Bent J. Nielsen DJF, Århus Universitet

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Bent J. Nielsen DJF, Århus Universitet"

Transkript

1 Økologisk udsæd med fokus på udsædsbårne sygdomme Bent J. Nielsen DJF, Århus Universitet DanSeed Symposium Kobæk Strand 8 marts 2010

2 Økologisk udsæd Større udviklings- og forskningsindsats i forbindelse med FØJO projektet ORGSEED ( ) Forslag til revision af skadetærskler Survey over forekomst af udsædsbårne sygdomme PCR baseret detektionsmetode (bladplet/stribesyge) Screening af danske sorter for resistens mod stribesyge (byg) og stinkbrand (hvede) Alternative bekæmpelsesmetoder Forsættelse i SEED projektet ( ) Samdyrkning af korn med ært, hestebønne eller lupin Test af resistens over for stinkbrand

3 Tolerancer for såsæd i DK Fastsat i DK i samarbejde mellem Landscentret, Plantedirektoratet og DJF Økologisk såsæd: Forekomst af vigtige udsædsbårne sygdomme må ikke overskride fastsatte grænser (tolerancer) Konventionel såsæd: Vejledende!

4 Ærtesyge Ascochyta kompleks: Phoma medicaginis var. pinodella, Ascochyta pisi Mycosphaerella pinodes

5 Tolerancer i hvede. OVERSIGT C1 C2 Stinkbrand 0 >10 sporer Brunplet 15 % 15 % Fusariose 15 % 15 % Vinterhvede 30 % 30 % Vårhvede

6 Tolerancer i byg. OVERSIGT C1 C2 Stribesyge 0 5 % Bladplet 5/15/25 % 5/15/25 % Nøgen brand Spore 2 % Fusariose 15 % 15 % Vinterbyg 30 % 30 % Vårbyg

7 Tolerancer for bygbladplet C1 C2 D. teres % Forslag om sortsafhængig tolerance: Fuldt modtagelige sorter (PVO 3) 5 % Modtagelig moderat resistene sorter (PVO 1-2) 15% Resistente sorter (PVO 0) 25%

8 Officiel liste? Tolerancerne med bygbladplet blev foreslået af arbejdsgruppen (DJF, LC, PD), men aldrig indstillet eller besluttet PD tager nu initiativ til at tolerancerne for bygbladplet gøres officiel. Samlet liste på PD hjemmeside med de officielle tolerancer % Barley seed lots with more than 5% or 15% leaf stripe/net blotch % of seed lots G.C. Nielsen, 2002 (plantedirektoratet) > 5 % > 15 %

9 PCR metode til detektion af bladplet og stribesyge P. graminea P. teres teres others K. Husted, 1993 GGGCCACAGTTGGAAACAGCTGCCGAGACCATAC CTCCATGACGTTTTCGCGCCGTGGTGCGTCAAGC GTTTCTTCCACAGTTTCGCAATCTTGATTATTGG TGCCCTTCTTTCGTTTGTTCGAGAAAGATGAGCC ACTAGCTTCACATGCGACCAAACCCACCCTTTTT CGCTTGAATGCCTGTGGCTGCCGCGTCTCTTGTT TGTGGCACAATCTAGCCAAGGTTTTCACAAATCG TATCCGGGCTTTGTCGTCCTGAATCGGCTTGAAG AGCATGCCAGCGATGGTACCTCGCTCCTGAAGTT CAAACTCAACGGCTGGTAGCGTCAGGACTTTGTC TGCGGCCATCCCGCTGAGTTGCCTGGCTATCTCG ATTGTGTCGATCGATTCATGGAACTCGCGGACGG CCGATTCTAATCGTTCTCTGTACAATCTCTGGTA TGTACTGCAATCTTTCGCTTCGTATCCTCGTATT TCTTATAAAGATCCGTCCCTTCAC P. graminea P. teres teres/maculata Metode tilgængelig og udbydes

10 Forekomst og betydning? Survey over forekomst af udsædsbårne sygdomme Organiseret af landscentret (Ghita Nielsen) Antal avlspartier/partier med konstateret Sygdomme/kasserede partier 40 % hvedepartier med stinkbrand Vårhvede Vinterhvede Systematisk survey ophørt Økologiske hvedepartier med konstateret forekomst af stinkbrand

11 Screening for resistens i danske kornsorter Stinkbrand: Ophørte 2009 (med ophør af SEED projektet Stribesyge: Ophørte 2006 med ophør af ORGSEED projektet

12 Procent angreb af stinkbrand i vårtriticalesorter afprøvet 2009, DJF, Flakkebjerg. Kunstig smitte med 5 g brandsporer pr kg vårtriticale. Forklaring se indledning Resultater af tidligere års forsøg kan ses i Sortsforsøg 2008 Procent angreb af stinkbrand i vårhvedesorter afprøvet 2009, DJF, Flakkebjerg. Kunstig smitte med 5 g brandsporer pr kg hvede. Forklaring se indledning Resultater af tidligere års forsøg kan ses i Sortsforsøg 2008"" SORT % stinkbrand SOMTRI 0 NOÉ 0 HE LEGALO 0 NILEX 0 LOGO 0 GRANADOR 0 DUBLET 0,2 Vinjett, vårhvedereference 10,3 Vintertriticale SORT % stinkbrand Kortego 0,0 Algalo 0,0 Lamberto 0,0 Dinaro 0,0 SW Valentino 0,0 Tritikon 0,0 Versus 0,0 Kaprys 0,0 SW Talentro 0,0 SJ ,0 Korpus 0,0 Cando 0,0 LP ,0 Nugget 0,0 Mungis 0,0 Triskell 0,0 Trigold 0,0 TIW 623 0,0 Gringo 0,0 Ti 410 0,4 HE ,5 PAJ ,5 CHD 734/00 1,0 Trigantus 3,8 Herzog, hvedereference 29,5 Dominator, rugreference 0,0 SORT % stinkbrand A 0,7 LEGUAN 4,8 SW ,0 VINJETT 10,3 ALORA 13,4 TERCIE 13,5 SAMUNO 16,0 KWS SCIROCCO 31,5 Resultater af screening for resistens mod stinkbrand. Ophørt 2009 Vinterhvede SORT % stinkbrand Stava 0,0 Hereward 6,9 LEU ,3 MH ,7 CM ,1 Gallant 19, ,4 CPBT W ,1 CPB-T W136 24,8 Herzog 25, ,8 Tambor 29,8 SWW C503 29,9 F ,1 Position 34,9 Gosmer 35,1 LEU ,6 CPBT W ,8 R ,3 Tritex 49,1 Julius 49,5 R ,9 R ,4 W ,1 Plutos 55,4 R ,9 JB. Diego 80,6 Hymack 83,1 CPB-T W140 85,0

Frøbårne sygdomme- Skadetærskler samt nye muligheder for diagnostik

Frøbårne sygdomme- Skadetærskler samt nye muligheder for diagnostik Frøbårne sygdomme- Skadetærskler samt nye muligheder for diagnostik Bent J. Nielsen DJF, Forskningscenter Flakkebjerg DanSeed Symposium Vissenbjerg 20. marts 2007 Baggrund Udsædsbårne sygdomme hyppige

Læs mere

AARHUS UNIVERSITET. 4 oktober, SEED - High Quality Seed. Maintaining Integrity in Organic Farming. seedp

AARHUS UNIVERSITET. 4 oktober, SEED - High Quality Seed. Maintaining Integrity in Organic Farming. seedp - High Quality Seed Maintaining Integrity in Organic Farming seedp Problemstilling Utilstrækkelig forsyning af økologisk udsæd Kvantitet (triticale, ærter, roer, majs, hvidkløver) Kvalitet (bælgsæd, hvede

Læs mere

OBSERVATIONSPARCELLER VINTERSÆD. Afdeling for Sortsafprøvning Plantedirektoratet

OBSERVATIONSPARCELLER VINTERSÆD. Afdeling for Sortsafprøvning Plantedirektoratet OBSERVATIONSPARCELLER 2009 VINTERSÆD Afdeling for Sortsafprøvning Plantedirektoratet Indhold OBS 2009 Oversigt 2 Vintersæd 4 Abed 7 Askov 9 Abildgård 11 Boelshøj 13 Brønderslev 15 Dyngby 17 Flakkebjerg

Læs mere

Økologisk dyrkning. Konklusioner. Artsvalg

Økologisk dyrkning. Konklusioner. Artsvalg Økologisk dyrkning Konklusioner Artsvalg Artsvalg i korn og oliefrø Vintertriticale har i årets forsøg klaret sig dårligere end i de foregående år, hvilket betyder, at der ikke har været signifikant forskel

Læs mere

Procent (%) Karakter: 1-9. Septoria, blad Lejesæd. Septoria, blad. Gulrust, aks. Meldug. Gulrust

Procent (%) Karakter: 1-9. Septoria, blad Lejesæd. Septoria, blad. Gulrust, aks. Meldug. Gulrust , aks 1 9001 Blanding 106,3 101,2 95,6 121,1 114,4 107,7 100 3,3 0,02 0,02 10 6 2 5 86 13/8 50.6 78 9.2 71.0 16.6 114,7 112,9 90,4 86,0 2 9001 Blanding 105,3 102,7 96,0 119,3 112,4 107,1 99 7 0,04 2,4

Læs mere

Skadetærskler for bygbladplet, stribesyge og spiringsfusariose

Skadetærskler for bygbladplet, stribesyge og spiringsfusariose Skadetærskler for bygbladplet, stribesyge og spiringsfusariose ans O. Pinnschmidt, DF, Flakkebjerg ans.pinnschmidt@agrsci.dk inficeret såsæd reduceret fremspiring Fusarium spp. M. nivale reduceret plantevækst

Læs mere

Forsøgsmarken Koldkærgård

Forsøgsmarken Koldkærgård Forsøgsmarken Koldkærgård 2010 2 Vinterhvede Frument Vinterhvede Frument Forsøgsareal Vinterhvede Frument Vårbyg Fairytale Vårbyg Fairytale Vårbyg Quench Vårbyg Quench Eng Vedvarende græs Koldkærgård ejes

Læs mere

FORSØGSMARKEN KOLDKÆRGÅRD

FORSØGSMARKEN KOLDKÆRGÅRD FORSØGSMARKEN KOLDKÆRGÅRD 2009 Koldkærgård ejes af Dansk Landbrugsrådgivning, Landscentret. Det samlede areal er ca. 110 ha. Jordtypen er lerjord med 12-25 % ler og 2-5 % humus. Eng Solist Ærteforsøg Medicinplanter

Læs mere

Bejdsning af hvede og raps samt nyt om resistensudvikling mod skadegørere. Ghita Cordsen Nielsen, Videncentret for Landbrug, Skejby

Bejdsning af hvede og raps samt nyt om resistensudvikling mod skadegørere. Ghita Cordsen Nielsen, Videncentret for Landbrug, Skejby Bejdsning af hvede og raps samt nyt om resistensudvikling mod skadegørere Ghita Cordsen Nielsen, Videncentret for Landbrug, Skejby Fusarium angrebne hhv. uangrebne planter 2... 20. november 2014 Forsøg

Læs mere

Økologisk og GMI-fri såsæd

Økologisk og GMI-fri såsæd Forskning i økologisk jordbrug Nyhedsbrev fra Forskningscenter for Økologisk Jordbrug, FØJO marts/april 2001 4. Årgang nr. 2 Økologisk og GMI-fri såsæd I efteråret 2000 blev der i finanslovsforliget for

Læs mere

Resultater og erfaringer med rodukrudtsbekæmpelse i økologisk planteproduktion ved AU

Resultater og erfaringer med rodukrudtsbekæmpelse i økologisk planteproduktion ved AU 24 November 2011 Økologikongres 2011, Vingstedcentret, 24 november 2011 Resultater og erfaringer med rodukrudtsbekæmpelse i økologisk planteproduktion ved AU Bo Melander 1, Ilse A. Rasmussen 2 og Niels

Læs mere

Strategier til regulering af udsædsbårne sygdomme i økologisk jordbrug

Strategier til regulering af udsædsbårne sygdomme i økologisk jordbrug This test is downloaded from the homepage of Anders Borgen (http//:www.agrologica.dk/anders.htm) Please consult his list of publications (http//:www.agrologica.dk/pub-list.htm) for reference of the publication

Læs mere

Skadevoldere i økologisk produktion af bælgplanter

Skadevoldere i økologisk produktion af bælgplanter Skadevoldere i økologisk produktion af bælgplanter Ghita Cordsen Nielsen Landscentret, Skejby Workshop, den 4. december 2003 Svampesygdomme i ærter Sædskiftesygdomme: Ærterodråd (Aphanomyces) Sct. Hanssyge

Læs mere

Gulrust i hvede - nuværende og kommende udfordringer

Gulrust i hvede - nuværende og kommende udfordringer Gulrust i hvede - nuværende og kommende udfordringer Mogens S Hovmøller, Annemarie F Justsen & Jens G Hansen Aarhus Universitet, Institut for Agroøkologi Det Globale Rustcenter mogens.hovmoller@agrsci.dk

Læs mere

Nordic Field Trial System Version: 1.0.0.17002

Nordic Field Trial System Version: 1.0.0.17002 Nordic Field Trial System Version: 1.0.0.17002 020200808 Gødskning af vårsæd, forfrugt kløvergræs Til Oversigt Landscentret, Planteavl Udkærsvej 15, Skejby 8200 Århus N. Forsøgsplanen er sidst opdateret

Læs mere

Forsøg, undersøgelser og analyser SORTSFORSØG Korn, bælgsæd og olieplanter

Forsøg, undersøgelser og analyser SORTSFORSØG Korn, bælgsæd og olieplanter Forsøg, undersøgelser og analyser SORTSFORSØG 2005 Korn, bælgsæd og olieplanter Indholdsfortegnelse Indholdsfortegnelse...1 Placering af observationsparceller og sortsforsøg...2 Forord...3 Summary...4

Læs mere

OBSERVATIONSPARCELLER VINTERSÆD. Afdeling for Sortsafprøvning Plantedirektoratet

OBSERVATIONSPARCELLER VINTERSÆD. Afdeling for Sortsafprøvning Plantedirektoratet OBSERVATIONSPARCELLER 2010 VINTERSÆD Afdeling for Sortsafprøvning Plantedirektoratet INDHOLD OBS 2010 Oversigt 2 Vintersæd 4 Abed 7 Abildgård 9 Billund 11 Boelshøj 13 Brønderslev 15 Dyngby 17 Flakkebjerg

Læs mere

3. Bekæmpelse af septoria med triazoler og triazolblandinger

3. Bekæmpelse af septoria med triazoler og triazolblandinger 3. Bekæmpelse af septoria med triazoler og triazolblandinger Bekæmpelse af septoria Forskellige midler blev afprøvet imod bekæmpelse af septoria i 2010. Forsøgene var også tilsigtet til at vurdere effekten

Læs mere

Vårbyg giver gode udbytter i økologiske forsøg

Vårbyg giver gode udbytter i økologiske forsøg Vårbyg giver gode udbytter i økologiske forsøg Vårbyg har givet gode udbytter i sædskifteforsøget i 2007, hvorimod vinterhveden har skuffet Af Jørgen E. Olesen, Ilse A. Rasmussen og Margrethe Askegaard,

Læs mere

Økologisk blandsæd. Markplan/sædskifte

Økologisk blandsæd. Markplan/sædskifte Side 1 af 5 Økologisk blandsæd Samdyrkning af korn og bælgsæd kan have flere formål: Dyrkning af proteinrigt foder. Dyrkning af bælgsæd med større dyrkningssikkerhed. Fremavl af ærter med mindre risiko

Læs mere

Kvælstofforsyningen på økologiske planteavlsbedrifter

Kvælstofforsyningen på økologiske planteavlsbedrifter Kvælstofforsyningen på økologiske planteavlsbedrifter Med udfasning af import af konventionel husdyrgødning bliver det nødvendigt med et større fokus på kvælstoffikserende afgrøder i økologiske planteavlssædskifter.

Læs mere

Danske forskere tester sædskifter

Danske forskere tester sædskifter Danske forskere tester sædskifter Jørgen E. Olesen, Ilse A. Rasmussen og Margrethe Askegaard, Danmarks Jordbrugsforskning Siden 1997 har fire forskellige sædskifter med forskellige andele af korn været

Læs mere

Gulrust i korn og frøgræs. Hvilke arter og sorter er mest udsatte?

Gulrust i korn og frøgræs. Hvilke arter og sorter er mest udsatte? Gulrust i korn og frøgræs. Hvilke arter og sorter er mest udsatte? Mogens S. Hovmøller Annemarie F. Justesen Tre hovedkategorier af rust på korn og græs Gulrust Brunrust/ kronrust Sortrust International

Læs mere

Ny dværgsort er den højestydende i 2008

Ny dværgsort er den højestydende i 2008 sorter Ny dværgsort er den højestydende i 2008 Dværgsorten Buggy har i årets landsforsøg givet hele 13 procent i merudbytte i forhold til målesorten Pergamon. Sidste års højestydende sort, Dominik, har

Læs mere

Plantebeskyttelse i økologisk jordbrug. Workshop på Forskningscenter Flakkebjerg 9. december 1998 i samarbejde med FØJO

Plantebeskyttelse i økologisk jordbrug. Workshop på Forskningscenter Flakkebjerg 9. december 1998 i samarbejde med FØJO Plantebeskyttelse i økologisk jordbrug Workshop på Forskningscenter Flakkebjerg 9. december 1998 i samarbejde med FØJO Program 9:00 Velkomst 9:15 Forskning i plantebeskyttelse Ilse A. Rasmussen 9:45 Problemer

Læs mere

AREALANVENDELSE 2004

AREALANVENDELSE 2004 DEN KGL. VETERINÆR- OG LANDBOHØJSKOLE GRØN FORVALTNING AREALANVENDELSE 2004 Bakkegården Rørrendegård Snubbekorsgård Højbakkegård Udarbejdet af KVL GI Service 2004 Baggrundskort: Kort25, Copyright Kort-

Læs mere

MARKVANDRING PÅ BORNHOLM HAVRESORTER TIL AFSKALNING, DYRKNING AF HESTEBØNNER, RÆKKEDYRKNING OG RADRENSNING. 14. juli 2016

MARKVANDRING PÅ BORNHOLM HAVRESORTER TIL AFSKALNING, DYRKNING AF HESTEBØNNER, RÆKKEDYRKNING OG RADRENSNING. 14. juli 2016 MARKVANDRING PÅ BORNHOLM HAVRESORTER TIL AFSKALNING, DYRKNING AF HESTEBØNNER, RÆKKEDYRKNING OG RADRENSNING 14. juli 2016 1 Sortsforsøg med havre med højt indhold af fedt eller protein Formålet med forsøgene

Læs mere

Grøn Viden. Ramularia-bladplet på byg. Danmarks JordbrugsForskning. Ministeriet for Fødevarer, Landbrug og Fiskeri

Grøn Viden. Ramularia-bladplet på byg. Danmarks JordbrugsForskning. Ministeriet for Fødevarer, Landbrug og Fiskeri Grøn Viden Ramularia-bladplet på byg Hans O. Pinnschmidt og Mogens S. Hovmøller, Afdeling for Plantebeskyttelse, Forskningscenter Flakkebjerg Ministeriet for Fødevarer, Landbrug og Fiskeri Danmarks JordbrugsForskning

Læs mere

GRAINLEG Bælgsæd i økologisk dyrkningforbedring

GRAINLEG Bælgsæd i økologisk dyrkningforbedring GRAINLEG 20022005 Bælgsæd i økologisk dyrkningforbedring af sygdomsresistens Birgit Jensen og Lars Bødker, DJF Flakkebjerg Bjarne Jørnsgård, KVL Jens Chr. Knudsen, Toft Planteforædling WP2 Specificitet

Læs mere

Mikroforædling eller nicheforædling. Erik Tybirk Knold & Top aps

Mikroforædling eller nicheforædling. Erik Tybirk Knold & Top aps Mikroforædling eller nicheforædling Erik Tybirk Knold & Top aps Erfaringer med rigtig forædling: Sukkerroeforædler (Maribo Seed) 5 år. Rapsforædling.(Dæhnfeldt/Prodana/DLF) 9 år. Hvedeforædling(Pajbjerg

Læs mere

Hvad siger landsforsøgene om udbytter i hestebønne og dyrkningsøkonomi? Landskonsulent Søren Kolind Hvid Videncentret for Landbrug

Hvad siger landsforsøgene om udbytter i hestebønne og dyrkningsøkonomi? Landskonsulent Søren Kolind Hvid Videncentret for Landbrug Hvad siger landsforsøgene om udbytter i hestebønne og dyrkningsøkonomi? Landskonsulent Søren Kolind Hvid Videncentret for Landbrug Hvorfor dyrke hestebønner? God vekselafgrøder forfrugtsværdi Proteinkilde

Læs mere

Landskonsulent Ghita Cordsen Nielsen

Landskonsulent Ghita Cordsen Nielsen Nyt fra Landsforsøgene: Strategier for bekæmpelse af svampe og skadedyr i korn, raps og majs Landskonsulent Ghita Cordsen Nielsen Det Europæiske Fællesskab ved Den Europæiske Fond for Udvikling af Landdistrikter

Læs mere

Landbrugsplanter: Udvikling af strategi til forebyggelse og regulering af frøbårne sygdomme i fremavlskorn

Landbrugsplanter: Udvikling af strategi til forebyggelse og regulering af frøbårne sygdomme i fremavlskorn Redegørelse om afviklingen af græsrodsforskningsprojektet Landbrugsplanter: Udvikling af strategi til forebyggelse og regulering af frøbårne sygdomme i fremavlskorn Projektets formål har været at udvikle

Læs mere

Oversigt over sædekornspartier kontrolleret i sæsonen 2013/14

Oversigt over sædekornspartier kontrolleret i sæsonen 2013/14 Ministeriet for Fødevarer, Landbrug og Fiskeri NaturErhvervstyrelsen Oversigt over sædekornspartier kontrolleret i sæsonen 2013/14 NaturErhvervstyrelsen, Nyropsgade 30, 1780 København V., Tlf. 33 95 80

Læs mere

Økologisk dyrkning. Konklusioner. Artsvalg

Økologisk dyrkning. Konklusioner. Artsvalg Økologisk dyrkning Økologisk dyrkning Konklusioner Artsvalg Artsvalg i korn og oliefrø Vintertriticale har i årets forsøg klaret sig dårligere end i de foregående år, hvilket betyder, at der ikke har været

Læs mere

Årets forsøg med bælgsæd og soja. Jesper Hansen Økologisk Rådgivning

Årets forsøg med bælgsæd og soja. Jesper Hansen Økologisk Rådgivning Årets forsøg med bælgsæd og soja. Jesper Hansen Økologisk Rådgivning Dyrkningssikre bælgplanter Dyrkning af vinterbælgsæd Sojabønner i Danmark Arter Sort Række Plantetal/m 2 Fordeling Vand Udbytte Hestebønne

Læs mere

Bedre plantesorter til økologisk jordbrug

Bedre plantesorter til økologisk jordbrug Bedre plantesorter til økologisk jordbrug Sven B. Andersen, Københavns Universitet Lars H. Jacobsen, Aarhus Universitet Thomas H. Thomsen, Landbrugets Kartoffelfond Christian S. Jensen, DLF-Trifolium Morten

Læs mere

Økologisk dyrkning. Konklusioner. Artsvalg

Økologisk dyrkning. Konklusioner. Artsvalg Økologisk dyrkning Konklusioner Artsvalg Artsvalg i korn og oliefrø I fem forsøg med vintersædsarter har der i 2006, i modsætning til tidligere år, ikke været signifikant forskel på udbytterne. Se tabel

Læs mere

Focus på udbyttejagt - tænk anderledes. DLG VækstForum 2013 v/jakob Skodborg-Jensen

Focus på udbyttejagt - tænk anderledes. DLG VækstForum 2013 v/jakob Skodborg-Jensen Focus på udbyttejagt - tænk anderledes 1 DLG VækstForum 2013 v/jakob Skodborg-Jensen Gefion s Planteavlsmøde - d. 22.11.2012 Set focus på udbyttejagt! Afgrødernes værdi forøget med ~1.300.000 kr. hos en

Læs mere

vårsæd og efterafgrøder

vårsæd og efterafgrøder vårsæd og efterafgrøder økologi produktinformation 2015 Stærkt sortiment af økologisk vårsæd og efterafgrøder Læs mere om sorterne og deres dyrkningsegenskaber Danish vårbyg agros kvægfoderprogram 2014

Læs mere

Går jorden under? Kvælstofforsyningen på økologiske plantebedrifter

Går jorden under? Kvælstofforsyningen på økologiske plantebedrifter Går jorden under? det historiske perspektiv og menneskets rolle Kvælstofforsyningen på økologiske plantebedrifter Professor Jørgen E. Olesen Kilder til kvælstofforsyningen i økologisk planteavl Deposition

Læs mere

Bygbladplet, biologi og bekæmpelse

Bygbladplet, biologi og bekæmpelse Markbrug nr. 289 marts 2004 Bygbladplet, biologi og bekæmpelse Lise Nistrup Jørgensen, Hans Pinnschmidt og Bent J. Nielsen Afdeling for Plantebeskyttelse, Forskningscenter Flakkebjerg Ghita Cordsen Nielsen

Læs mere

Producentsammenslutningen Det Økologiske Akademi. Dyrkning af korn til foder og konsum og frøgræs

Producentsammenslutningen Det Økologiske Akademi. Dyrkning af korn til foder og konsum og frøgræs Producentsammenslutningen Det Økologiske Akademi Dyrkning af korn til foder og konsum og frøgræs Korn til foder og konsum Havre Vårbyg Vårhvede Vårtriticale Rug Vintertriticale Vinterhvede (Spelt, emmer,

Læs mere

Økologisk dyrkning af efterafgrøder og grøngødning Foulum, 1. juli 2014

Økologisk dyrkning af efterafgrøder og grøngødning Foulum, 1. juli 2014 Økologisk dyrkning af efterafgrøder og grøngødning Foulum, 1. juli 2014 Producentsammenslutningen Det Økologiske Akademi Margrethe Askegaard VFL Økologi mga@vfl.dk Program: 1. Fordele og ulemper 2. Regler

Læs mere

Seedron 1000 L. Svampemiddel. Svampemiddel UN 3082 ADVARSEL OG FØRSTEHJÆLP BRUGSANVISNING

Seedron 1000 L. Svampemiddel. Svampemiddel UN 3082 ADVARSEL OG FØRSTEHJÆLP BRUGSANVISNING Seedron Seedron Svampemiddel Må kun anvendes til bejdsning af korn i lukkede industrielle anlæg. Gældende fra 26. november 2015: Dette plantebeskyttelsesmiddel må kun købes af professionelle og anvendes

Læs mere

Foders klimapåvirkning

Foders klimapåvirkning Foders klimapåvirkning Fodringsseminar 2010 Torsdag d. 15. april, Herning Søren Kolind Hvid, Planteproduktion Det Europæiske Fællesskab ved Den Europæiske Fond for Udvikling af Landdistrikter og Ministeriet

Læs mere

Vedrørende støtteordning ved dyrkning af udvalgte afgrøder i henhold til artikel 68 Jacobsen, Brian H.; Jensen, Carsten Lynge

Vedrørende støtteordning ved dyrkning af udvalgte afgrøder i henhold til artikel 68 Jacobsen, Brian H.; Jensen, Carsten Lynge university of copenhagen University of Copenhagen Vedrørende støtteordning ved dyrkning af udvalgte afgrøder i henhold til artikel 68 Jacobsen, Brian H.; Jensen, Carsten Lynge Publication date: 2011 Document

Læs mere

Bekæmpelsestærskler for svampesygdomme

Bekæmpelsestærskler for svampesygdomme Bekæmpelsestærskler for svampesygdomme Nedenfor ses en oversigt over vejledende bekæmpelsestærskler for sygdomme i korn. Tærsklerne er fra Planteværn Online og disse tærskler er relativt godt belyst. Tærsklerne

Læs mere

Sedimentation, ml FEsv pr. hkg. FEso pr. hkg EFOSsvin EFOSi. Faldtal, sek. Meldug

Sedimentation, ml FEsv pr. hkg. FEso pr. hkg EFOSsvin EFOSi. Faldtal, sek. Meldug , skala: 0-10 1 9001 Blanding 91,2 87,9 83,1 87,4 100 42,8 729 10,8 70,0 20,4 191 32 121 119 91 87 1,2 0 3 9 6 5 1 6 6 7 3 73 6/8 2,8 2 13801 Hereward AS 74,8 75,1 71,7 73,9 85 41,4 768 12,1 70,1 23,2

Læs mere

Svampestrategi 2017 Dit nettoudbytte

Svampestrategi 2017 Dit nettoudbytte Svampestrategi 2017 Dit nettoudbytte Hkg/ha 14 12 10 8 Bruttomerudbytter for svampebekæmpelse i mest dyrkede hvedesorter, landsforsøg i vinterhvede Omkostninger til delt akssprøjtning med samlet 75 procent

Læs mere

Produktinformation 2012

Produktinformation 2012 Produktinformation 2012 Vårsæd og efterafgrøder Valg af vårbyg Sortsvalg i vårbyg skal foretages med hensyntagen til anvendelse og afsætningsmulighed. Når der vælges maltbygsort er det vigtigt at overveje

Læs mere

Hvad er en god vårbyg til økologisk jordbrug?

Hvad er en god vårbyg til økologisk jordbrug? Hvad er en god vårbyg til økologisk jordbrug? FØJO II - projektet : Egenskaber ved sorter af vårbyg til økologisk dyrkning Risø DJF KVL Økologiske dyrkningsforhold indebærer ofte mindre end optimal forsyning

Læs mere

Hvad er en god vårbyg til økologisk jordbrug?

Hvad er en god vårbyg til økologisk jordbrug? Hvad er en god vårbyg til økologisk jordbrug? FØJO II - projektet : Egenskaber ved sorter af vårbyg til økologisk dyrkning Risø DJF KVL Økologiske dyrkningsforhold indebærer ofte mindre end optimale forhold:

Læs mere

Forsøg, undersøgelser og analyser. SORTSFORSØG 2010 Korn, bælgsæd og olieplanter

Forsøg, undersøgelser og analyser. SORTSFORSØG 2010 Korn, bælgsæd og olieplanter Forsøg, undersøgelser og analyser SORTSFORSØG 2010 Korn, bælgsæd og olieplanter Forsidefotos: Morten Haastrup, Dansk Landbrugsrådgivning, Videncentret for Landbrug, Planteproduktion Indholdsfortegnelse

Læs mere

Nyeste viden om betydning og bekæmpelse af skoldplet i byg

Nyeste viden om betydning og bekæmpelse af skoldplet i byg AARHUS UNIVERSITET Institut for Agroøkologi Nyeste viden om betydning og bekæmpelse af skoldplet i byg Lise Nistrup Jørgensen, Ghita C. Nielsen, Susanne Sindberg, Kristian Kristensen Indholdsfortegnelse

Læs mere

OBSERVATIONSPARCELLER VINTERSÆD. Afdeling for Sortsafprøvning NaturErhvervstyrelsen

OBSERVATIONSPARCELLER VINTERSÆD. Afdeling for Sortsafprøvning NaturErhvervstyrelsen OBSERVATIONSPARCELLER 2013 VINTERSÆD Afdeling for Sortsafprøvning NaturErhvervstyrelsen 1 2 Observationsparceller 2013 Brønderslev Aakirkeby Hobro Abildgård Foulum Holstebro Koldkærgård Dyngby Sejet Askov

Læs mere

Ompløjning af afgræsnings- og kløvergræsmarker. Ukrudtsbekæmpelse Efterafgrøder Principper for valg af afgrøde

Ompløjning af afgræsnings- og kløvergræsmarker. Ukrudtsbekæmpelse Efterafgrøder Principper for valg af afgrøde Et dokument fra Dansk Landbrugsrådgivning, Landscentret www.landscentret.dk Find mere faglig information på www.landscentret.dk/landbrugsinfo Udskrevet 2. april 2008 LandbrugsInfo > Planteavl > Afgrøder

Læs mere

KARUP KARTOFFELMELSFABRIK december 2016 og 24. januar 2017

KARUP KARTOFFELMELSFABRIK december 2016 og 24. januar 2017 KARUP KARTOFFELMELSFABRIK 13.- 2. december 216 og 24. januar 217 5 1 15 2 25 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85

Læs mere

Produktinformation 2013

Produktinformation 2013 Produktinformation Vå rs æ d og e ft e ra fgrø de r Valg af vårbyg Vårbyg Sortsvalg i vårbyg skal foretages med hensyntagen til anvendelses og afsætningsmulighed. Når der vælges maltbygsort er det vigtigt

Læs mere

Værdiafprøvningen udbytteforsøg af landbrugsplanter

Værdiafprøvningen udbytteforsøg af landbrugsplanter J:\Admin\TystofteFonden\IT\Hjemmeside\Afprøvning\VP-oversigter\VP OVERSIGTER_13 VP-steder Værdiafprøvningen 2013 - udbytteforsøg af landbrugsplanter Vinterhvede Bagehvede- kvalitet Bagehvede - Udbytte

Læs mere

Sortsforsøg Korn, bælgsæd og olieplanter

Sortsforsøg Korn, bælgsæd og olieplanter Sortsforsøg Korn, bælgsæd og olieplanter 2012 Foto: Morten Haastrup vfl.dk Foto: Morten Haastrup, Videncentret for landbrug. Indholdsfortegnelse Placering af observationsparceller og sortsforsøg...4 Forord...5

Læs mere

Udvaskning af kvælstof: Betydning af jordbearbejdning, såtidspunkt og sortsvalg

Udvaskning af kvælstof: Betydning af jordbearbejdning, såtidspunkt og sortsvalg Udvaskning af kvælstof: Betydning af jordbearbejdning, såtidspunkt og sortsvalg Elly Møller Hansen 1, Bo Melander 2 & Lars J. Munkholm 1 1 Institut for Jordbrugsproduktion og Miljø, Foulum 2 Institut for

Læs mere

Et økologisk jordbrug uden konventionel husdyrgødning og halm Asger Overgaard

Et økologisk jordbrug uden konventionel husdyrgødning og halm Asger Overgaard Gårdrapport Et økologisk jordbrug uden konventionel husdyrgødning og halm Asger Overgaard Udarbejdet af Niels Tvedegaard, Fødevareøkonomisk Institut & Økologisk Landsforening 2007 Indhold Forord... 2 1.

Læs mere

Det økonomiske økosædskifte

Det økonomiske økosædskifte Det økonomiske økosædskifte Peter Mejnertsen og Michael Tersbøl Emner i præsentationen: Økonomisk vurdering af sædskifterne Betydningen af dyrkningsfaktorer Bekæmpelse af rodukrudt økonomisk set Forslag

Læs mere

Rapport vedrørende græsrodsforskningsprojekt: Sprøjtning med mælk til bekæmpelse af meldug

Rapport vedrørende græsrodsforskningsprojekt: Sprøjtning med mælk til bekæmpelse af meldug Rapport vedrørende græsrodsforskningsprojekt: Sprøjtning med mælk til bekæmpelse af meldug Ringe den 25.oktober 2001 J.nr.93S-2462-Å00-00891 Ved Freddy Madsen, Nørhavegård, Rudkøbing og økologikonsulent

Læs mere

Resultater med bekæmpelse af tidsler og blandede rodukrudstbestande

Resultater med bekæmpelse af tidsler og blandede rodukrudstbestande Temadag om rodukrudt på Nilles Kro, 4 Oktober, 2013 Resultater med bekæmpelse af tidsler og blandede rodukrudstbestande Institut for Agroøkologi Aarhus Universitet Forskningscenter Flakkebjerg DK-4200

Læs mere

VINTERSÆD 2015 PRODUKTINFORMATION

VINTERSÆD 2015 PRODUKTINFORMATION VINTERSÆD 2015 PRODUKTINFORMATION Stærke vintersædssorter til sæson 2015/2016 NAG 50 års jubilæum 17. juni 2015 Åbent hus på dagen kl. 14-19 I NAG Borup Borupvej 65, 3320 Skævinge DANISH VALG AF AGROS

Læs mere

Forsøg, undersøgelser og analyser. Korn, bælgsæd og olieplanter

Forsøg, undersøgelser og analyser. Korn, bælgsæd og olieplanter Forsøg, undersøgelser og analyser 62576)256 * Korn, bælgsæd og olieplanter Indholdsfortegnelse Indholdsfortegnelse...1 Placering af observationsparceller og sortsforsøg...2 Forord...3 Summary...4 Afprøvningens

Læs mere

Oversigt over resultater i gårdrapporter

Oversigt over resultater i gårdrapporter Oversigt over resultater i gårdrapporter Projekt Økologisk landbrug uden konventionel gødning og halm, 2007 Oversigt over økonomiske tab på de 10 deltagende bedrifter PLANTE Samlet tab kr./år Fald i Dækningsbidrag

Læs mere

Alternative proteinkilder produktivitet og økonomi ved raps, solsikke, ærter, hestebønner

Alternative proteinkilder produktivitet og økonomi ved raps, solsikke, ærter, hestebønner Alternative proteinkilder produktivitet og økonomi ved raps, solsikke, ærter, hestebønner v. Else Vils, VSP Temagruppemøde, Herning, 25. 26. maj 2011 DW130166 Alternative proteinkilder Emner: Ærter og

Læs mere

Clonostachys rosea en svamp, der kan bekæmpe sygdomme i korn

Clonostachys rosea en svamp, der kan bekæmpe sygdomme i korn Clonostachys rosea en svamp, der kan bekæmpe sygdomme i korn Birgit Jensen Hans Jørgen Lyngs Jørgensen Institut for Plante- og Miljøvidenskab 2 Hvad er mikrobiologisk plantebeskyttelse? Brug af gavnlige

Læs mere

Oversigt over sædekornspartier kontrolleret i sæsonen 2015/16

Oversigt over sædekornspartier kontrolleret i sæsonen 2015/16 Oversigt over sædekornspartier kontrolleret i sæsonen 2015/16 NaturErhvervstyrelsen, Nyropsgade 30, 1780 København V., Tlf. 33 95 80 00 2 Indholdsfortegnelse 1. Indledning... 3 2. Bestemmelser vedrørende

Læs mere

HESTEBØNNER PÅ SVINEBEDRIFTEN

HESTEBØNNER PÅ SVINEBEDRIFTEN HESTEBØNNER PÅ SVINEBEDRIFTEN Else Vils, SEGES Videncenter for Svineproduktion Jon Birger Pedersen, SEGES Planter & Miljø Kongres for Svineproducenter Herning d. 21-10-2015 Støttet af Svineafgiftsfonden

Læs mere

Forsøg, undersøgelser og analyser SORTSFORSØG 2002. Korn, bælgsæd og olieplanter

Forsøg, undersøgelser og analyser SORTSFORSØG 2002. Korn, bælgsæd og olieplanter Forsøg, undersøgelser og analyser SORTSFORSØG 2002 Korn, bælgsæd og olieplanter Indholdsfortegnelse Indholdsfortegnelse... 1 Placering af observationsparceller og sortsforsøg... 2 Forord... 3 Summary...

Læs mere

Forskningscenter for Økologisk Jordbrug

Forskningscenter for Økologisk Jordbrug Plantebeskyttelse i økologisk jordbrug - rapport fra en workshop Ilse A. Rasmussen (Red.) FØJO Forskningscenter for Økologisk Jordbrug Plantebeskyttelse i økologisk jordbrug - rapport fra en workshop

Læs mere

Nyt dyrkningssystem med øget rækkeafstand i kornafgrøder

Nyt dyrkningssystem med øget rækkeafstand i kornafgrøder 8 juni, 2015 Økologiske feltdage, 8-9 juni, 2015 Nyt dyrkningssystem med øget rækkeafstand i kornafgrøder Factulty of Science and Technology Department of Agroecology Research Centre Flakkebjerg DK-4200

Læs mere

Oversigt over sædekornspartier kontrolleret i sæsonen 2014/15

Oversigt over sædekornspartier kontrolleret i sæsonen 2014/15 Oversigt over sædekornspartier kontrolleret i sæsonen 2014/15 NaturErhvervstyrelsen, Nyropsgade 30, 1780 København V., Tlf. 33 95 80 00 2 Indholdsfortegnelse 1. Indledning... 3 2. Bestemmelser vedrørende

Læs mere

Agrinord 17/3 2015 Darran Andrew Thomsen cand. agro Økologi i SEGES ØKO- EFTERAFGRØDER FORSØG OG PRAKTISK

Agrinord 17/3 2015 Darran Andrew Thomsen cand. agro Økologi i SEGES ØKO- EFTERAFGRØDER FORSØG OG PRAKTISK Agrinord 17/3 2015 Darran Andrew Thomsen cand. agro Økologi i SEGES ØKO- EFTERAFGRØDER FORSØG OG PRAKTISK PROGRAM Det arbejder jeg/vi med i SEGES? Hvad kan efterafgrøder? Såtidsforsøg efterafgrøder Eftervirkning

Læs mere

Oversigt over Landsforsøgene 2014

Oversigt over Landsforsøgene 2014 Oversigt over Landsforsøgene 2014 vfl.dk Oversigt over Landsforsøgene 2014 Forsøg og undersøgelser i Dansk Landbrugsrådgivning Samlet og udarbejdet af LANDBRUG & FØDEVARER, PLANTEPRODUKTION ved chefkonsulent

Læs mere

God planlægning er 3 ud af 6 tons raps

God planlægning er 3 ud af 6 tons raps God planlægning er 3 ud af 6 tons raps Dorthe Kappel dorthe.kappel@monsanto.com mobil: 30 38 13 19 Monsanto Picture: Anne Williams 2 3 I planlægningen bør overvejes.. Placering i sædskiftet Sortsvalg Kold

Læs mere

Hvede. Ingen regulering Fradrag: kr. 0,45 pr. 0,1% under 11,5% Afregnes som foderhvede Faldtal 250 225 250 og derover 249 225: 224 og derunder

Hvede. Ingen regulering Fradrag: kr. 0,45 pr. 0,1% under 11,5% Afregnes som foderhvede Faldtal 250 225 250 og derover 249 225: 224 og derunder HØSTINFO 2015 Hvede Brødhvede/vårhvede Handles individuelt mellem køber og sælger og på individuelle kontraktkrav til kvalitet og er derfor ikke omfattet af nærværende afregningsaftale. Eksporthvede Protein,

Læs mere

Relevante afgrøder i økologisk produktion Økologikonsulent Lars Egelund Olsen

Relevante afgrøder i økologisk produktion Økologikonsulent Lars Egelund Olsen Producentsammenslutningen Det Økologiske Akademi Relevante afgrøder i økologisk produktion Økologikonsulent Lars Egelund Olsen Hvordan adskiller afgrødevalget hos økologer sig fra det konventionelle? 2...

Læs mere

Et økologisk jordbrug uden konventionel husdyrgødning og halm Torsten Wetche

Et økologisk jordbrug uden konventionel husdyrgødning og halm Torsten Wetche Gårdrapport Et økologisk jordbrug uden konventionel husdyrgødning og halm Torsten Wetche Udarbejdet af Niels Tvedegaard, Fødevareøkonomisk Institut & Økologisk Landsforening 2007 Indhold Forord... 2 1.

Læs mere

Bestemmelser for fremavl af korn

Bestemmelser for fremavl af korn Bestemmelser for fremavl af korn 5. udgave, juni 2013 FORORD DLG ønsker med denne folder at sætte fokus på de specielle forhold man skal være opmærksom på som fremavler af sædekorn. NaturErhvervstyrelsens

Læs mere

Bekæmpelse af Neonectria ædelgrankræft på nordmannsgran

Bekæmpelse af Neonectria ædelgrankræft på nordmannsgran Bekæmpelse af Neonectria ædelgrankræft på nordmannsgran Temadag om Neonectria og certificering 19. Januar 2015 Klaus Paaske & Magnus Gammelgaard Aarhus Universitet Flakkebjerg Disposition Baggrund Forsøg

Læs mere

Arealanvendelse, husdyrproduktion og økologisk areal i 2003 til brug ved slutevaluering

Arealanvendelse, husdyrproduktion og økologisk areal i 2003 til brug ved slutevaluering Ministeriet for Fødevarer, Landbrug og Fiskeri Fødevareøkonomisk Institut Baggrundsnotat til Vandmiljøplan II slutevaluering Arealanvendelse, husdyrproduktion og økologisk areal i 2003 til brug ved slutevaluering

Læs mere

HighCrop. Går jorden under? Sådan får landmanden højere udbytter med udbyttestabilitet. det historiske perspektiv og menneskets rolle

HighCrop. Går jorden under? Sådan får landmanden højere udbytter med udbyttestabilitet. det historiske perspektiv og menneskets rolle Går jorden under? det historiske perspektiv og menneskets rolle Sådan får landmanden højere udbytter med udbyttestabilitet Professor Jørgen E. Olesen HighCrop Udfordringer i økologisk jordbrug Behov for

Læs mere

Observationsparceller 2015

Observationsparceller 2015 VP OVERSIGTER_15 / OBS-steder Observationsparceller 2015 Parcelstørrelse i m 2 Vinterhve Vinterbyg Vinterrug Triticale Vårbyg Havre Vårhvede 295 Abildgård MS MS MS MS MS MS MS 1 Askov 20 20 20 20 20 20

Læs mere

Forskellige bekæmpelsesstrategier i korn. Lise Nistrup Jørgensen Danmarks JordbrugsForskning

Forskellige bekæmpelsesstrategier i korn. Lise Nistrup Jørgensen Danmarks JordbrugsForskning Forskellige bekæmpelsesstrategier i korn Lise Nistrup Jørgensen Danmarks JordbrugsForskning Hvordan behandlede I hvede med fungicider i 2002 92 % af hele arealet blev behandlet med fungicider I gennemsnit

Læs mere

Fusarium i korn. Ghita Cordsen Nielsen Landbrugets Rådgivningscenter Skejby

Fusarium i korn. Ghita Cordsen Nielsen Landbrugets Rådgivningscenter Skejby Fusarium i korn Ghita Cordsen Nielsen Landbrugets Rådgivningscenter Skejby Aksfusarium i hvede Fusarium i hvede Pct. kerner med Fusarium 8 6 4 2 0 2 2,5 mm 2,5 2,75 mm 2,75 3 mm > 3 mm (Piorr, 1991) Aksfusarium

Læs mere

DRIFTSANALYSER 2013/2014 FORELØBIGE RESULTATER

DRIFTSANALYSER 2013/2014 FORELØBIGE RESULTATER DRIFTSANALYSER 2013/2014 FORELØBIGE RESULTATER 2013/2014 2013/2014 Prognose Gnsn. Bedste ½ Antal ejendomme 41 21 Gens. størrelse, ha 528 637 Gens. høstudbytte korn, kg pr. ha 7.350 7.293 7.698 Arealfordeling

Læs mere

Nye udfordringer med gulrust seneste resultater fra GRRC

Nye udfordringer med gulrust seneste resultater fra GRRC Nye udfordringer med gulrust seneste resultater fra GRRC Mogens Støvring Hovmøller Professor Aarhus Universitet, Institut for Agroøkologi Det Globale Rustcenter mogens.hovmoller@agrsci.dk Växjö, 3. december

Læs mere

Dét skal vi forholde os til i 2017

Dét skal vi forholde os til i 2017 Dét skal vi forholde os til i 2017 1 Fungicideffekt mod septoria i 2006 % effekt (vurderet på de 2 øverste blade i st. 65-73) 100 90 80 70 60 Septoria DJF 2006 Semi-field forsøg Uddrag ¾ dosering Sort:

Læs mere

Økologi uden konventionel gødning og halm

Økologi uden konventionel gødning og halm Økologi uden konventionel gødning og halm Niels Tvedegaard Fødevareøkonomisk Institut Dias 1 Vigtigste forudsætninger Priser Korn: Ært/lupin Blandsæd Grovfoder: 2,00 kr. pr kg. 2,00 kr. pr kg. 1,90 kr.

Læs mere

Rug fra mark til mave. Kongres for svineproducenter 2013, Herning Dorthe K. Rasmussen, Ernæring & Reproduktion Søren Kolind Hvid, Planteproduktion

Rug fra mark til mave. Kongres for svineproducenter 2013, Herning Dorthe K. Rasmussen, Ernæring & Reproduktion Søren Kolind Hvid, Planteproduktion Rug fra mark til mave Kongres for svineproducenter 2013, Herning Dorthe K. Rasmussen, Ernæring & Reproduktion Søren Kolind Hvid, Planteproduktion Rug fra mark til mave Grisen Hvad ved vi om rug til foder?

Læs mere

Situationen i marken. Planteavlskonsulent Ole Hansen Telefon Mail: Rapsjordloppens larve bekæmpes fra ca.

Situationen i marken. Planteavlskonsulent Ole Hansen Telefon Mail: Rapsjordloppens larve bekæmpes fra ca. Plantenyt nr. 34 den 27. september 2016 - Situationen i marken - Status på bladlus og havrerødsot - Vækstregulering og svampebekæmpelse i vinterraps - Mangan til vintersæd - Rabat markplanlægning - Vårbygsorter

Læs mere

Økologimøde. 25. januar 2017

Økologimøde. 25. januar 2017 Økologimøde 25. januar 2017 Velkomst v/ Leif Hagelskjær Afdelingschef Planteavl Få nok ud af gødningen v/ Diana Boysen Poulsen Økologikonsulent Program Kort om gødningsreglerne Sædskifte Efterafgrøder

Læs mere

Økologisk planteavl uden husdyrgødning Af Jesper Hansen

Økologisk planteavl uden husdyrgødning Af Jesper Hansen Økologisk planteavl uden husdyrgødning Af Jesper Hansen Debatten vedrørende anvendelse af ikke økologisk gødning på økologiske bedrifter har ligget stille i en periode. Der er dog ingen tvivl om, at det

Læs mere

VÅRSÆD 2015. Jacob Hansen, Nordic Seed

VÅRSÆD 2015. Jacob Hansen, Nordic Seed VÅRSÆD 2015 Jacob Hansen, Nordic Seed EVERGREEN Unik sundhed Stabilt højt udbytte Middel stråstyrke Mlo-resistent All-round sort, foder og økologi Middel til højt proteinindhold Egnet til økologi Høj sortering

Læs mere

Aarhus Universitet Institut for Agroøkologi. Askov Forsøgsstation. Markplan 2012

Aarhus Universitet Institut for Agroøkologi. Askov Forsøgsstation. Markplan 2012 AU Aarhus Universitet Institut for Agroøkologi Askov Forsøgsstation Markplan 2012 2 3 Askov Forsøgsstation Askov Forsøgsstation er oprettet i 1885 og hører under Aarhus Universitet. Til forsøgsstationen

Læs mere