Dansk resumé for begyndere

Størrelse: px
Starte visningen fra side:

Download "Dansk resumé for begyndere"

Transkript

1 Dansk resumé for begyndere Dansk resumé for begyndere Dette afsnit introducerer bakteriel genregulation for enhver uden forudgående kendskab til dette emne. Alle nødvendige, videnskabelige betegnelser er defineret og tekniske detaljer er udeladt. Sidst i dette afsnit gives et kort resumé af resultater opnået i dette projekt og beskrevet i denne afhandling. Bakterier Bakterier er levende organismer, som kun består af en enkelt celle, i modsætning til højerestående organismer såsom svampe, planter og mennesker. Fordelen ved den simple livsstil, er bakteriers evne til hurtigt at ændre sig og overleve, enten som enkelte celler eller som celle-samfund, i respons til selv ekstreme ændringer i deres omgivelser. Bakterier findes og trives stort set overalt på Jorden, lige fra vulkaniske svovlsøer med temperaturer over kogepunktet til menneskets tarmsystem, og det er f.eks. generelt anerkendt, at et menneske bærer på flere bakterieceller end menneskeceller. Mælkesyrebakterier, som er beskrevet i denne afhandling, er relativt simple bakterier med det tilfælles, at de er i stand til at producere store mængder mælkesyre (laktat), hvilket har givet dem deres navn. De har dog ganske forskellige egenskaber og ofte med indflydelse på mange mennesker. Nogle er kendte for deres evne til at give sygdom, eksemplificeret ved Streptococcus pneumoniae, som kan give lungebetændelse. Andre, såsom Lactococcus og Lactobacillus, som ikke er sygdomsfremkaldende, er blevet brugt i tusinder af år til konservering af mælkeprodukter og andre fødevarer, da de er i stand til at forhindre vækst af andre, skadelige bakterier. Metabolisme Alle levende organismer optager næringsstoffer fra deres omgivelser, og omsætter disse til energi og byggeklodser, som cellen har brug for til vækst. Dette kaldes metabolisme, en samlet betegnelse som spænder over hundredvis af processer i cellen, hvilket vil sige omdannelsen af et stof til et andet (Fig. Add.1). Dannelsen af et bestemt stof fra et andet kan foregå i små trin, som hver tilføjer en lille ændring til det oprindelige stof. En sådan række af trin kaldes en metabolisme- pathway eller metabolismevej. Omdannelsen i et enkelt trin udføres af såkaldte enzymer, som er en bestemt form for proteiner, dedikeret til at katalysere denne slags omdannelser i 203

2 Addendum levende celler. Proteiner, som består af en kæde af forbundne, mindre enheder (kaldet aminosyrer), er komplekse molekyler med en lang række funktioner i cellen, f.eks. som byggeklodser, i transportprocesser når næringsstoffer optages fra omgivelserne, som enzymer i omdannelsesprocesser, eller i kontrolfunktioner som regulerer alle disse processer. Proteiner selv dannes på grundlag af gener (se nedenfor), og forskellige gener danner basis for forskellige proteiner. Celle Omdannelsesprocess Næringsstoffer Metabolisme A B C D Affaldsstoffer Energi Byggeklodser Figur Add.1. Simplificeret fremstilling af metabolisme i en bakteriecelle. Dobbeltcirklen angiver en enkelt bakteriecelle, og bogstaverne angiver en metabolisme-vej hvor et næringsstof bliver omsat til en række forskellige intra-cellulære produkter (A, B, C og D) via processtrin udført af enzymer. De intracellulære produkter kan f.eks. blive anvendt som byggeklodser, til at producere energi, som igen kan anvendes til at udnytte andre næringstoffer, eller blot udskilt fra cellen som uanvendelige affaldsstoffer. Kromosomer og gener Et kromosom bærer en levende celles samlede arvemasse ved at indeholde alle cellens gener. Bakteriers kromosomer er cirkulære og består af DNA (deoxyribonucleic acid), hvilket er en lang kæde af såkaldte nukleotid-baser (eller blot baser) (Fig. Add.2). Der findes fire forskellige slags baser, ofte angivet som bogstaver (A, C, G og T), og kromosomer kan gengives som ét langt ord på millioner af bogstaver, hvor disse fire bogstaver gentages i forskellige kombinationer. En vilkårlig række af baser kan være kodende (gen) eller ikke-kodende, saa kromosomet består af gentagne, kodende regioner på hundrede til tusinde baser (gener), hver afbrudt af ikke-kodende regioner som kan have en hvilken som helst længde (Fig. Add.2). Gener koder for proteiner. I en process som hedder transkription bliver den kodende del af genet oversat til et intermediært molekyle kaldet RNA (ribonucleic acid; også en kæde af baser som DNA), som v.h.a. translation igen bliver oversat til en kæde af 204

3 Dansk resumé for begyndere aminosyrer (Fig. Add.3). Denne aminosyre-kæde udgør altså et specifikt protein, og afhængigt af den specifikke orden af de fire baser i forskellige gener, bliver forskellige aminosyrekæder, og derfor forskellige proteiner, produceret. A. Komplet kromosom B. Kromosom-del Kodende DNA Ikke-kodende DNA Kontrol-region Start-sted Gen Operon-struktur C. DNA-sekvens Kontrol-region Start-sted Gen-start CAATGTAATTACATTTGACAGATTCTATAATGCAAGATGAA Ikke-kodende sekvens Kodende Figur Add.2. Skematisk fremstilling af faktorer som er involveret i genregulation i bakterier. (A) Et bakteriekromosom er et cirkulært DNA molekyle (af milioner af nukleotid-baser) som indeholder cellens komplette arvemateriale i form af tusinder af gener. (B) Del af kromosomet forstørret op, med angivelse af gener (hvide bokse), startsteder (pile), og kontrolregioner (sorte bokse), på det kromosomale DNA (vandret streg). Gener består af kodende DNA, og alt andet af ikke-kodende DNA. De to gener til højre er placeret i en operon-struktur, hvilket vil sige at begge gener aktiveres og kontrolleres fra et enkelt startsted, foran det første gen. (C) Forstørrelse af region omkring et startsted. Bogstavrækken angiver den specifikke nukleotid-base-sekvens af DNA et, med angivelse af de sekvenser som svarer til kontrolregionen, startstedet og genet. Kun begyndelsen af genet, som kan være flere hundrede eller tusinde baser langt, er vist. Regulation af gener Gener kan være aktive eller ikke-aktive, hvilket afgør om de respektive proteiner bliver dannet eller ej. Det er ikke altid attraktivt for en celle at holde alle 205

4 Addendum gener aktive, da dette koster energi som kan bruges andetsteds. Under visse omstændigheder er der ikke brug for bestemte proteiner, hvorfor deres gener bliver lukket ned, og under andre omstændigheder er det brug for bestemte proteiner, og deres gener bliver aktiveret. Denne process kaldes generelt for genregulation. Regulator Stimulus Respons DNA Gen Transkription RNA Translation Protein A Katalyse af process B Figur Add.3. Fra gen til funktion - overblik over protein-syntese og genregulation. En lille del af bakteriekromosomet er angivet med DNA, med et gen (hvid boks), et startsted (pil) og en kontrolregion (sort boks). Genet bliver oversat fra DNA til RNA via en process som kaldes transkription. Via translation bliver RNA videre oversat til en aminosyrekæde, kaldet et protein (i dette tilfælde et enzym), som kan katalysere omdannelsen af A til B i cellens metabolisme. Produktet B virker som stimulus for et regulatorprotein (dannet fra et andet gen), hvis respons er at binde sig til kontrolregionen, hvilket inhiberer aktiviteten af startstedet, og dermed af genet. På denne måde vil en høj koncentration of B bevirke et fald i dannelsen af proteinet (enzymet) som danner B fra A, og altså et fald i dannelsen af B. Modsat vil en lav B -koncentration resultere i dannelsen af mere B. I den ikke-kodende region foran et gen findes en basesekvens som angiver genets startsted, og så længe intet forstyrer dette startsted, vil genet have en vis grad af aktivitet (Fig. Add.2 og Add.3). I forbindelse med dette startsted, også i den ikkekodende region foran et gen, findes ofte en såkaldt kontrolregion, som har direkte inflydelse på startstedet (Fig. Add.2 og Add.3). Nogle proteiner, kaldet (transkriptionelle) regulatorer, interagerer med (eller binder til) denne kontrolregion, i respons til visse cellulære stimuli (f.eks. et næringsstof eller lign.) og 206

5 Dansk resumé for begyndere regulerer derved genets aktivitet (transkriptionel regulation) (Fig. Add.3). Regulatorproteiner er desuden ofte i stand til at kontrollere aktiviteten af flere forskellige gener på én gang. Dette kan hovedsageligt opnås på to forskellige måder. Først kan den nødvendige kontrolregion være til stede foran flere forskellige gener placeret forskellige steder på kromosomet. Alternativt (men meget ofte forekommende i bakterier) kan en række af gener være placeret lige efter hinanden på kromosomet (kaldet en operon-struktur), hvorved de alle kan aktiveres fra et enkelt startsted og reguleres fra en enkelt kontrolregion, lokaliseret foran det første gen i rækken (Fig. Add.2). I begge tilfælde er resultatet, at en enkelt regulator og en enkelt type kontrolregion kan regulere produktionen af en lang række af forskellige proteiner og dermed processer i cellen, hvilket kaldes et regulatorisk netværk. Transkriptionel regulation af gener involveret i metabolisme af aminosyrerne glutamin, glutamat og arginin Projektet beskrevet i denne afhandling bestod i at karakterisere funktionen af tre forskellige regulator-proteiner, kaldet GlnR, ArgR og AhrC, i mælkesyrebakterien Lactococcus lactis subsp. cremoris MG1363 (L. lactis), anvendt som starterkultur ved syrning af mælk under fremstilling af en række fødevarer. Aminosyren glutamin bliver dannet ved kobling af ammonium til aminosyren glutamat, i en energiforbrugende proces som bliver udført af enzymet glutaminsynthetase (eller GS) (Fig. 1.3). Genet som koder for dette enzym er lokaliseret i en operon-stuktur med et gen som koder for regulator-proteinet GlnR. Ved at konstruere en mutant, hvor genet som koder for GlnR var fjernet, og sammenligne denne mutant med moderstammen (uden mutationen), var det muligt at afgøre hvilke gener som reguleres af GlnR i L. lactis. GlnR er istand til at kontrollere glutamin/glutamatmetabolismen i cellen ved at binde til kontrol-regioner kaldet GlnR-boxes foran tre operon-strukturer som koder for proteinerne AmtB og GlnK, involveret i hhv. ammonium-transport og nitrogen-sensing, og GlnR og GS, beskrevet ovenfor, samt GlnP og GlnQ, involveret i transport af glutamin (Fig. 6.1). Det kunne desuden fastlægges, at denne regulation var direkte afhængig af tilstedeværelsen af glutamin og ammonium i omgivelserne. Ydermere var der antydninger af, at et endnu ukendt regulator-protein er involveret i regulation af generne som koder for AmtB og GlnK. I L. lactis bliver aminosyren arginin dannet fra glutamat i en lang metabolismevej som består af otte enzymatiske trin (biosyntese), og nedbrudt via en 207

6 Addendum anden metabolismevej som i tre enzymatiske trin omdanner arginin til ammonium, kuldioxid og energi (katabolisme) (Fig. 1.4). Arginin havde en tydelig effekt på aktiviteten af generne som koder for enzymerne der udfører disse processer: Under høj koncentration af arginin i omgivelserne var aktiviteten af generne involveret i argininbiosyntese lav, og aktiviteten af de kataboliske gener høj. Det modsatte var, som ventet, tilfældet under lav argininkoncentration. Overraskende viste det sig, at to forskellige regulatorproteiner, ArgR og AhrC, begge var nødvendige for denne genregulation. Når bare én af disse regulatorer blev fjernet, ophørte den observerede argininafhængige regulation af biosyntesen såvel som af katabolismen. Imidlertid var effekten ikke ens for de to metabolismeveje. Ved deletion af én eller begge regulatorer var aktiviteten af de biosyntetiske gener konstant høj, uafhægigt af argininkoncentration. I modsætning havde deletion af ArgR, eller både ArgR og AhrC, ingen betydelig effekt på aktiviteten af katabolisme-generne, men fjernelsen af kun AhrC resulterede i en meget lav aktivitet af disse gener. De viste sig at de to forskellige regulatorproteiner havde forskellige funktioner i regulation af argininmetabolisme. ArgR alene var istand til at interagere med kontrolregionerne, men uafhængigt af arginin. Så snart både ArgR og AhrC var til stede blev argininafhængig regulation genoprettet, og der var stærke indikationer af at de to regulatorer, udover at interagere med DNA, også interagerer med hinanden, hvilket er usædvanligt i bakterier. En model over regulationsmekanismen giver følgende konklusioner (Fig. 5.9): Under høj koncentration af arginin inhiberer ArgR og AhrC (bundet til hinanden) aktiviteten af argininbiosyntese-generne, så der ikke bliver produceret arginin i cellen. Samtidig forbliver argininkatabolisme-generne aktive, så overskydende arginin kan blive brugt af cellen. Under lav koncentration af arginin binder ArgR og AhrC sig ikke længere til hinanden, og kan derfor ikke længere inhibere arginin-biosyntese-generne, hvorfor disse har høj aktivitet og arginin bliver produceret. ArgR alene (ikke bundet til AhrC) kan interagere med kontrolregionen i argininkatabolisme-generne, der som resultat bliver inhiberet, hvilket forhindrer at arginin bliver nedbrudt. 208

Energi, Enzymer & enzymkinetik.metabolisme

Energi, Enzymer & enzymkinetik.metabolisme (gruppeopgaver i databar 152 (og 052)) Energi, Enzymer & enzymkinetik.metabolisme Tirsdag den 17. september kl 13-14.15 (ca) Auditorium 53, bygning 210 Susanne Jacobsen sja@bio.dtu.dk Enzyme and Protein

Læs mere

Proteiner. Proteiner er molekyler der er opbygget af "aminosyrer",nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde

Proteiner. Proteiner er molekyler der er opbygget af aminosyrer,nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde Proteiner Proteiner er molekyler der er opbygget af "aminosyrer",nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde Der findes ca. 20 aminosyrer i menneskets organisme. Nogle

Læs mere

Syv transmembrane receptorer

Syv transmembrane receptorer Syv transmembrane receptorer Receptoren som kommunikationscentral Cellemembranen definerer grænsen mellem en celles indre og ydre miljø, der er meget forskelligt. Det er essentielt for cellens funktion

Læs mere

Struktur og funktion af gener

Struktur og funktion af gener Molekylærbiologi og genetik S4, F2008 f Malene Munk Jørgensen Emne: Struktur og funktion af gener Link: undervisningsplanen for S4-molekylærbiologi og genetik MMJ, VI niversity ollege Bioanalytikeruddannelsen

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ofte stillede spørgsmål, januar 2011

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ofte stillede spørgsmål, januar 2011 Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ofte stillede spørgsmål, januar 2011 Svar på ofte stillede spørgsmål om HD - den første i en

Læs mere

Udbytteberegning ved fermentering

Udbytteberegning ved fermentering Bioteknologi 2, Tema 3 Opgave www.nucleus.dk 6 Udbytteberegning ved fermentering Opgaven bygger videre på Bioteknologi 2, side 11-18. Ved fermenteringsprocesser er det af stor teknisk og økonomisk betydning

Læs mere

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve Vejledende opgavesæt 1 Bioteknologi A Gymnasiale uddannelser 5 timers skriftlig prøve Vejledende opgavesæt 1 Mandag den 31. maj 2010 kl. 9.40-14.40 Side 1 af 8 sider pgave 1. Genmodificeret ris Vitamin

Læs mere

PCR (Polymerase Chain Reaction): Opkopiering af DNA

PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR til at opkopiere bestemte DNA-sekvenser i en prøve er nu en af genteknologiens absolut vigtigste værktøjer. Peter Rugbjerg, Biotech Academy PCR (Polymerase

Læs mere

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' Forskere kan lave præcise ændringer

Læs mere

Fra mutationer til sygdom

Fra mutationer til sygdom Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Nyt antistof afslører farlige dele af huntingtinproteinet Et nyt antistof gør forskere i stand

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-Jun 2010 Institution Sukkertoppen Uddannelse Fag og niveau Lærer(e) Hold htx Biologi B Thomas Haack Den

Læs mere

1. Cellen og celledelinger. 2. Respiration og gæring

1. Cellen og celledelinger. 2. Respiration og gæring 1. Cellen og celledelinger Gør rede for dyrecellens opbygning og beskriv nogle af de processer der foregår i cellen. Beskriv DNA s opbygning og funktion. Beskriv i oversigtsform mitosen, og diskuter mitosens

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

Organismer inddeles i tre fundamentale stofomsætningstyper:

Organismer inddeles i tre fundamentale stofomsætningstyper: Stofskiftetyper Organismer inddeles i tre fundamentale stofomsætningstyper: autotrofe organismer: organismer som opbygger organisk stof ved fotosyntese (eller i nogle tilfælde kemosyntese); de kræver foruden

Læs mere

Folkeskolens afgangsprøve December 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B4

Folkeskolens afgangsprøve December 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B4 Folkeskolens afgangsprøve December 2012 B4 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B4 afgangsprøver december 2012 Sæt 4 Evolution og udvikling Det er cirka

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet?

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Lyn dine gener op! En baglæns besked, gemt i 'backup-dna'et'

Læs mere

Menneskets væskefaser

Menneskets væskefaser Menneskets væskefaser Mennesket består af ca. 60% væske (vand) Overordnet opdelt i to: Ekstracellulærvæske og intracellulærvæske Ekstracellulærvæske udgør ca. 1/3 Interstitielvæske: Væske der ligger mellem

Læs mere

Genbrug af behandlingsformer

Genbrug af behandlingsformer Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Genbrug af et lægemiddel giver os ny indsigt i HS Et eksisterende lægemiddel kan booste HS-hjernecellerne

Læs mere

Eksamensopgaver. Biologi C DER KAN OPSTÅ ÆNDRINGER I DE ENDELIGE SPØRGSMÅL

Eksamensopgaver. Biologi C DER KAN OPSTÅ ÆNDRINGER I DE ENDELIGE SPØRGSMÅL Eksamensopgaver Biologi C DER KAN OPSTÅ ÆNDRINGER I DE ENDELIGE SPØRGSMÅL 1 Vandmiljøet 1. Gør rede for de vigtigste processer i et økosystem. 2. Beskriv hvordan økosystemet i en sø reagerer, hvis søen

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Træning øger genbrug i museceller. Er det derfor, at motion er

Læs mere

Kort fortalt om. Mælkesyrebakterier og tarmens funktion

Kort fortalt om. Mælkesyrebakterier og tarmens funktion Kort fortalt om Mælkesyrebakterier og tarmens funktion Tarmen - og dine mange venner! Du kender måske udtrykket Maven er din bedste ven!? Maven er rigtigt nok en god ven, og hvis den har det godt, har

Læs mere

Forsvundet ved oversættelsen? Ny viden om hvordan proteinet for Huntingtons Sygdom dannes Du siger kartoffel. huntingtingenet

Forsvundet ved oversættelsen? Ny viden om hvordan proteinet for Huntingtons Sygdom dannes Du siger kartoffel. huntingtingenet Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Forsvundet ved oversættelsen? Ny viden om hvordan proteinet for Huntingtons Sygdom dannes Dannelsen

Læs mere

Er der flere farver i sort?

Er der flere farver i sort? Er der flere farver i sort? Hvad er kromatografi? Kromatografi benyttes inden for mange forskellige felter og forskningsområder og er en anvendelig og meget benyttet analytisk teknik. Kromatografi bruges

Læs mere

Mælkesyrebakterier og holdbarhed

Mælkesyrebakterier og holdbarhed Mælkesyrebakterier og holdbarhed Formål Formålet med denne øvelse er at undersøge mælkesyrebakteriers og probiotikas evne til at øge holdbarheden af kød ved at: 1. Undersøge forskellen på bakterieantal

Læs mere

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod.

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod. Gå op i røg Hvilke konsekvenser har rygning? Udfordringen Denne udfordring handler om nogle af de skader, der sker på kroppen, hvis man ryger. Du kan arbejde med, hvordan kulilten fra cigaretter påvirker

Læs mere

Cellekernen (Nucleus) Sebastian Frische Anatomisk Institut

Cellekernen (Nucleus) Sebastian Frische Anatomisk Institut Cellekernen (Nucleus) Sebastian Frische Anatomisk Institut Cellekernen Cellekernens overordnede struktur kernemembranen/nucleolemma kromatin nucleolus Cellecyklus faser i cellecyklus faser i mitosen Størrelse:

Læs mere

Eksamensspørgsmål Biologi C maj-juni 2014 Sygeeksamen: 4cbicsy1

Eksamensspørgsmål Biologi C maj-juni 2014 Sygeeksamen: 4cbicsy1 Eksamensspørgsmål Biologi C maj-juni 2014 Sygeeksamen: 4cbicsy1 HF og VUC Nordsjælland. Helsingørafdelingen Lærer: Lisbet Heerfordt, Farumgårds Alle 11, 3520 Farum, tlf. 4495 8708, mail: lhe@vucnsj.dk.

Læs mere

Brugsvejledning for 7827.10 dialyseslange

Brugsvejledning for 7827.10 dialyseslange Brugsvejledning for 7827.10 dialyseslange 14.06.07 Aa 7827.10 1. Præsentation Dialyseslangen er 10 m lang og skal klippes i passende stykker og blødgøres med vand for at udføre forsøgene med osmose og

Læs mere

Uden enzymer var der ikke liv på jorden

Uden enzymer var der ikke liv på jorden Uden enzymer var der ikke liv på jorden 1 2 I naturen findes mangfoldige mikroorganismer, som Novozymes kan benytte til fremstilling af enzymer 3 4 Mikroorganismer dyrket på steril agar i laboratoriet

Læs mere

Elevens uni-login: Skolens navn: Tilsynsførendes underskrift: FP9. 9.-klasseprøven BIOLOGI

Elevens uni-login: Skolens navn: Tilsynsførendes underskrift: FP9. 9.-klasseprøven BIOLOGI Elevens uni-login: Skolens navn: Tilsynsførendes underskrift: FP9 9.-klasseprøven BIOLOGI Maj 2016 B1 Indledning Rejsen til Mars Det er blevet muligt at lave rumrejser til Mars. Muligheden for bosættelser

Læs mere

Eksamensspørgsmål til BiB biologi B 2015

Eksamensspørgsmål til BiB biologi B 2015 Eksamensspørgsmål til BiB biologi B 2015 Med udgangspunkt i de udleverede bilag og temaet evolution skal du: 1. Redegøre for nogle forskellige teorier om evolution, herunder begrebet selektion. 2. Analysere

Læs mere

Styrk dit immunforsvar. - med kost og træning

Styrk dit immunforsvar. - med kost og træning Styrk dit immunforsvar - med kost og træning Immunforsvaret Immunforsvarets vigtigste opgave er at beskytte mod infektioner og fremmede stoffer som f.eks.: Bakterier Svampe Parasitter Virus Cancerceller

Læs mere

Forårsager et 'rustent hængsel' Huntingtons sygdom? Huntingtin mutant huntingtin

Forårsager et 'rustent hængsel' Huntingtons sygdom? Huntingtin mutant huntingtin Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Forårsager et 'rustent hængsel' Huntingtons sygdom? Canadiske forskere har fundet ud af, at det

Læs mere

OPGAVER ØL -verdens første svar på anvendt bioteknologi

OPGAVER ØL -verdens første svar på anvendt bioteknologi OPGAVER ØL -verdens første svar på anvendt bioteknologi Biotech Academy BioCentrum-DTU Søltofts Plads DTU - Bygning 221 2800 Kgs. Lyngby www.biotechacademy.dk bioteket@biocentrum.dtu.dk SMÅ OPGAVER Nedskriv

Læs mere

EKSAMENSOPGAVER. Eksamensopgaver uden bilag

EKSAMENSOPGAVER. Eksamensopgaver uden bilag EKSAMENSOPGAVER Eksamensopgaver uden bilag Eksaminator: Morten Sigby-Clausen (MSC) 1. Celler, fotosyntese og respiration 2. Den naturlige å og vandløbsforurening 3. Kost og ernæring 4. DNA og bioteknologi

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin December/januar 13-14 Institution Vestegnen HF VUC Albertslund og Rødovre Uddannelse Fag og niveau Lærer(e)

Læs mere

Hvad er så vigtigt ved målinger?

Hvad er så vigtigt ved målinger? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Spændende opdagelse i blodceller fra patienter med Huntingtons Sygdom Mængden af huntingtinprotein

Læs mere

Oste-kemi. Størstedelen af proteinerne i mælken findes som små kugleformede samlinger, kaldet miceller.

Oste-kemi. Størstedelen af proteinerne i mælken findes som små kugleformede samlinger, kaldet miceller. Man behøver ikke at sætte sig ind i de mere tekniske eller kemiske forhold for at lave ost selv, men for dem som gerne vil vide mere om hvad der grundlæggende sker ved forvandlingen af mælk til ost, så

Læs mere

Proteiner: en introduktion. Modul 1; F13 Rolf Andersen, 18/2-2013

Proteiner: en introduktion. Modul 1; F13 Rolf Andersen, 18/2-2013 Proteiner: en introduktion Modul 1; F13 Rolf Andersen, 18/2-2013 4 facts om proteiner Proteiner udgør én af de vigtigste stofgrupper i vores organisme; de varetager en lang række forskellige funktioner.

Læs mere

Folkeskolens afgangsprøve Maj 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B3

Folkeskolens afgangsprøve Maj 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B3 Folkeskolens afgangsprøve Maj 2012 B3 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B3 afgangsprøver maj 2012 Sæt 3 Levende organismers udvikling og livsytringer

Læs mere

Sundheds CVU Nordjylland INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00

Sundheds CVU Nordjylland INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00 INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00 ANATOMI OG FYSIOLOGI Opgave 1 Den menneskelige organisme er opbygget af celler. a. Beskriv cellens opbygning, heri skal

Læs mere

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer)

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer) Elevvejledning til det Virtuelle Kræftlaboratorium Det Virtuelle Kræftlaboratorium stiller krav til en grundig forståelse af det centrale dogme inden for molekylærbiologien, hvordan DNA oversættes til

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2011 Institution Teknisk Gymnasium Grenaa Uddannelse Fag og niveau Lærer(e) Hold HTX Biologi C Lennart

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Biologien bag epidemien

Biologien bag epidemien Biologien bag epidemien Af Niels Kristiansen, biologilærer, Grindsted Gymnasium Sygdomme kan smitte på mange måder. Enten via virus, bakterier eller parasitter. I det følgende vil vi koncentrere os om

Læs mere

Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Den basale genetik

Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Den basale genetik Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Intermediate alleler

Læs mere

Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport

Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport Afrapportering for projektet Molekylær analyse af nye stivelseskartofler Slutrapport Projektperiode april december 2012 Deltagere Andreas Blennow (projektleder), Susanne L. Jensen (PhD studerende), Lisbeth

Læs mere

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres.

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres. Epigenetik Men hvad er så epigenetik? Ordet epi er af græsk oprindelse og betyder egentlig ved siden af. Genetik handler om arvelighed, og hvordan vores gener videreføres fra generation til generation.

Læs mere

BioMaster affaldskværn 3.0. Din madlavning kan blive billigere, hvis du vælger biogas

BioMaster affaldskværn 3.0. Din madlavning kan blive billigere, hvis du vælger biogas BioMaster affaldskværn 3.0 BioMasteren er selve affaldskværnen, eller bio kværnen som den også kaldes, hvor madaffaldet fyldes i. Det er en både let og hygiejnisk måde at bortskaffe madaffald på set i

Læs mere

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et:

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: F2011-Opgave 1. En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: Forward primer: 5 CC ATG GGT ATG AAG CTT TGC AGC CTT

Læs mere

Folkeskolens afgangsprøve Maj 2013. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B2

Folkeskolens afgangsprøve Maj 2013. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B2 Folkeskolens afgangsprøve Maj 2013 B2 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B2 Indledning Foto: Keld Nørgaard Fødevareproduktion Det danske landbrug producerer

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2011 Institution Teknisk Gymnasium Grenaa Uddannelse Fag og niveau Lærer(e) Hold HTX Biologi C Lennart

Læs mere

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008 STUDENTEREKSAMEN AUGUST 2008 BIOLOGI A-NIVEAU Tirsdag den 19. august 2008 NY ORDNING Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX082-BIA Undervisningsministeriet

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2001 kl

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2001 kl STUDENTEREKSAMEN AUGUST 2001 2001-6-2 BIOLOGI HØJT NIVEAU Mandag den 13. august 2001 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares.

Læs mere

Fotosyntese og respiration

Fotosyntese og respiration Biologi Fotosyntese og respiration Kasper Angelo, Klasse 1.3, HTX Roskilde 16/12 2007 Formål Der uføres og analyseres nogle forsøg der kan besvare: Forbruger en grøn plante kuldioxid (CO 2), når den udsættes

Læs mere

Folkeskolens afgangsprøve December 2011. Biologi - Facitliste. Elevnavn: Elevnummer: Skole: Hold: 1/23 B4

Folkeskolens afgangsprøve December 2011. Biologi - Facitliste. Elevnavn: Elevnummer: Skole: Hold: 1/23 B4 Folkeskolens afgangsprøve December 2011 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/23 B4 Indledning Mennesket ændrer på dyr og planter Mennesket benytter i dag

Læs mere

HDAC-inhibitorer og en mulig 'blod- biomarkør' Kogebogen

HDAC-inhibitorer og en mulig 'blod- biomarkør' Kogebogen Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab HDAC-inhibitorer og en mulig 'blodbiomarkør' En forklaring af HDAC-inhibitorer, samt hvordan

Læs mere

Dansk Sportsdykker Forbund

Dansk Sportsdykker Forbund Dansk Sportsdykker Forbund Teknisk Udvalg Sid Dykketabellen Copyright Dansk Sportsdykker Forbund Indholdsfortegnelse: 1 FORORD... 2 2 INDLEDNING... 3 3 DEFINITION AF GRUNDBEGREBER... 4 4 FORUDSÆTNINGER...

Læs mere

Eksamensspørgsmål 3bbicfh1. Med udgangspunkt i vedlagt materiale og relevante øvelser ønskes at du:

Eksamensspørgsmål 3bbicfh1. Med udgangspunkt i vedlagt materiale og relevante øvelser ønskes at du: 1 Søens onde cirkler Eksamensspørgsmål 3bbicfh1 Gør rede for de vigtigste processer i et økosystem. Forklarer, hvordan en sø reagerer, hvis der tilføres organisk stof eller store mængder af næringssalte

Læs mere

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Exiqons cloud-løsning hjælper forskere med at analysere og forstå genomics og big data Hvad er genomics? Genomics er

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

Hvad i alverden er zinkfingre?

Hvad i alverden er zinkfingre? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab At give fingeren til Huntingtons Sygdom - to forskningsgrupper har succes med zinkfingerlægemidler

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Januar 2016 Institution VUC Hvidovre-Amager Uddannelse Fag og niveau Lærer(e) Hold Hfe Biologi C Stig Haas

Læs mere

HS er en hjernesygdom, ikke?

HS er en hjernesygdom, ikke? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ændringer i leveren hos patienter med Huntingtons Sygdom antyder, at mere forskning i 'hele kroppen'

Læs mere

1. Planter. 1. Gør rede for eukaryote cellers opbygning og for funktionen af de forskellige dele. Beskriv forskellene på dyre- og planteceller.

1. Planter. 1. Gør rede for eukaryote cellers opbygning og for funktionen af de forskellige dele. Beskriv forskellene på dyre- og planteceller. 1. Planter 1. Gør rede for eukaryote cellers opbygning og for funktionen af de forskellige dele. Beskriv forskellene på dyre- og planteceller. 2. Beskriver plantecellens vigtige processer som fotosyntese

Læs mere

2. Spildevand og rensningsanlæg

2. Spildevand og rensningsanlæg 2. Spildevand og rensningsanlæg 36 1. Fakta om rensningsanlæg 2. Spildevand i Danmark 3. Opbygning rensningsanlæg 4. Styring, regulering og overvågning (SRO) 5. Fire cases 6. Øvelse A: Analyse af slam

Læs mere

Bioteknologi. Niveau: 9. klasse. Varighed: 7 lektioner

Bioteknologi. Niveau: 9. klasse. Varighed: 7 lektioner Bioteknologi Niveau: 9. klasse Varighed: 7 lektioner Præsentation: At undervise i bioteknologi handler først og fremmest om at åbne øjne. I forløbet kommer vi omkring forskellige teknikker, som fx gensplejsning

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 9. august 2004 kl

BIOLOGI HØJT NIVEAU. Mandag den 9. august 2004 kl STUDENTEREKSAMEN AUGUST 2004 2004-6-2 BIOLOGI HØJT NIVEAU Mandag den 9. august 2004 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares.

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Termin Institution Uddannelse Fag og niveau Lærer(e) Hold Termin hvori undervisningen afsluttes Maj-juni 2010 Teknisk Gymnasium Grenaa HTX-student Biologi C Ejner Læsøe Madsen

Læs mere

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm)

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm) Opgave 1 Leveren spiller en central rolle i lipid metabolismen og i opretholdelse af lipid homeostasen i hele kroppen. Lipidmetabolismen er fejlreguleret hos blandt andet svært overvægtige personer samt

Læs mere

På jagt efter enzymer på Nordpolen 24. august 2009 kl. 14:19

På jagt efter enzymer på Nordpolen 24. august 2009 kl. 14:19 På jagt efter enzymer på Nordpolen 24. august 2009 kl. 14:19 I bakterier og mikrobers gener findes enzymer, der kan gøre verden grønnere. Nikolaj Blom, der til daglig forsker for Novozymes, er på opdagelse

Læs mere

Gymnasium. Osteproduktion. Viden

Gymnasium. Osteproduktion. Viden Osteproduktion Faglige begreber og ordforklaringer Anaerob:... 3 Aroma:... 3 Centrifuge:... 3 Colibakterier:... 3 Disakkarider:... 3 Enzym:... 3 Fermentering:... 4 Gensplejsning:... 4 Homogenisering:...

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste Folkeskolens afgangsprøve Maj 2007 1/23 B3 Indledning Livsbetingelser og global opvarmning Klimaet på Jorden er under forandring. De mange menneskelige aktiviteter påvirker efterhånden temperaturen i et

Læs mere

Eksamensspørgsmål til biocu til mandag d. 10. juni 2013

Eksamensspørgsmål til biocu til mandag d. 10. juni 2013 Eksamensspørgsmål til biocu til mandag d. 10. juni 2013 Nr. 1. Fra gen til protein. Hvordan er sammenhængen mellem DNA ets nukleotider og proteinets aminosyrer? Beskriv hvad der sker ved henholdsvis transskription

Læs mere

Februar 2014. Duolac Derma+ Plus. 10,0 mia./ stick

Februar 2014. Duolac Derma+ Plus. 10,0 mia./ stick DUOLAC PRODUKTOVERSIGT Daglige behov Daglig+ Vitalitet Daglig+ Børn Rejse+ 2i1 Specielle behov Normal+ Immunforsvar Derma+ Plus Streptococcus thermophilus Lactobacillus plantarum Lactobacillus acidophilus

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Huntington's chorea og cilier

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Huntington's chorea og cilier Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Huntington's chorea og cilier Huntington's chorea og cilier: huntingtinprotein påvirker små,

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2007 kl

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2007 kl TUDENTEREKAMEN AUGUT 2007 2007-6-2 BILGI ØJT NIVEAU Mandag den 13. august 2007 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares. TRE

Læs mere

Teknisk Gymnasium Silkeborg - Arla Produktion af mejeriprodukter. Smil(e) Workshop d. 17.april i NVH

Teknisk Gymnasium Silkeborg - Arla Produktion af mejeriprodukter. Smil(e) Workshop d. 17.april i NVH Teknisk Gymnasium Silkeborg - Arla Produktion af mejeriprodukter Smil(e) Workshop d. 17.april i NVH Disposition Overordnet præsentation af projektets dele Præsentation af PLS-forløb og besøg på Arla, Rødkærsbro

Læs mere

1. Hvad er kræft, og hvorfor opstår sygdommen?

1. Hvad er kræft, og hvorfor opstår sygdommen? 1. Hvad er kræft, og hvorfor opstår sygdommen? Dette kapitel fortæller om, cellen, kroppens byggesten hvad der sker i cellen, når kræft opstår? årsager til kræft Alle levende organismer består af celler.

Læs mere

Undervisningsbeskrivelse for: 1bic14e 0813 Biologi C, HFE

Undervisningsbeskrivelse for: 1bic14e 0813 Biologi C, HFE Undervisningsbeskrivelse for: 1bic14e 0813 Biologi C, HFE Fag: Biologi C, HFE Niveau: C Institution: VUC Fredericia (607247) Hold: Biologi C enkeltfag Alle Termin: Juni 2014 Uddannelse: HF-enkeltfag Lærer(e):

Læs mere

Elegante modeller til vigtige spørgsmål

Elegante modeller til vigtige spørgsmål Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Ny forskningsmetode indikerer, at et antioxidant gen beskytter sårbare neuroner Forskere bruger

Læs mere

Formål for biologi. Tankegange og arbejdsmetoder

Formål for biologi. Tankegange og arbejdsmetoder Formål for biologi. I natur/biologi skal eleverne tilegne sig viden om det levende liv og dets omgivelser. De skal kende til miljøet og dets betydning for levende organismer. Undervisningen skal søge at

Læs mere

Spørgsmål til fordøjelse og stofskifte

Spørgsmål til fordøjelse og stofskifte Spørgsmål til fordøjelse og stofskifte 1. Hvad er dentes decidui og dentes permanentes og hvor mange har vi af hver? 2. Beskriv smagsløgenes placering og funktion. Hvilken anden sans spiller en vigtig

Læs mere

BIOTEKNOLOGI HØJT NIVEAU

BIOTEKNOLOGI HØJT NIVEAU STUDENTEREKSAMEN 2007 2007-BT-1 BITEKNLGI HØJT NIVEAU Torsdag den 31. maj 2007 kl. 9.00 14.00 Sættet består af 1 stor og 2 små opgaver samt 1 bilag i 2 eksemplarer. Det ene eksemplar af bilaget afleveres

Læs mere

Elevvejledning pglo transformation

Elevvejledning pglo transformation Introduktion til transformation Elevvejledning pglo transformation I denne øvelse skal du lære fremgangsmåden ved genetisk transformation. Husk på, at et gen er et stykke DNA, der indeholder informationer

Læs mere

Folkeskolens afgangsprøve Maj 2006 Biologi - Facitliste

Folkeskolens afgangsprøve Maj 2006 Biologi - Facitliste Folkeskolens afgangsprøve Maj 2006 1/25 B3 Indledning Vores kost De fleste af vores fødevarer kommer fra landbruget. Nogle landmænd har kun planteproduktion, mens andre også producerer grise, æg eller

Læs mere

At eleverne tilegner sig viden om de levende organismer og den omgivende natur, om miljø og sundhed samt om anvendelse af biologi.

At eleverne tilegner sig viden om de levende organismer og den omgivende natur, om miljø og sundhed samt om anvendelse af biologi. Fagplan for biologi Formål: Formålet med undervisningen i biologi er: At eleverne tilegner sig viden om de levende organismer og den omgivende natur, om miljø og sundhed samt om anvendelse af biologi.

Læs mere

Huntingtinproteinet: lad os komme til sagens kerne

Huntingtinproteinet: lad os komme til sagens kerne Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab På fisketur: nye lægemiddelmål for Huntingtons Sygdom identificeret ved screening af proteinnetværk

Læs mere

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste Folkeskolens afgangsprøve Maj 2007 1/23 B4 Indledning Ozon, temperaturstigning og levende organismer Mennesker og andre levende organismer er meget afhængige af de vilkår, som hersker på Jorden. I de seneste

Læs mere

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares.

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. Bioteknologi A Studentereksamen Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. frs111-btk/a-31052011 Tirsdag den 31. maj 2011 kl. 9.00-14.00

Læs mere

Lærervejledning Til internet-spillet Kræftkampen og undervisningshæftet Hvorfor opstår kræft? Biologi 8.-9. klasse

Lærervejledning Til internet-spillet Kræftkampen og undervisningshæftet Hvorfor opstår kræft? Biologi 8.-9. klasse kraeftkampen.dk Kræftens Bekæmpelse Lærervejledning Til internet-spillet Kræftkampen og undervisningshæftet Hvorfor opstår kræft? Biologi 8.-9. klasse Hvorfor arbejde med Kræft? Erhvervsskolernes Forlag

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Vintereksamen 2014 Institution Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold hfe Biologi C Marie Gottschalk

Læs mere

Projektbeskrivelse. Projektanalyse. PLS (Projektbeskrivelse Yoghurt) Edmond Ziari og Ali Hamzaei

Projektbeskrivelse. Projektanalyse. PLS (Projektbeskrivelse Yoghurt) Edmond Ziari og Ali Hamzaei Projektbeskrivelse Projektanalyse Man har fremstillet yoghurt i over 4500 år, og man ved at tyrkerne brugte yoghurt som lægemiddel mod smerter og lidelser, som råddannelse i tyktarmen, allerede tilbage

Læs mere

Biologiolympiaden 2010-2011. Torsdag 18. november 2010 Varighed: 90 minutter.

Biologiolympiaden 2010-2011. Torsdag 18. november 2010 Varighed: 90 minutter. Biologiolympiaden 2010-2011 Torsdag 18. november 2010 Varighed: 90 minutter. Opgave 1-21 besvares på svararket; Opgaverne 22-24 besvares direkte i opgaven! Hjælpemidler: Kun lommeregner og lineal Husk

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Sommereksamen 2015 Institution 414 Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold HFe Biologi B Torben

Læs mere

ANATOMI for tandlægestuderende. Henrik Løvschall Anatomisk afsnit Afd. for Tandsygdomslære Odontologisk Institut Århus Universitet

ANATOMI for tandlægestuderende. Henrik Løvschall Anatomisk afsnit Afd. for Tandsygdomslære Odontologisk Institut Århus Universitet ANATOMI for tandlægestuderende Henrik Løvschall Anatomisk afsnit Afd. for Tandsygdomslære Odontologisk Institut Århus Universitet CELLEBIOLOGI celleform kubisk celle pladeformet celle prismatisk celle

Læs mere

BIOLOGI B-NIVEAU - SPØRGSMÅL 1

BIOLOGI B-NIVEAU - SPØRGSMÅL 1 BIOLOGI B-NIVEAU - SPØRGSMÅL 1 Kvælstof, fosfor og vandmiljøplaner Gør kort rede for kvælstof og fosfors kredsløb i naturen - og kom ind på følgerne ved udledning af næringssalte til vandmiljøet. Med udgangspunkt

Læs mere