

Hvad betyder registrering af inseminering, vægt, livskraft osv. for racens avlsarbejde

Hvad betyder registrering af inseminering, vægt, livskraft osv. for racens avlsarbejde Hvad betyder registrering af inseminering, vægt, livskraft osv. for racens avlsarbejde Hvad betyder øget frekvens af registrering for racens avlsfremgang Avlsseminar for Dansk Kødkvæg Horsens Januar 2010

Læs mere

Nordisk Avlsværdivurdering. status og muligheder International avlsværdivurdering for kødkvæg

Nordisk Avlsværdivurdering. status og muligheder International avlsværdivurdering for kødkvæg status og muligheder International avlsværdivurdering for kødkvæg v/direktør Gert Pedersen Aamand status og muligheder International avlsværdivurdering for kødkvæg 1. Hvad er NAV? 2. NAV for malkekvæg

Læs mere

Principperne for indeksberegning

Principperne for indeksberegning Principperne for indeksberegning Avlsseminar for Simmental Pejsegården, Brædstrup Anders Fogh November 2010 Avl er et stærkt redskab! Permanent genetisk fremgang fra generation til generation Forskel mellem

Læs mere

Frugtbarhed i avlsarbejdet

Frugtbarhed i avlsarbejdet Frugtbarhed i avlsarbejdet Tema 3 Bedre avlsværdivurdering for ydelse og reproduktion Landskonsulent Ulrik Sander Nielsen S:\SUNDFODE\s kongres 2003\Tema 3\Ulrik Sander ! Egenskaber! Arvbarhed Disposition!

Læs mere

Dansk Varmblods Avlsplan 2012-2020 Vedtaget af Hovedbestyrelsen nov. 2011, efter høring i regionerne

Dansk Varmblods Avlsplan 2012-2020 Vedtaget af Hovedbestyrelsen nov. 2011, efter høring i regionerne Dansk Varmblods Avlsplan 2012-2020 Vedtaget af Hovedbestyrelsen nov. 2011, efter høring i regionerne Af Karina Christiansen Avlskonsulent for Dansk Varmblod Baggrund Fundamentet for Dansk Varmblod blev

Læs mere

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 19.oktober 2015 Liselotte Wesley Andersen

Læs mere

Hidtil mange sejre i nordisk kvægavl

Hidtil mange sejre i nordisk kvægavl Mandag den 28. juli Hvorledes skabes en effektiv nordisk organisation på tværs af landegrænser rfaringer fra VikingGenetics og Nordisk Avlsværdivurdering Lars-Inge Gunnarsson Hidtil mange sejre i nordisk

Læs mere

Fra skrivebord til stald Sådan optimerer jeg min produktion

Fra skrivebord til stald Sådan optimerer jeg min produktion Fra skrivebord til stald Sådan optimerer jeg min produktion Dansk kvæg kongress 2011 Aftenmøde Holstein Morten Hansen Højgård B. S. Christiansen Jeg er mig sådan er jeg vi er alle særlinger Sig sandheden

Læs mere

Cisgen byg med bedre fosfatudnyttelse

Cisgen byg med bedre fosfatudnyttelse Cisgen byg med bedre fosfatudnyttelse Seniorforsker Inger Bæksted Holme Aarhus Universitet, Science and Technology, Institut for Molekylærbiologi og Genetik, Afgrødegenetik og Bioteknologi Hypotese Det

Læs mere

Kåringens indflydelse på avlsværdital ELLER. Hvordan opnås mest sikre avlsværdital. Anders Fogh, Ulrik Sander Nielsen og Gert Pedersen Aamand

Kåringens indflydelse på avlsværdital ELLER. Hvordan opnås mest sikre avlsværdital. Anders Fogh, Ulrik Sander Nielsen og Gert Pedersen Aamand Kåringens indflydelse på avlsværdital ELLER Hvordan opnås mest sikre avlsværdital Anders Fogh, Ulrik Sander Nielsen og Gert Pedersen Aamand Informationskilder Bedømmelse - Meget information (h 2 ) - Alle

Læs mere

Produktion af en 1400 gram tung kylling. 1960 80 dage. 2000 30 dage

Produktion af en 1400 gram tung kylling. 1960 80 dage. 2000 30 dage Produktion af en 1400 gram tung kylling 1960 80 dage 2000 30 dage 1 2 Udvikling i proteinydelse 1990 til 2000 Race Arv Miljø I alt % Arv RDM 22 4 26 85 SDM 28 12 40 70 Jersey 20 11 31 65 3 Forventet avlsmæssig

Læs mere

SNP håndtering og datavalidering. Kevin Byskov

SNP håndtering og datavalidering. Kevin Byskov SNP håndtering og datavalidering Kevin Byskov Disposition Principperne bag genotypning Kontrolprocedurer: Kontrol af Sample ID Mendel Error Check Kontrol af omtypede dyr Cytosin (C) Guanin (G) Homologe

Læs mere

Avl og indeksberegning - får

Avl og indeksberegning - får 4. Avl og indeksberegning - får Jette Lauridsen Avlsarbejdet med får i Danmark bygger på registrering af afstamning og produktionsdata i Fåreregistreringen. Vi bruger de registrerede data til beregning

Læs mere

AVL MED KØDKVÆG. Avl med kødkvæg 1

AVL MED KØDKVÆG. Avl med kødkvæg 1 AVL MED KØDKVÆG LandbrugsRådgivning Østjylland I/S Konsulent Jørgen Skov Nielsen, Ålevej 50, 7160 Tørring Tlf. 76 90 25 77. Fax. 75 80 17 31. Mobil. 20 12 07 96. www.lro.dk. E-mail: jos@lro.dk Avl med

Læs mere

Tid og sted 8.-10. oktober 2002 hos Svensk Avel i Skara samt studietur for danske kvægavlsrådgivere den 11. oktober 2002 i området omkring Skara.

Tid og sted 8.-10. oktober 2002 hos Svensk Avel i Skara samt studietur for danske kvægavlsrådgivere den 11. oktober 2002 i området omkring Skara. Kvæg Testdagsmodeller og indavl samt studietur Tid og sted 8.-10. oktober 2002 hos Svensk Avel i Skara samt studietur for danske kvægavlsrådgivere den 11. oktober 2002 i området omkring Skara. Baggrund

Læs mere

Strategier for anvendelse af genomiske test på besætningsniveau

Strategier for anvendelse af genomiske test på besætningsniveau Strategier for anvendelse af genomiske test på besætningsniveau Line Hjortø Jehan Ettema Morten Kargo Christian Sørensen Torben Nørremark Anders Fogh Baggrund Brugen af KSS er nu en integreret del af dansk

Læs mere

Jersey i Årsmøde området

Jersey i Årsmøde området Jersey i Årsmøde området Området er kendte for progressive kvægbrugere Den gennemsnitlige besætningsstørrelse ligger betydeligt over landsgennemsnittet med ca. 245 køer. Interessen for avl og det organisatoriske

Læs mere

Betragtninger omkring hvordan Simmental opnår avlsmæssig fremgang for racen

Betragtninger omkring hvordan Simmental opnår avlsmæssig fremgang for racen Betragtninger omkring hvordan Simmental opnår avlsmæssig fremgang for racen Avlsseminar for Simmental Pejsegården, Brædstrup Anders Fogh November 2010 Avlsmaskinen Input: - Racen - Biologiske omstændigheder

Læs mere

OMVERDENENS SYN PÅ FREMTIDENS AVLSMÅL

OMVERDENENS SYN PÅ FREMTIDENS AVLSMÅL OMVERDENENS SYN PÅ FREMTIDENS AVLSMÅL Peter Sandøe & Christian Gamborg Den Kgl. Veterinær- og Landbohøjskole www.bioethics.kvl.dk HVAD MENER ALMINDELIGE MENNESKER OM KVÆGAVL? Hvad mener almindelige mennesker

Læs mere

Avlsplaner i VikingGenetics. Lars Nielsen Avlsleder Holstein VikingGenetics

Avlsplaner i VikingGenetics. Lars Nielsen Avlsleder Holstein VikingGenetics Avlsplaner i VikingGenetics Lars Nielsen Avlsleder Holstein VikingGenetics Avlsplanerne i VikingGenetics I VikingGenetics er avlsarbejdet opdelt i fire racer, der arbejder med individuelle avlsplaner Holstein,

Læs mere

DIFFERENTIERET AVL AF ØKOLOGISKE GRISE VIA DANAVL

DIFFERENTIERET AVL AF ØKOLOGISKE GRISE VIA DANAVL DIFFERENTIERET AVL AF ØKOLOGISKE GRISE VIA DANAVL Med støtte fra: DIFFERENTIERET AVL AF GRISE VIA DANAVL Vejledning i brug af DanAvls udbud af KS til økologiske besætninger DIFFERENTIERET AVL AF GRISE

Læs mere

Årsstatistik Avl /11

Årsstatistik Avl /11 Årsstatistik Avl - 2010/11 Team Avlsværdivurdering Videncentret for Landbrug, Kvæg 1 Forord Denne udgave af "Årsstatistik, Avl" fra Team Avlsværdivurdering er kun tilgængelig på internettet. Årsstatistikken

Læs mere

Indeks for HD BLUP - AM

Indeks for HD BLUP - AM Indeks for HD Per Madsen Seniorforsker Aarhus Universitet Det Jordbrugsvidenskabelige Fakultet Institut for Genetikk og Bioteknologi Forskningscenteret Foulum, Danmark Hofteledsdysplasi (HD) er en lidelse,

Læs mere

Årsstatistik Avl 2015/16. Team Avlsværdivurdering SEGES Kvæg

Årsstatistik Avl 2015/16. Team Avlsværdivurdering SEGES Kvæg Årsstatistik Avl 2015/16 Team Avlsværdivurdering SEGES Kvæg 1 Forord Denne udgave af "Årsstatistik, Avl" fra Team Avlsværdivurdering er kun tilgængelig på internettet. Årsstatistikken indeholder engelske

Læs mere

Årsstatistik Avl - 2009/10

Årsstatistik Avl - 2009/10 Årsstatistik Avl - 2009/10 Team Avlsværdivurdering Videncentret for Landbrug, Kvæg 1 Forord Denne udgave af "Årsstatistik, Avl" fra Team Avlsværdivurdering er kun lavet i Internet-version. Årsstatistikken

Læs mere

Lars Nielsen Trygve R. Solberg

Lars Nielsen Trygve R. Solberg Genomisk selektion status, erfaringer og muligheder for øget avlmæssig fremgang herunder effekt på den praktisk avlsplan populations og besætningsniveau Lars Nielsen Trygve R. Solberg Innhold Del 1 Trygve

Læs mere

Avlsarbejde. Dansk Landbrugsrådgivning Landscentret 4.1

Avlsarbejde. Dansk Landbrugsrådgivning Landscentret 4.1 Avlsarbejde 4. Avlsteori Arveanlæggene (gener) ligger på kromosomer Kromosomer befinder sig i alle celler Arveanlæggene optræder altid parvis, to og to De to gener i hvert par adskilles, når dyret senere

Læs mere

Anvendelse af DNA markører i planteforædlingen

Anvendelse af DNA markører i planteforædlingen Anvendelse af DNA markører i planteforædlingen Forsker Gunter Backes, Afdeling for Planteforskning, Forskningscentret Risø DNA-markører på kontaktfladen mellem molekylær genetik og klassisk planteforædling

Læs mere

Årsstatistik Avl 2011/12

Årsstatistik Avl 2011/12 Årsstatistik Avl 2011/12 Team Avlsværdivurdering Videncentret for Landbrug, Kvæg 1 Forord Denne udgave af "Årsstatistik, Avl" fra Team Avlsværdivurdering er kun tilgængelig på internettet. Årsstatistikken

Læs mere

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får DNA analyse til artsidentifikation af spytprøver fra to dødfundne får Notat fra DCE -Nationalt Center for Miljø og Energi Dato: 22. oktober 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

Hvordan beregnes avlsværdital og hvorfor giver høje avlsværdital bedre produktionsresultater

Hvordan beregnes avlsværdital og hvorfor giver høje avlsværdital bedre produktionsresultater Hvordan beregnes avlsværdital og hvorfor giver høje avlsværdital bedre produktionsresultater Avlskursus for kødkvægsproducenter Aulum fritidscenter Januar 2010 Anders Fogh Landscentret, Disposition Grundlæggende

Læs mere

Holstein-aftenmøde 29. februar Sidste nyt om Holstein Af landskonsulent Keld Christensen

Holstein-aftenmøde 29. februar Sidste nyt om Holstein Af landskonsulent Keld Christensen Holstein-aftenmøde 29. februar 2016 Sidste nyt om Holstein Af landskonsulent Keld Christensen Udvikling de seneste 20-25 år De gode historier om Holstein Udvikling frem til Effektive køer Sunde køer Holdbare

Læs mere

Jeg har god økonomi i min kødkvægsproduktion Dansk Landbrugsrådgivning Landscentret

Jeg har god økonomi i min kødkvægsproduktion Dansk Landbrugsrådgivning Landscentret Jeg har god økonomi i min kødkvægsproduktion Dansk Kvægs kongres 2007 Tema 4 Gårdejer Henning Olesen, Slagelse Min baggrund Gift i 1960 Selvstændig landmand med alsidig bedrift Salg af malkekøer / start

Læs mere

Økonomi i anvendelse af GS, KSS og kødkvæg

Økonomi i anvendelse af GS, KSS og kødkvæg Økonomi i anvendelse af GS, KSS og kødkvæg Morten Kargo 12 Line Hjortø 2, Jehan Ettema 3 & Anders Christian Sorensen 1 1 Aarhus University, Foulum, Denmark 2 Knowledge Centre Agriculture, Denmark 3 Simherd

Læs mere

ESPE-HOLM LEVERER TYRENE

ESPE-HOLM LEVERER TYRENE { NR 04 DECEMBER 2013 } Magasinet for kvægavl og reproduktion ESPE-HOLM LEVERER TYRENE Side 4 27 52 40 FEBRUAR 2013 avlsnyt 3 Hovedkontor Ebeltoftvej 16, 8960 Randers SØ T: 8795 9400, F: 8795 9401 info@vikinggenetics.com

Læs mere

tilvækst) Gennemslag i produktionen

tilvækst) Gennemslag i produktionen Avlsfremgang og omsætning SIDE 11 Tabel 1 - Avlsfremgangen de seneste fire år for hver egenskab og race samt gennemsnit for et D(LY)-slagtesvin. Race Tilvækst (0-30 kg), g/dag Tilvækst (30-100 kg), g/dag

Læs mere

HD og HD-indeks V/Helle Friis Proschowsky, dyrlæge, phd. Spørgsmål og diskussion. Hvad er HD?

HD og HD-indeks V/Helle Friis Proschowsky, dyrlæge, phd. Spørgsmål og diskussion. Hvad er HD? HD og HD-indeks V/Helle Friis Proschowsky, dyrlæge, phd Generelt om HD HD hos Ruhår HD-indeks Nyt og gammelt Indeks som avlsredskab Spørgsmål og diskussion Hvad er HD? Lårbenets hoved ikke passer ind i

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

Årsstatistik Avl 2013/14 Team Avlsværdivurdering Videncentret for Landbrug, Kvæg

Årsstatistik Avl 2013/14 Team Avlsværdivurdering Videncentret for Landbrug, Kvæg Årsstatistik Avl 2013/14 Team Avlsværdivurdering Videncentret for Landbrug, Kvæg Link til European Agricultural Fund for Rural Development 1 Forord Denne udgave af "Årsstatistik, Avl" fra Team Avlsværdivurdering

Læs mere

{ NR 02 JUNI 2015 } Magasinet for kvægavl og reproduktion. Det hele liv med familie og køer. Side 4. FEBRUAR 2013 avlsnyt

{ NR 02 JUNI 2015 } Magasinet for kvægavl og reproduktion. Det hele liv med familie og køer. Side 4. FEBRUAR 2013 avlsnyt { NR 02 JUNI 2015 } Magasinet for kvægavl og reproduktion Det hele liv med familie og køer Side 4 16 35 44 FEBRUAR 2013 avlsnyt 3 Af CEO Rex A. Clausager Hovedkontor Ebeltoftvej 16, 8960 Randers SØ T:

Læs mere

27. april 2015 Gert P. Aamand, Anders Fogh og Morten Kargo KRYDSNING

27. april 2015 Gert P. Aamand, Anders Fogh og Morten Kargo KRYDSNING 27. april 2015 Gert P. Aamand, Anders Fogh og Morten Kargo KRYDSNING Avlskort som kan spilles for at trække stikket hjem Systematisk krydsning i malkekobesætningen Krydsning med kødkvægssæd Brug af kønssorteret

Læs mere

Kombinerer genomisk test, ET og kviehotel

Kombinerer genomisk test, ET og kviehotel { NR 02 MAJ 2014 } Magasinet for kvægavl og reproduktion Kombinerer genomisk test, ET og kviehotel Side 4 14 32 41 FEBRUAR 2013 avlsnyt 3 Af direktør Claus Fertin Hovedkontor Ebeltoftvej 16, 8960 Randers

Læs mere

Årsrapport 2017 for projektet:

Årsrapport 2017 for projektet: Årsrapport 2017 for projektet: Robuste og produktive afgrøder til bæredygtig intensivering af fremtidens planteavl (Robusta 2017 2019) Projektet er initieret af udvalget for konkurrencedygtig planteproduktion.

Læs mere

Referat af bestyrelsesmøde i Dansk Jerseys Racebestyrelse

Referat af bestyrelsesmøde i Dansk Jerseys Racebestyrelse Referat af bestyrelsesmøde i Dansk Jerseys Racebestyrelse Tid og sted: Mødeleder: Referent: Deltagere: Afbud: Tirsdag d. 23. august 2011, på VG kontoret, Ørnsro, Skara, Sverige Anders Levring Peter G.

Læs mere

Antal 1. insemineringer

Antal 1. insemineringer Områdemøder 2013 Program 10.00 11.00 Besætningsbesøg 11.15 Fællesmøde Vikings aktiviteter - på vej mod nye mål vær med til at løfte overliggeren Udpegning af områdets Repromester 12.15 Viking er vært ved

Læs mere

Rangering og udvælgelse af avlsdyr afhængigt af produktionssystemet

Rangering og udvælgelse af avlsdyr afhængigt af produktionssystemet Rangering og udvælgelse af avlsdyr afhængigt af produktionssystemet Per Madsen & Trine Villumsen Danmarks JordbrugsForskning Afdeling for Genetik og Bioteknologi Baggrund Omfanget af økologisk mælkeproduktion

Læs mere

X bundet arvegang. Information til patienter og familier

X bundet arvegang. Information til patienter og familier X bundet arvegang Information til patienter og familier 2 X bundet arvegang Følgende er en beskrivelse af, hvad X bundet arvegang betyder og hvorledes X bundne sygdomme nedarves. For at forstå den X bundne

Læs mere

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Per Tøfting 23. september 2008 Speciale i softwarekonstruktion IT-Vest Aarhus Universitet Agenda Formål microrna Strategien

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Termin Maj-juni 2014-2015 Institution Favrskov Gymnasium Uddannelse Fag og niveau Lærer Hold stx Biologi C Jeppe Lund (JL) 2a bic Oversigt over gennemførte undervisningsforløb

Læs mere

MAJ KVÆGAVLEREN 3 2005. Premiere på NAV Kønssorteret sæd Fremgang i sædeksporten

MAJ KVÆGAVLEREN 3 2005. Premiere på NAV Kønssorteret sæd Fremgang i sædeksporten MAJ KVÆGAVLEREN 3 2005 Premiere på NAV Kønssorteret sæd Fremgang i sædeksporten Kvægavleren, nr. 3, maj 2005, 3. årgang Hovedkontor: Ebeltoftvej 16, Assentoft 8900 Randers Tlf.: 8795 9400 Fax: 8795 9401

Læs mere

Bestilling inden 1. september: Næste mulighed for bestilling: Avlsudvalget

Bestilling inden 1. september: Næste mulighed for bestilling: Avlsudvalget Fransk Importsæd bestilling inden 1. September 150 121 - dansklimousine.dk Skal du have fransk sæd hjem til efterårs insemineringer? Her præsenteres avlsudvalgets bud på 7 franske tyre. Avlsudvalget har

Læs mere

Hvordan henfører man fisk til deres oprindelsesbestand?

Hvordan henfører man fisk til deres oprindelsesbestand? Hvordan henfører man fisk til deres oprindelsesbestand? Genetiske forskelle mellem bestande ikke katagoriske Bygger på frekvensforskelle Fisk af ukendt oprindelse GGTAACATCACGAAAGTC Hvor stammer den sandsynligvis

Læs mere

Teknikken i testdagsmodellen (2)

Teknikken i testdagsmodellen (2) Teknikken i testdagsmodellen (2) Gert Pedersen Aamand Single trait versus multi trait Den gamle danske model Single trait en egenskabs model mælk fedt og protein separat NAV-model Multitrait fleregenskabsmodel

Læs mere

Anvendelse af DNA markører i planteforædlingen. - genteknik uden GMO er. Gunter Backes Forskningscenter Risø

Anvendelse af DNA markører i planteforædlingen. - genteknik uden GMO er. Gunter Backes Forskningscenter Risø Anvendelse af DNA markører i planteforædlingen - genteknik uden GMO er Gunter Backes Forskningscenter Risø Inddeling Hvad er molekylære markører? Hvordan kan man bruge dem? Konklusion Inddeling Hvad er

Læs mere

ning ved Uddrag Kristian af beretn Nielsen Avlsfore pressen.

ning ved Uddrag Kristian af beretn Nielsen Avlsfore pressen. Årsmøde 2015 i Korsør af beretn Nielsen Uddrag Kristian Christensen, Avlsfore ning ved og Keld eningen Dansk Holstein Velkommen til alle deltagere i årsmøde i Dansk Holstein her på Sjælland, en særlig

Læs mere

Mavesår. Normalt er mavesækkens slimhinde. en livsstilssygdom hos heste?

Mavesår. Normalt er mavesækkens slimhinde. en livsstilssygdom hos heste? FAGLIGT Hestekongres en god kur mod mavesår og som forebyggelse er, at give hesten adgang til hø af god kvalitet og/eller sætte hesten på en god græsfold. (Foto: ridehesten.com/ mette Andersen). Mavesår

Læs mere

Proteinniveau til unge kvier Martin Tang Sørensen og Mogens Vestergaard, Aarhus Universitet, Foulum

Proteinniveau til unge kvier Martin Tang Sørensen og Mogens Vestergaard, Aarhus Universitet, Foulum Proteinniveau til unge kvier Martin Tang Sørensen og Mogens Vestergaard, Aarhus Universitet, Foulum Indledning Ved AU-Foulum har vi gennemført et forsøg med to niveauer af protein i foderet til kvier i

Læs mere

Farver og genetik hos landracegeder. Andreas Gertz

Farver og genetik hos landracegeder. Andreas Gertz Farver og genetik hos landracegeder Andreas Gertz 01.11.2014 DNA Gener - kromosomer gener kan sammenlignes med opskrifter nedskrevet I DNA-molekyler skrevet i 4 bogstaver (adenin, cytosin, guanin, thymin)

Læs mere

Viking køber kvier til avlsprogrammet

Viking køber kvier til avlsprogrammet { NR 04 DECEMBER 2015 } Magasinet for kvægavl og reproduktion Viking køber kvier til avlsprogrammet Side 9 18 34 46 Alex Arkink Af direktør Rex A. Clausager Hovedkontor Ebeltoftvej 16, 8960 Randers SØ

Læs mere

Side 1 af 5 Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Aug-dec. 14 Institution Frederiksberg VUF Uddannelse Fag og niveau Lærer(e) Hold Hf-e Biologi

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Vintereksamen 2014-15 Institution 414 Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold HF-e Biologi B

Læs mere

Testdagsmodeller for ydelse

Testdagsmodeller for ydelse Testdagsmodeller for ydelse Tema 3 Bedre avlsværdivurdering for ydelse og reproduktion Specialkonsulent Jørn Pedersen S:\SUNDFODE\s kongres 2003\Tema 3\Jorn Testdagsmodeller for ydelse S:\SUNDFODE\s kongres

Læs mere

Registrering er hjørnestenen i avl, produktion og registrering generelt

Registrering er hjørnestenen i avl, produktion og registrering generelt Registrering er hjørnestenen i avl, produktion og registrering generelt Dansk Kødkvægs Årsmøde Ann Margaret Sørensen, Dansk Kvæg Ingen registreringer Ingen avl Ingen produktionsstyring 2... 27. februar

Læs mere