GAPDH PCR modul Manual

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "GAPDH PCR modul Manual"

Transkript

1 GAPDH PCR modul Manual Katalog nr EDU explorer.bio-rad.com Kopiering kun tilladt til undervisningsbrug Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende dele til opbevaring ved den anbefalede temperatur. Oversat og bearbejdet af Birgit Sandermann Justesen Nærum Gymnasium, februar /12

2 Indledning PCR er i dag en meget benyttet teknologi i forskning, i retsgenetiske analyser og i laboratorier. Blandt de mange anvendelsesmuligheder af PCR er også muligheden for at bruge PCR til at klone gener også i tilfælde, hvor man ikke kender genomet. Ved at designe primerne ud fra kendte beslægtede organismers DNA er det muligt at få amplificeret de gener, man ønsker. Metoden, der kaldes nested DNA, er en totrinsproces. I den første PCR-runde amplificeres de gener, der har sekvenser, der ligner det gen, der skal undersøges. I den anden runde PCR amplificeres mere specifikt de gener, der har interesse efter første runde. Overblik Teori: DNA, DNAreplikation, PCR, primerdesign, de generede primere, nedsted PCR For-forsøg: ekstration af genomdna fra forskelligt plantemateriale (Nukleinsyreekstraktion) Del 1: Klargøre til første PCR, PCR, elektroforese og analyse af resultaterne Del 2: Behandling af DNA med exonuclease, klargøre til PCR, PCR, elektroforese og analyse af resultaterne Afslutning: Opsamling og endelig tolkning af resultaterne Elevforudsætninger Kittet kræver et større overblik og er derfor designet til elever, der har enten molekylær biologi eller bioteknologi på A-niveau. Det forudsættes, at eleverne allerede har kendskab til og prøvet PCR-teknikken. Tjekliste I kittet Mængde Initial GAPDH PCR-primer 50µL 1 Nested GAPDHPCR-primers 50µL 1 PCR master mix 1,2mL 3 Plasmid control DNA 1 ml 1 Control Arabidopsis genomdna 1 Exonuclease I, 50µL 1 Molekylær vægt-lineal 1 Sterilt vand 2,5mL 1 PCR-rør 0,2mL 150 Adaptorer til PCR-rør 1,5ml 150 Farvede mikrocentrifugerør 120 Skumholdere til mikrocentrifugerørene 12 Nødvendigt udstyr Mikropipette 2-20µL 1 pr. gruppe Mikropipette µL 1 pr. gruppe Pipettespidser med aerosolbarriere til ovennævnte pipetter PCR-maskine Elektroforeseudstyr Udstyr det er rart at have Nyt ekstraheret plante DNA (fra kittet Nukleinsyreekstraktion ) 2/12

3 Ultracentrifuge Vortexer Enten ethidium-agarose elektroforeseudstyr eller fast-blast-agarose elektroforeseudstyr Teori xxx Lærerens forberedelse Teoretiske noter I dette forsøg skal eleverne lave to runder med PCR. For at amplificere en del af GAPC-genet fra genom DNA. Genom-DNA kan skaffes på 3 måder 1) GenomDNA udvundet ved ekstraktion af plantemateriale eller2) fra et forskningslaboratorium eller 3) ved at bruge det i kittet medfølgende Arabidopsis genom DNA. I den første PCR benyttes degenererede primere for at amplificere en større del af DNA stykkerne. I modsætning til normale primere, der er syntetiserede med en nucleotid på hver position har degenererede primere en eller flere positioner, hvor der er syntetiseret forskellige nukleotider. Start (initial) primeren ser sådan ud: GABTATGTTGTTGARTCTTCWGG Degenereringen ses i position 3, 15 og 21 Position IUB kode Baser 3 B G/T/C 15 R(purin) G/A 21 W(Weak) A/T Den reverse primer er dannet på samme måde. I anden PCR-runde i nested PCR benyttes mere specifikke primere til at amplificere et specifikt GAPCgen fra genom-poolen. Disse primere er ikke degenererede, men findes inde i sekvensen fra de første primere. Se fx: Initial primer Nested primer GABTATGTTGTTGARTCTTCWGG CTACTGGTGTCTTCACTGACAA Primerne binder ikke lige godt til alle plantearter, hvorfor der vil være forskellig PCR-effektivitet hos de forskellige arter. Det kan sagtens ske, at eleverne allerede efter første PCR-runde får fragmenter, der er gode nok til at klone. Det vil sige at der er nok DNA (der kan ses bånd på en gel), kvaliteten er god nok (der er et eller flere bånd) og fragmenterne har den forventede størrelse. Men for at være på den sikre side anbefales det på det kraftigste, at man gennemfører begge PCR-runder. Det kan dog stadig ske, at nogle elever selv efter to PCR-runder ikke har fået nok DNA. Hvis eleverne benytter det DNA, de selv har ekstraheret fra plantemateriale anbefales det, at de som kontrol benytter de Arabidopsis genom-dna, der følger med kittet. Derudover følger der med kittet plasmid DNA, der koder for target(mål)delen af GAPDHgenet fra Arabidopsis og hvis dette benyttes som skabelon i begge PCRrunder er man sikker på, at PCR en virker. Ved at lave disse forskellige kontrolforanstaltninger lærer eleverne noget om kontrollers betydning, men samtidig 3/12

4 kan kontrolreaktionen fungere som en slags klonbar PCRprodukt, hvis deres egne prøver ikke virker. Endelig anbefales det at man også arbejder med en negativ kontrol. Lærerens forberedelse 1. Fortynd 5x genom Arabidopsis DNA (25ng/µL) med sterilt vand til 5ng/µL. Det gøres ved at tage 20 µl DNA og blande med 80µL vand. Blandes godt. Hver gruppe har brug for 6µL. 2. Læreren kan evt. blande mastermixen med primere. Elevvejledningen lægger dog op til, at eleverne ud fra beregninger af molaritet selv blander deres mastermix med primere. Tidligst 30 minutter før forsøget blandes mastermixen. Hver gruppe skal bruge 120µL 2x mastermix med primere til 5 PCR reaktioner. Tilsæt 30µL specifikke primere (blå i første runde, gul nested primere i anden runde) til 1500µL BioRad2x mastermix bland godt 3. Før anden PCR-runde placeres exonuclease I på is 4. Fremstil 500bp molekylær vægtlinealen: Tilsæt 100µL 5x orange G Loading Dye til den medfølgende 500bp molekyl-vægt-lineal 5. Læreren eller elever gør klar til at lave elektroforese. Der støbes 1% agarosegel i TAE-buffer. Hver gruppe har brug for to geler. 6. Programmer PCR-maskinen Første PCR-runde initial GAPDHPCR: Start denaturering 95 o C i 5 minutter Derefter 40 cykler: Denaturering 95 o C i 1 minut Annealing 52 o C i 1 minut Extension 72 o C i 2 minutter Afslutnings extension 72 o C i 6 minutter Slut 15 o C uendeligt Anden PCRrunde nested GAPDHPCR: Start denaturering 95 o C i 5 minutter Derefter 40 cykler: Denaturering 95 o C i 1 minut Annealing 46 o C i 1 minut Extension 72 o C i 2 minutter Afslutnings extension 72 o C i 6 minutter Slut 15 o C uendeligt 4/12

5 Elevvejledning Det gen, der skal analyseres skal studeres i dette forsøg koder for GAPDH dvs. glycerolaldehydfosfatdehydrogenase, - et af glykolysens enzymer. GAPDH er et meget vigtigt enzym i glykolysen (Læs selv om glykolysen i din biokemibog) og det udtrykkes konstant og samtidig er det livsvigtigt for cellens overlevelse. Eftersom der er rigeligt med GAPDH i cellerne og det er muligt at oprense enzymet ved man også meget om enzymet proteinstruktur og dets funktion. GAPDH består af 4 underenheder der holdes sammen af ikke-kovalente bindindinger. I nogle tilfælde er alle fire underenheder ens, i andre tilfælde er der små forskelle. Hver underenhed har et aktivt område, hvor der kan bindes en NAD + co-faktor. Selvom der er GAPDH i alle organismer er det ikke ensbetydende med, at organismernes genetiske kode for GAPDH er ens, idet mængde og størrelsen af fx introns kan variere. I første PCR runde bruges der en primer, der stammer fra nærtbeslægtede organismer, som Arabidopsis (også en plante) og denne primer vil nok virke, men ikke optimalt. Men der amplificeres dog en del Dna og i anden PCRrunde kan man være mere specifik med hensyn til at fange det DNA, der koder for GAPDH. Materialer pr. gruppe: BioRad 2x master-mix 120 µl Blå initial primer 4 µl gdna fra planter (tidligere forsøg) 2 1x Arabidopsis gdna (fortyndet til 5ng/µL) 6 µl Kontrol pgap plasmid DNA 6 µl 2-20 µl mikropipette spidser til mikropipetten PCR-rør 5 PCR-adaptorer 5 Mikrocentrifugerør 1 Holder til rørene Tusch isbad Første PCR-runde (Initial PCR) Bemærkning: Såfremt læreren fremstiller mastermixen springes punkt 3 over. 1. Gruppen starter med planlægningen af første PCR-runde. I startrunden skal der laves PCR på Arabidopsis gdna (gdna=genomdna), på pgap plasmid DNA (positiv kontrol), på mindst én plantes gdna samt på en negativ kontrol, som består af sterilt vand i stedet for DNA. Tegn en tabel så I har styr på, hvad der står på de pågældende rør, hvilken skabelon, der er benyttet og hvilke primere, der har været brugt. Mærke på PCR-røret Skabelon Primere 5/12

6 2. Tidligst 30 minutter før PCR-reaktionen skal starte, fremstiller I jeres mastermix. Mastermix er er en blanding bestående af alle de reagenser, der er nødvendige for PCR nemlig Taq polymerase, dntp, buffer og salt. Mastermixen er dog først klar til brug, når der også er tilsat primere. I kittet er der en 2x mastermix (klar væske). Denne vil, når den blandes i PCRrørene med en tilsvarende mængde DNA-skabelon (jeres prøver, der skal køres PCR på) opnå den rette koncentration; 1x. Vi skal nu beregne, hvor meget mastermix, der skal bruges: Hver PCR-prøve kræver 40µL. Dvs. hver prøve skal bruge 20µL 2xMMIP (dvs 2x mastermix initial primere) plus 20µL DNA-skabelon. Hvis I således regner med at køre 5 prøver skal I i alt bruge 5 x 20µL 2xMMIP. Dertil skal I nu beregne, hvor megen initial-primer, der skal tilsættes: Primeren leveres i en koncentration på 100µM og den er blå. Til selve PCR en kræves kun en koncentration på 2µM. Beregn nu hvor meget initial-primer, der skal tilsættes 2xMMIP: Formel: M 1 x V 1 /M 2 =V 2 Vi har altså: Mængde initial-primer i µl= (koncentration af primer i µm)x(volumen af 2xMMIP i µl) (given primer-koncentration i µm) Tidligst 30 minutter før starten på PCR tilsætter I den beregnede mængde initial-primer til den afmålte mængde 2xMMIP (mastermix) i et skruelågsmikrocentrifugerør. Bland grundigt ved at knipse på røret eller brug en vortexer. Den færdige blanding er blå Stil det på is! Note: Initial-primerne sætter sig fast udenfor selve target-området. (Se mere i jeres teoribøger om dette) 3. Mærk 5 PCR-rør med jeres initialer og følgende numre: 1 Negativ kontrol (sterilt vand) 2 Arabidopsis gdna 3 Positiv kontrol pgap plasmid 4 Plante 1 gdna 5 Plante 2 gdna 4. Stil rørene i en PCR-adaptor, luk hvert rør og stil PCR-adaptorerne med PCR-rørene på is. 6/12

7 5. Tag den færdigblandede blå mastermix og knips på røret og giv det evt. en kort centrifugering for at få indholdet ned i bunden 6. Tilsæt 20µL færdigblandet blå mastermix til hvert af de 5 mærkede rør Blå mastermix 7. Skift pipettespids og tilsæt 15µL sterilt vand til hvert rør sterilt vand 8. Tilsæt 5µL negativ kontrol til det første rør. Sug forsigtigt op og ned med pipetten for at blande godt. Skift spids og tilsæt 5µL Arabidopsis gdna til rør nr. 2 bland Skift spids og tilsæt 5µL positiv kontrol til rør 3 bland Skift spids og tilsæt 5µL plante 1 gdna til rør 4 - bland Skift spids og tilsæt 5µL plante 2 gdna til rør 5 bland DNA-prøver 9. Når alle grupper er klar stilles rørene i PCR-maskinen 10. Start PCRreaktionen: Første PCR-runde initial GAPDHPCR: Start denaturering 95 o C i 5 minutter Derefter 40 cykler: Denaturering 95 o C i 1 minut Annealing 52 o C i 1 minut Ekstension 72 o C i 2 minutter Afslutnings-ekstension 72 o C i 6 minutter Slut 15 o C uendeligt 7/12

8 Hvis der er overskydende gdna stilles det straks i fryseren 11. Gør klar til elektroforese. Støb en 1% agarosegel i TAE-buffer 12. Tag prøverne ud af PCR-maskinen 13. Mærk 5 mikrocentrifugerør som før og tilsæt 5µL 5x Orange Loading Dye til hvert rør. 14. Afpipetter 20µL fra hvert af de respektive rør til de nye rør. Sug op og ned med pipetten for at blande. Vigtigt! De resterende 20µL i PCR-rørene skal bruges til anden PCR-runde! 15. Sæt 10µL 500bp molekyl-vægt-lineal i første brønd og derefter 20µL af hver prøve i de næste brønde. Noter rækkefølgen. Kør elektroforesen Bemærk: Båndene i molekyl-vægt-linealen er: 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500 og 5000bp 16. Studer resultatet og noter det. Bemærk: pgap-plasmidkontrollen skulle gerne vise et bånd ved ca 1kb. For plante gdna er det relativt normalt, at der ses flere bånd eller modsat kun yderst svage bånd. Der kan dog sagtens stadig være gode muligheder for amplificering i anden PCR-runde. 17. Den del af prøverne, der skal arbejdes videre med, stilles i køleskabet! 8/12

9 Anden PCR-runde (Nested PCR) 1. I skal nu planlægge jeres nested-pcr eksperiment. Der vil blive udført nested- PCR på de prøver, der indeholdt gdna (gdna=genomdna). Derudover laves der såvel en positiv kontrol som en negativ kontrol. Som i første del laver I en oversigtstabel over indholdet i de forskellige rør: Mærke på PCRrøret skabelon Fortyndingsfaktor Primere 2. Tidligst 30 minutter før PCR-reaktionen skal starte, fremstiller I jeres mastermix. Mastermix er er en blanding bestående af alle de reagenser, der er nødvendige for PCR nemlig Taq polymerase, dntp, buffer og salt. Mastermixen er dog først klar til brug, når der også er tilsat primere. I kittet er der en 2x mastermix (klar væske). Denne vil, når den blandes i PCRrørene med en tilsvarende mængde DNA-skabelon (jeres prøver, der skal køres PCR på) opnå den rette koncentration; 1x. Vi skal nu beregne, hvor meget mastermix, der skal bruges: Hver PCR-prøve kræver 40µL. Dvs. hver prøve skal bruge 20µL 2xMMNP (dvs 2x mastermix nested primere) plus 20µL DNA-skabelon. Hvis I således regner med at køre 5 prøver skal I i alt bruge 5 x 20µL 2xMMNP. Dertil skal I nu beregne, hvor megen nested-primer, der skal tilsættes: Primeren leveres i en koncentration på 25µM og den er gul. Til selve PCR en kræves kun en koncentration på 0,5µM. Beregn nu hvor meget nested-primer, der skal tilsættes 2xMMNP: Formel: M 1 x V 1 /M 2 =V 2 Vi har altså: Mængde nested-primer i µl= (koncentration af primer i µm)x(volumen af 2xMMNP i µl) (given primer-koncentration i µm) Tidligst 30 minutter før starten på PCR tilsætter I den beregnede mængde gul nested-primer til den afmålte mængde 2xMMNP (mastermix) i et skruelågsmikrocentrifugerør. Bland grundigt ved at knipse på røret eller brug en vortexer. Den færdige blanding er gul Stil det på is! Note: nested-primerne arbejder på selve target-området. (Se mere i jeres teoribøger om dette) 9/12

10 3. Først skal ikke-inkorporerede primere fra første runde fjernes ved hjælp af exonuclease I. Brug en ny pipettespids hver gang når I pipetterer 1µL exonuclease I til hvert Første-runde-PCR-rør, der indeholder gdna (dvs. rør 2, 4 og 5). Bland godt. 4. Inkuber i 15 minutter ved 37 o C 5. Inaktiver enzymet ved derefter at inkubere i 15 minutter ved 80 o C. Hvorfor er det nødvendigt at inaktivere exonucleasen? 6. Mærk et mikrocentrifugerør til hvert af de exonuclasebehandlede første-runde-pcr-rør. exo Arabidopsis gdna exo plante 1 gdna exo plante 2 gdna 37 o C vandbad 80 o C vandbad 7. PCR en fra første runde skal nu fortyndes. Tilsæt 98µL sterilt vand til hvert af mikrocentrifugerørene sterilt vand 8. Skift pipettespids og tilsæt 2µL af de respektive exonucleasebehandlede PCR-prøver til de tilsvarende mærkede mikrocentrifugerør. Luk låget exonucleasebehandlede PCR-prøver 10/12

11 9. Knips på røret eller brug en vortexer. Centrifuger efterfølgende kort for at få alt ned i bunden af røret. 10. Mærk 5 nye PCR-rør ift. jeres skema og stil disse i PCR-adaptorer og derefter på is. IS x Tilsæt 20µL gul MMNP til hvert PCR-rør 12. Idet I følger jeres skema, tilsætter I 20µL skabelon til hvert af de respektive prøver (fortyndet første-runde-pcr, Arabidopsis gdna, pgapplasmid DNA og sterilt vand) til de tilsvarende PCR-rør gul MMNP 13. Stil PCR-rørene i PCR-maskinen. Kør programmet Anden PCRrunde nested GAPDHPCR: Start denaturering 95 o C i 5 minutter Derefter 40 cykler: Denaturering 95 o C i 1 minut Annealing 46 o C i 1 minut Ekstension 72 o C i 2 minutter Afslutnings ekstension 72 o C i 6 minutter Slut 15 o C uendeligt 14. Tag prøverne ud af termalcykleren/pcr-maskinen prøver 15. Tilsæt 5µL 5x loading dye til 5 nye PCR-rør og afpipetter 20µL fra hvert af de respektive rør til de nye rør. Sug op og ned med pipetten for at blande. Vigtigt! De resterende 20µL i PCR-rørene skal bruges til ligering og transformation og fryses derfor. 11/12

12 16. Sæt 10µL 500bp molekyl-vægt-lineal i første brønd og derefter 20µL af hver prøve i de næste brønde. Noter rækkefølgen. Kør elektroforesen. Bemærk: Båndene i molekyl-vægt-linealen er: 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500 og 5000bp 17. Tolk resultatet. De fragmenter af GAPC der er blevet amplificeret varierer i størrelse fra art til art. Den forventede størrelse er 0,5-2,5 kb. Der ses af og til dubletter dvs to DNA fragmenter på samme størrelse hos nogle plantearter. Dette skyldes sandsynligvis, at to homologe GAPC-gener er blevet amplificeret. 12/12

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Oprensning af genomisk DNA fra plantemateriale Manual Katalog nr. 166-5005EDU explorer.bio-rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, februar 2009

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Navn: Forsøgsvejledning Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA sekvens,

Læs mere

KRIMINALDETEKTIVEN GERNINGSSTEDETS GÅDE PCR

KRIMINALDETEKTIVEN GERNINGSSTEDETS GÅDE PCR KRIMINALDETEKTIVEN GERNINGSSTEDETS GÅDE Elevvejledning PCR PCR trin for trin PCR involverer en række gentagne cykler, der hver består af følgende tre trin: Denaturering, primer påsætning og forlængelse

Læs mere

Gerningsstedets gåde Den usynlige sandhed - DNA PCR Basics Kit. Katalog nr. 166-2600EDU

Gerningsstedets gåde Den usynlige sandhed - DNA PCR Basics Kit. Katalog nr. 166-2600EDU 1 Gerningsstedets gåde Den usynlige sandhed - DNA PCR Basics Kit Katalog nr. 166-2600EDU Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks pakken og læg de dele, der er mærket med -20

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Genes in a Bottle Kit DNA Extraction Module Lav et halssmykke med dit eget DNA Katalognr.: 166-2000EDU Dertil kan man købe ekstradele, hvis der skal laves halskæder til eleverne.

Læs mere

Test dit eget DNA med PCR

Test dit eget DNA med PCR Test dit eget DNA med PCR Forsøgsvejledning Navn: Side 1 af 7 Formål med forsøget Formålet med dette forsøg er at undersøge jeres arvemateriale (DNA) for et transposon kaldet Alu. Et transposon er en DNA

Læs mere

Ligerings- og transformationsmodul inklusiv plasmidoprensning og restriktionsanalyse

Ligerings- og transformationsmodul inklusiv plasmidoprensning og restriktionsanalyse Biotechnology Explorer Ligerings- og transformationsmodul inklusiv plasmidoprensning og restriktionsanalyse Katalog nr. 166-5015EDU explorer.bio-rad.com Kopiering kun tilladt til undervisningsbrug Bemærk:

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

Biotechnology Explorer GMO analyse Kit

Biotechnology Explorer GMO analyse Kit 1 Biotechnology Explorer GMO analyse Kit Katalog nr.166-2500edu www.biorad.com Oversat og bearbejdet af Birgit Sandermann Justesen december 2005 - revideret februar 2010 Bemærk: Kittet indeholder temperaturfølsomme

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

Protokol for genetisk bestemmelse af ABO blodtyper

Protokol for genetisk bestemmelse af ABO blodtyper Page1 Udarbejdet i samarbejde mellem: Kåre Lehmann, Annabeth Høgh Petersen, Anne Rusborg Nygaard og Jørn M. Clausen Page2 VIGTIGT: SKIFT PIPETTE SPIDSER/TIPS EFTER HVER GANG!! Så undgår du at forurene

Læs mere

PCR (Polymerase Chain Reaction): Opkopiering af DNA

PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR til at opkopiere bestemte DNA-sekvenser i en prøve er nu en af genteknologiens absolut vigtigste værktøjer. Peter Rugbjerg, Biotech Academy PCR (Polymerase

Læs mere

Biotechnology Explorer. Kromosom 16 PV92 PCR Kit

Biotechnology Explorer. Kromosom 16 PV92 PCR Kit 1 Biotechnology Explorer Kromosom 16 PV92 PCR Kit Katalog nr.166-2500edu explorer.bio-rad.com Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende dele til opbevaring

Læs mere

ELISA Immuno Explorer TM Kit

ELISA Immuno Explorer TM Kit - 1 - ELISA Immuno Explorer TM Kit Katalog nummer 166-2400EDU Til læreren Dette kit er lavet for at lette og illustrere immunologiundervisningen og kan give en øget forståelse af antigen-antistof interaktionen,

Læs mere

Biotechnology Explorer ELISA Immuno Explorer Kit. Instruktionsmanual

Biotechnology Explorer ELISA Immuno Explorer Kit. Instruktionsmanual Biotechnology Explorer ELISA Immuno Explorer Kit Instruktionsmanual Katalognummer 166-2400EDU explorer.bio-rad.com Delene i dette kit er sendt i separate æsker. Opbevar posen med reagenser i køleskab indefor

Læs mere

Elevvejledning pglo transformation

Elevvejledning pglo transformation Introduktion til transformation Elevvejledning pglo transformation I denne øvelse skal du lære fremgangsmåden ved genetisk transformation. Husk på, at et gen er et stykke DNA, der indeholder informationer

Læs mere

Dette er en kladde til et genoptryk af Eksperimentel Genteknologi fra 1991. Ideer, rettelser og forslag modtages gerne. Kh Claudia.

Dette er en kladde til et genoptryk af Eksperimentel Genteknologi fra 1991. Ideer, rettelser og forslag modtages gerne. Kh Claudia. Transformation af E.coli K 12 Version 3. marts 2009 (C) Claudia Girnth-Diamba og Bjørn Fahnøe Dette er en kladde til et genoptryk af Eksperimentel Genteknologi fra 1991. Ideer, rettelser og forslag modtages

Læs mere

Analyse af proteiner Øvelsesvejledning

Analyse af proteiner Øvelsesvejledning Center for Undervisningsmidler, afdeling København Analyse af proteiner Øvelsesvejledning Formål At separere og analysere proteiner i almindelige fødevarer ved brug af gelelektroforese. Teori Alle dele

Læs mere

Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid)

Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid) Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid) (Denne del tager ca. 3 timer, max 14 prøver) ELEVVEJLEDNING forsøgskasse nr. 1 AAU Oprensning af DNA-prøven foregår gennem fem trin, se figur 1:

Læs mere

Biotechnology Explorer. Protein Fingerprinting

Biotechnology Explorer. Protein Fingerprinting Biotechnology Explorer Protein Fingerprinting Instruktionsmanual Katalognummer 166-0100EDU explorer.bio-rad.com Delene i dette kit er sendt i seperate æsker. Opbevar proteinstandarderne i fryseren, ved

Læs mere

DNA origami øvelse 2013. DNA origami øvelse

DNA origami øvelse 2013. DNA origami øvelse DNA origami øvelse Introduktion I denne øvelse bruger vi DNA origami teknikken til at samle en tavle af DNA med dimensioner på 70 nm x 100 nm. Tavlen dannes af et langt enkeltstrenget DNA molekyle, der

Læs mere

Proteinelektroforese af GFP Suppleringskit til pglo

Proteinelektroforese af GFP Suppleringskit til pglo Proteinelektroforese af GFP Suppleringskit til pglo Katalognummer nr. 166 0013EDU www.bio rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium, Nærum Hovedgade 30, 2850 Nærum Birgitjustesen@gmail.com

Læs mere

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et:

En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: F2011-Opgave 1. En forsker har lavet et cdna insert vha PCR og har anvendt det følgende primer sæt, som producerer hele den åbne læseramme af cdna et: Forward primer: 5 CC ATG GGT ATG AAG CTT TGC AGC CTT

Læs mere

pglo-transformationskit

pglo-transformationskit 1 Katalog nummer 166-0003-EDU www.bio-rad.com pglo-transformationskit arac ori pglo bla GFP Oversat og bearbejdet af Birgit Sandermann Justesen og Lars Moeslund, 2007 Revideret november 2009. Kontakt:

Læs mere

Protokol for genetisk bestemmelse af ABO blodtyper

Protokol for genetisk bestemmelse af ABO blodtyper Page1 Udarbejdet i samarbejde mellem: Kåre Lehmann, Annabeth Høgh Petersen, Anne Rusborg Nygaard og Jørn M. Clausen Page2 VIGTIGT: SKIFT PIPETTE SPIDSER/TIPS EFTER HVER GANG!! Så undgår du at forurene

Læs mere

Undersøgelser af fiskeproteiner. protein-fingerprinting og immunoblotting 1. Proteomik kit I Proteinelektroforese

Undersøgelser af fiskeproteiner. protein-fingerprinting og immunoblotting 1. Proteomik kit I Proteinelektroforese Undersøgelser af fiskeproteiner. protein-fingerprinting og immunoblotting 1 Proteomik kit I Proteinelektroforese Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium og Niels Troest, Bjerringbro

Læs mere

FORSØG ØL verdens første svar på anvendt

FORSØG ØL verdens første svar på anvendt FORSØG ØL verdens første svar på anvendt bioteknologi Biotech Academy BioCentrum-DTU Søltofts Plads DTU - Bygning 221 2800 Kgs. Lyngby www.biotechacademy.dk bioteket@biocentrum.dtu.dk INDHOLDSFORTEGNELSE

Læs mere

OPTIMERING AF PCR MHP. DETEKTION AF SNP ER I CERS6.

OPTIMERING AF PCR MHP. DETEKTION AF SNP ER I CERS6. OPTIMERING AF PCR MHP. DETEKTION AF SNP ER I CERS6. Bachelorprojekt Udarbejdet af Sandra Reinholt Nielsen 14.08.1981 Projektperiode: 6. April 9.juni 2009 Vejledere: Søren Jensen, Lektor, Professionshøjskolen

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Green Fluorescent Protein (GFP) Oprensnignskit Katalognummer 166-0005-EDU www.bio-rad.com For teknisk service bedes du ringe til dit lokale Bio-Rad kontor Office or in the U.S. Call

Læs mere

Biotechnology Explorer. Regnskovens hemmelighed

Biotechnology Explorer. Regnskovens hemmelighed Biotechnology Explorer Regnskovens hemmelighed Katalognummer 166-0006-EDU explorer.bio-rad.com For teknisk service bedes du ringe til dit lokale Bio-Rad kontor Office or in the U.S. Call 1-800-4BIORAD

Læs mere

Laboratorieprotokol for manuel isolering af DNA fra 0,5 ml prøve

Laboratorieprotokol for manuel isolering af DNA fra 0,5 ml prøve Laboratorieprotokol for manuel isolering af DNA fra 0,5 ml prøve Til isolering af genomisk DNA fra indsamlingssætserierne Oragene - og ORAcollect. Du kan finde flere sprog og protokoller på vores webside

Læs mere

DNA origami øvelse DNA origami øvelse

DNA origami øvelse DNA origami øvelse DNA origami øvelse Introduktion I denne øvelse bruger vi DNA origami teknikken til at samle en tavle af DNA med dimensioner på 70 nm x 100 nm. Tavlen dannes af et langt enkeltstrenget DNA molekyle, der

Læs mere

Green Fluorescent Protein (GFP) Oprensning af GFP

Green Fluorescent Protein (GFP) Oprensning af GFP 1 Green Fluorescent Protein (GFP) Oprensning af GFP Katalognummer 166-0005EDU www.biorad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium Revideret februar 2010. Kontakt: Birgitjustesen@gmail.com

Læs mere

pglo-transformationskit

pglo-transformationskit Katalog nummer 166-0003-EDU pglo-transformationskit arac ori pglo bla GFP Oversat og bearbejdet af Birgit Sandermann Justesen og Lars Moeslund, 2004 Brugen af dette kit til undervisningsbrug skal varetages

Læs mere

C V C. Vejledning i brug af Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014

C V C. Vejledning i brug af Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014 DOT131v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Side 1 af 7 Vejledning i brug af Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revision 2 Juli 2014 DOT131v1

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer DNA Fingerprinting Kit Instruktionsmanual Katalognummer 166-0007EDU explorer.bio-rad.com Kittet sendes ved stuetemperatur. Åben kittet straks ved modtagelse og opbevar de enkelte

Læs mere

Elektroforese. Navne: Rami Kassim Kaddoura Roman Averin Safa Sarac Magnus Høegh Jensen Frederik Gaarde Lindskov

Elektroforese. Navne: Rami Kassim Kaddoura Roman Averin Safa Sarac Magnus Høegh Jensen Frederik Gaarde Lindskov Elektroforese Navne: Rami Kassim Kaddoura Roman Averin Safa Sarac Magnus Høegh Jensen Frederik Gaarde Lindskov Klasse: 1.4 Fag: Biologi Vejleder: Brian Christensen Skole: Roskilde tekniske gymnasium, Htx

Læs mere

Isolering af DNA fra løg

Isolering af DNA fra løg Isolering af DNA fra løg Formål: At afprøve en metode til isolering af DNA fra et levende væv. At anvende enzymer.. Indledning: Isolering af DNA fra celler er første trin i mange molekylærbiologiske undersøgelser.

Læs mere

Kromosom 16 PV92 PCR Kit

Kromosom 16 PV92 PCR Kit as indicated. 1 uplication of any part of this document is permitted for classroom use only Please visit explorer.bio-rad.com to access our selection of language translations for Biotechnology Explorer

Læs mere

Regnskovens hemmelighed

Regnskovens hemmelighed 1 Regnskovens hemmelighed Katalognummer 1660006-EDU www.bio-rad.com Oversat og bearbejdet af Birgit Sandermann Justesen, Nærum Gymnasium Revideret februar 2010. Kontakt: Birgitjustesen@gmail.com Brugen

Læs mere

Restriktionsenzymer findes Genkendelsessekvens

Restriktionsenzymer findes Genkendelsessekvens Restriktionsenzymer Skanning Restriktionsenzymer findes i bakterier (forsvarsmekanisme) IKKE i eukaryote celler 3-5 - 5-3 - Restriktionsenzyme Genkendelsessekvens Palindromisk Otto, Anna, radar Madam I

Læs mere

Regnskovens hemmeligheder

Regnskovens hemmeligheder Center for Undervisningsmidler, afdeling København Regnskovens hemmeligheder Øvelsesvejledning Formål Et gen for et kræfthelbredende protein er blevet fundet i nogle mystiske blade i regnskoven. Forskere

Læs mere

Materialeliste: Ready-to-loadTM DNA prøver til elektroforese. Medfølgende reagenser og tilbehør. Egne materialer

Materialeliste: Ready-to-loadTM DNA prøver til elektroforese. Medfølgende reagenser og tilbehør. Egne materialer Elevvejledning 1 Materialeliste: Ready-to-loadTM DNA prøver til elektroforese A B C D E F Plasmid DNA (uskåret) Plasmid skåret med Bgl I Plasmid skåret med Eco RI Lambda DNA (uskåret) Lambda DNA skåret

Læs mere

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse

Plasmidoprensning med kogemetode Oprensning af plasmid DNA med kogemetode for brug til transformation og restriktionsanalyse www.volvoxdk.dk C. Girnth-Diamba og B. Fahnøe, 2010 Claudia Girnth-Diamba og Bjørn Fahnøe Solrød Gymnasium, Solrød Center 2 DK 2680 Solrød Strand, Denmark E: sgcg@solgym.dk og sgbf@solgym.dk Plasmidoprensning

Læs mere

Elevguide Forsøg I: Tjekliste Materialer pr. gruppe.

Elevguide Forsøg I: Tjekliste Materialer pr. gruppe. Elevguide Forsøg I: Opsporing af sygdomsudbrud en sygdoms smitteveje. I dette forsøg skal I prøve at kortlægge smittevejene for koppe-virus. For at stoppe sygdommens fremmarch mest muligt, ønsker man at

Læs mere

Deltagermateriale 43230 OGM. PCR-teknikker 1

Deltagermateriale 43230 OGM. PCR-teknikker 1 Deltagermateriale 43230 OGM PCR-teknikker 1 POLYMERASE KÆDE REAKTION (PCR) Indholdsfortegnelse 04/02 2 af 36 1. INDLEDNING... 4 DNA's opbygning... 5 DNA-replikation.... 7 2. PCR METODEN... 10 PCR en oversigt...

Læs mere

Brugsanvisning for SURVEYOR Scan KRAS Kit Exon 2 CE IVD

Brugsanvisning for SURVEYOR Scan KRAS Kit Exon 2 CE IVD 1 Producent Brugsanvisning for SURVEYOR Scan KRAS Kit Exon 2 CE IVD for DHPLC systemer Læs venligst denne brugsanvisning grundigt igennem, før dette produkt anvendes. Gem denne brugsanvisning til senere

Læs mere

Brugsanvisning for SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD

Brugsanvisning for SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD 1 Producent Brugsanvisning for SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD for DHPLC systemer Læs venligst denne brugsanvisning grundigt igennem, før dette produkt anvendes. Gem denne brugsanvisning til

Læs mere

Som substrat i forsøgene anvender vi para nitrophenylfosfat, der vha. enzymet omdannes til paranitrofenol

Som substrat i forsøgene anvender vi para nitrophenylfosfat, der vha. enzymet omdannes til paranitrofenol Enzymkinetik Introduktion I disse forsøg skal I arbejde med enzymet alkalisk fosfatase. Fosfataser er meget almindelige i levende organismer og er enzymer med relativt bred substrat specificitet. De katalyserer

Læs mere

FORSØG ØL verdens første svar på anvendt

FORSØG ØL verdens første svar på anvendt FORSØG ØL verdens første svar på anvendt bioteknologi Biotech Academy BioCentrum-DTU Søltofts Plads DTU - Bygning 221 2800 Kgs. Lyngby www.biotechacademy.dk bioteket@biocentrum.dtu.dk INDHOLDSFORTEGNELSE

Læs mere

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer pglo Transformationskit Katalognummer 166-0003-EDU explorer.bio-rad.com Dette kit skal opbevares ved stuetemperatur Kopiering af enhver del af dette dokument er kun tilladt til undervisningsbrug

Læs mere

August 2016 Outbreak Copyright: Lise Junker Nielsen & Allan Haurballe. Foto og illustrationer: Colourbox Kontakt:

August 2016 Outbreak Copyright: Lise Junker Nielsen & Allan Haurballe. Foto og illustrationer: Colourbox Kontakt: OutBreak 1 August 2016 Outbreak Copyright: Lise Junker Nielsen & Allan Haurballe. Foto og illustrationer: Colourbox Kontakt: lisej@bmb.sdu.dk Undervisningsforløbet og tilhørende forsøg udføres på eget

Læs mere

Formål At analysere for myosin i muskelvæv fra fisk ved brug af western blotting

Formål At analysere for myosin i muskelvæv fra fisk ved brug af western blotting Center for Undervisningsmidler, afdeling København Western blotting Øvelsesvejledning Formål At analysere for myosin i muskelvæv fra fisk ved brug af western blotting Teori Proteomik er studiet af celleproteiners

Læs mere

Faktor V Leiden mutation

Faktor V Leiden mutation Faktor V Leiden mutation Formål: finde ud af om individ har mutation i faktor V Leiden gen (missense: arginin glutamin) Materiale: oprens DNA fra leukocytter Metode: PCR med specifikke primere, oprens,

Læs mere

DNA-smykke Simpel ekstraktion af DNA fra kindceller fra mennesket, som er velegnet til at bruge i et halssmykke

DNA-smykke Simpel ekstraktion af DNA fra kindceller fra mennesket, som er velegnet til at bruge i et halssmykke 145678 John Schollar and Dean Madden National Centre for Biotechnology Education, University of Reading Science and Technology Centre, Earley Gate, Reading RG6 6BZ UK E: J.W.Schollar@reading.ac.uk Simpel

Læs mere

Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP

Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP August 2015 QIAsymphony SPprotokolark Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP Dette dokument er Tissue_LC_200_V7_DSP og Tissue_HC_200_V7_DSP QIAsymphony SPprotokolark, R2, til kitversion 1. QIAsymphony

Læs mere

Det Teknisk-Naturvidenskabelige Fakultet

Det Teknisk-Naturvidenskabelige Fakultet Analyse af geners ekspressionsprofil i arkiveret lymfoidt materiale: Undersøgelse af metode til kvalitetsbaseret udvælgelse af tumorvæv, der er fikseret i formalin og indstøbt i paraffin Afgangsprojekt

Læs mere

Kapitel 1 Genteknologi (1/6)

Kapitel 1 Genteknologi (1/6) Kapitel 1 Genteknologi (1/6) Transformation FOTO: SØREN LUNDBERG FORMÅL At isolere plasmider fra plasmidbærende bakterier og overføre dem til andre bakterier. TEORI Transformation er den teknik, hvor generne

Læs mere

Øvelse med tarmkræftceller i kultur.

Øvelse med tarmkræftceller i kultur. Øvelse med tarmkræftceller i kultur. Baggrund Hver 3. dansker bliver ramt af kræft, inden de er blevet 75 år. Tyktarmskræft er den 3. hyppigste kræftform hos både mænd og kvinder, hvor henholdsvis 7.3

Læs mere

Vejledning i brug af Biofortuna SSPGo TM HLA Typing Kits CE revision 5, Januar 2014

Vejledning i brug af Biofortuna SSPGo TM HLA Typing Kits CE revision 5, Januar 2014 DOT109v8: Vejledning i brug af Biofortuna SSPGo TM HLA Typing Kits. CE Revision 5 Side 1 af 11 1. Anvendelse Vejledning i brug af Biofortuna SSPGo TM HLA Typing Kits CE revision 5, Januar 2014 Biofortuna

Læs mere

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det.

Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Samarbejde mellem gymnasier og Aarhus Universitet Bioteknologiske eksperimenter Tag dine gener om halsen. Isoler dit eget DNA, og lav et halssmykke ud af det. Denne øvelse er baseret på øvelseskittet:

Læs mere

Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid)

Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid) Trin 1: Oprensning af genomisk DNA (DeoxyriboNucleicAcid) LÆRERVEJLEDNING forsøgskasse nr. 1 AAU (rev.17.02.16) (Denne del tager ca. 3 timer, max 14 prøver) Oprensningen forudsætter elevernes fortrolighed

Læs mere

Undersøgelse af forskellige probiotiske stammer

Undersøgelse af forskellige probiotiske stammer Undersøgelse af forskellige probiotiske stammer Formål Formålet med denne øvelse er: 1. At undersøge om varer med probiotika indeholder et tilstrækkeligt antal probiotiske bakterier, dvs. om antallet svarer

Læs mere

Brugsanvisning. PCR-amplifikation og sekventering af HLA-klasse I- og II-loci. Versionsnr.: 13.0 Udfærdigelsesdato: Juli 2013

Brugsanvisning. PCR-amplifikation og sekventering af HLA-klasse I- og II-loci. Versionsnr.: 13.0 Udfærdigelsesdato: Juli 2013 Brugsanvisning PCR-amplifikation og sekventering af HLA-klasse I- og II-loci Versionsnr.: 13.0 Udfærdigelsesdato: Juli 2013 EC REP Conexio Genomics Pty Ltd Qarad bvba 8/31 Pakenham St Cipalstraat 3 Fremantle

Læs mere

Kemiøvelse 2 1. Puffere

Kemiøvelse 2 1. Puffere Kemiøvelse 2 1 Puffere Øvelsens pædagogiske rammer Sammenhæng Denne øvelse er tilpasset kemiundervisningen på modul 3 ved bioanalytikeruddannelsen. Kemiundervisningen i dette modul indeholder blandt andet

Læs mere

Besvarelse til opgave 1 januar 1999 Spm. A: Spm. B:

Besvarelse til opgave 1 januar 1999 Spm. A: Spm. B: Besvarelse til opgave 1 januar 1999 Spm. A: Vi må lave et genomisk bibliotek i en lambdafag, cosmid, BAC eller YAC plasmid. Til dette vil vi skære det genomiske DNA partielt med Sau3A, så vi får stykker

Læs mere

Androstenon-indol-skatol-protokol.

Androstenon-indol-skatol-protokol. Androstenon-indol-skatol-protokol. Indholdsfortegnelse: 1. Formål side 2 2. Teori side 2 2. Prøvebehandling side 2 3. Materialer side 2 3.1 Apparatur side 2 3.2 Kemikalier side 3 3.3 Reagenser side 3 4.

Læs mere

Løsninger til opgaverne den Opgave 2 januar 2003 Spm. 1:

Løsninger til opgaverne den Opgave 2 januar 2003 Spm. 1: Løsninger til opgaverne den 6-9-06 Opgave 2 januar 2003 Spm. 1: Fidusen er her at vi kender den primære struktur af glukoamylasen fra tre forskellige svampe, en ascomycet, en basidiomycet og en zygomycet.

Læs mere

ProbeTec ET Chlamydia trachomatis and Neisseria gonorrhoeae Amplified DNA Assays

ProbeTec ET Chlamydia trachomatis and Neisseria gonorrhoeae Amplified DNA Assays ProbeTec ET Chlamydia trachomatis and Neisseria gonorrhoeae Amplified DNA Assays 3300754JAA 2008/09 Dansk USA patent nr. 5,270,184; 5,547,861; 5,648,211; 5,712,124; 5,744,311; 5,846,726; 5,851,767; 5,866,336;

Læs mere

Biosensor. by Biotech Academy. Øvelsesvejledning

Biosensor. by Biotech Academy. Øvelsesvejledning Biosensor by Biotech Academy Øvelsesvejledning Vigtig information om brug af biosensor kittet for undervisere Før øvelsen startes, er det vigtigt at underviseren har læst følgende erklæring og lærervejledningen,

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

PROCEDURENS PRINCIPPER BD

PROCEDURENS PRINCIPPER BD ProbeTec ET Chlamydia trachomatis Amplified DNA Assay 3300755JAA 2008/09 Dansk Patent Numbers: 5,270,184; 5,547,861; 5,648,211; 5,712,124; 5,744,311; 5,846,726; 5,851,767; 5,866,336; 5,919,630; 5,928,869;

Læs mere

Mælkesyrebakterier og holdbarhed

Mælkesyrebakterier og holdbarhed Mælkesyrebakterier og holdbarhed Formål Formålet med denne øvelse er at undersøge mælkesyrebakteriers og probiotikas evne til at øge holdbarheden af kød ved at: 1. Undersøge forskellen på bakterieantal

Læs mere

QIAsymphony SP-protokolark

QIAsymphony SP-protokolark Februar 2017 QIAsymphony SP-protokolark circdna_2000_dsp_v1 og circdna_4000_dsp_v1 Dette dokument er QIAsymphony circdna_2000_dsp_v1 og circdna_4000_dsp_v1 protokolark, version 1, R1 Sample to Insight

Læs mere

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler

Vi går derfor ud fra, at I ved, at DNA molekyler er meget lange molekyler DNA-profil analyse Indledning DNA-profil analyser eller i daglig tale DNA-fingeraftryk er en metode, der bruges, når man skal finde ud af, hvem der er far et barn, hvis der altså er flere muligheder. Det

Læs mere

Er der flere farver i sort?

Er der flere farver i sort? Er der flere farver i sort? Hvad er kromatografi? Kromatografi benyttes inden for mange forskellige felter og forskningsområder og er en anvendelig og meget benyttet analytisk teknik. Kromatografi bruges

Læs mere

Leucosep rør LTK.615 INDLÆGSSEDDEL. Til diagnostisk anvendelse in vitro PI-LT.615-DK-V3

Leucosep rør LTK.615 INDLÆGSSEDDEL. Til diagnostisk anvendelse in vitro PI-LT.615-DK-V3 Leucosep rør LTK.615 INDLÆGSSEDDEL Til diagnostisk anvendelse in vitro PI-LT.615-DK-V3 Vejledende information Tilsigtet anvendelse Leucosep rørene er beregnet til anvendelse i forbindelse med indsamling

Læs mere

NOD2 ekspression i tarmepitelceller

NOD2 ekspression i tarmepitelceller Roskilde Universitet, Den Naturvidenskabelige Bacheloruddannelse, Hus nr. 14 NOD2 ekspression i tarmepitelceller 2. semesterprojekt - forår 2015 Gruppe 6: Joachim Wittrup Højris Jensen Nicholas Philip

Læs mere

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm)

CYP7A1 (0,1 nm) CYP7A1 (0nM) UBIC (0,1 nm) Opgave 1 Leveren spiller en central rolle i lipid metabolismen og i opretholdelse af lipid homeostasen i hele kroppen. Lipidmetabolismen er fejlreguleret hos blandt andet svært overvægtige personer samt

Læs mere

Eksamensspørgsmål til BiB biologi B 2015

Eksamensspørgsmål til BiB biologi B 2015 Eksamensspørgsmål til BiB biologi B 2015 Med udgangspunkt i de udleverede bilag og temaet evolution skal du: 1. Redegøre for nogle forskellige teorier om evolution, herunder begrebet selektion. 2. Analysere

Læs mere

Børsteormene Marenzelleria

Børsteormene Marenzelleria Børsteormene Marenzelleria - PCR optimering i forbindelse med identifikation af siblingearter Roskilde Universitet 2011 Bachelor projekt Safa Maarouf og Nanna Høegh Jensen. Samarbejde med Jasna Mozina

Læs mere

Besvarelse af opgaverne til den Spm.A: efter TGA TCA Spm. B:

Besvarelse af opgaverne til den Spm.A: efter TGA TCA Spm. B: Besvarelse af opgaverne til den 20-9-06 Spm.A: Her vil vi gerne sætte et relativt lille stykke DNA (FLAG) sammen med et relativt stort stykke (PRB1). Det lille stykke er for lille til at vi kan PCR amplificere

Læs mere

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier

Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Forsøgsprotokol til larveforsøg: Tilsætning af 3 dage gamle larver til gødning inficeret med patogene bakterier Formål: at undersøge udviklingen i mængden af tilsatte patogene bakterier til hønsegødning.

Læs mere

Kemiøvelse 2 C2.1. Buffere. Øvelsens pædagogiske rammer

Kemiøvelse 2 C2.1. Buffere. Øvelsens pædagogiske rammer Kemiøvelse 2 C2.1 Buffere Øvelsens pædagogiske rammer Sammenhæng Denne øvelse er tilpasset kemiundervisningen på modul 3 ved bioanalytikeruddannelsen. Kemiundervisningen i dette modul indeholder blandt

Læs mere

[BESØGSSERVICE INSTITUT FOR MOLEKYLÆRBIOLOGI OG GENETIK, AU]

[BESØGSSERVICE INSTITUT FOR MOLEKYLÆRBIOLOGI OG GENETIK, AU] Enzymkinetik INTRODUKTION Enzymer er biologiske katalysatorer i alle levende organismer som er essentielle for liv. Selektivt og effektivt katalyserer enzymerne kemiske reaktioner som ellers ikke ville

Læs mere

ScanGel Monoclonal ABO/RH1/K 86495 48 kort 86485 288 kort

ScanGel Monoclonal ABO/RH1/K 86495 48 kort 86485 288 kort ScanGel Monoclonal ABO/RH1/K 86495 48 kort 86485 288 kort GELER INDEHOLDENDE MONOKLONALE REAGENSER AF MURIN ELLER HUMAN OPRINDELSE ABO1, ABO2, RH1, KEL1 Ag BESTEMMELSE IVD Alle de af Bio-Rad producerede

Læs mere

Efterbehandling til Enzymer - Klip dit tis i stykker CIRKUS NATURLIGVIS

Efterbehandling til Enzymer - Klip dit tis i stykker CIRKUS NATURLIGVIS Efterbehandling til Enzymer - Klip dit tis i stykker CIRKUS NATURLIGVIS Enzymer kan godt være svære at forstå, og oplægget indeholder rigtig meget information. Derfor er det en god idé, at lave noget efterbehandling.

Læs mere

Spm. 1.: Hvis den totale koncentration af monomer betegnes med CT hvad er så sammenhængen mellem CT, [D] og [M]?

Spm. 1.: Hvis den totale koncentration af monomer betegnes med CT hvad er så sammenhængen mellem CT, [D] og [M]? DNA-smeltetemperaturbestemmelse KemiF2-2008 DNA-smeltetemperaturbestemmelse Introduktion Oligonucleotider er ofte benyttet til at holde nanopartikler sammen med hinanden. Den ene enkeltstreng er kovalent

Læs mere

Mælkesyrebakterier og holdbarhed

Mælkesyrebakterier og holdbarhed Mælkesyrebakterier og holdbarhed Navn: Forsøgsvejledning Mælkesyrebakterier og holdbarhed Formål med forsøget Formålet med denne øvelse er at undersøge mælkesyrebakteriers og probiotikas evne til at øge

Læs mere

Anvendelse af Enzymer i Fødevarer

Anvendelse af Enzymer i Fødevarer SRP-øvelse ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet Anvendelse af Enzymer i Fødevarer Øvelsesvejledning 2013 Henriette Erichsen, Anni Bygvrå Hougaard, Karsten Olsen og Jeanette

Læs mere

Find enzymer til miljøvenligt vaskepulver

Find enzymer til miljøvenligt vaskepulver Find enzymer til miljøvenligt vaskepulver Enzymer, der er aktive under kolde forhold, har adskillige bioteknologiske anvendelsesmuligheder. Nye smarte og bæredygtige produkter kan nemlig blive udviklet

Læs mere

datp, dctp, dgtp, dttp, [α 32 P]-dCTP urinstofholdig polyacrylamid gel røntgen film

datp, dctp, dgtp, dttp, [α 32 P]-dCTP urinstofholdig polyacrylamid gel røntgen film Opgave 1 Denne opgave omhandler osteoblast differentiering. Osteoblast celler er involveret i opbygning af knoglevæv. Osteoblast celler dannes ud fra såkaldte calvarial celler. For at forstå det molekylære

Læs mere

Analyse af benzoxazinoider i brød

Analyse af benzoxazinoider i brød Analyse af benzoxazinoider i brød Øvelsesvejledning til kemi-delen af øvelsen. Af Stine Krogh Steffensen, Institut for Agroøkologi, AU Eleven har forberedt før øvelsen: 1. Eleven har udfyldt skemaet herunder

Læs mere

Identifikation af CYP2B6 Sekvensvarianter ved Brug af Restriktions analyse

Identifikation af CYP2B6 Sekvensvarianter ved Brug af Restriktions analyse Identifikation af CYP2B6 Sekvensvarianter ved Brug af Restriktions analyse Udarbejdet af: Susan Nørmann Andersen projektperiode: April 2009 Juni 2009 Projekttype: bachelorprojekt Vejledere: Henrik B Rasmussen

Læs mere

B ProbeTec ET Chlamydia trachomatis Amplified DNA Assay

B ProbeTec ET Chlamydia trachomatis Amplified DNA Assay B ProbeTec ET Chlamydia trachomatis Amplified DNA Assay TILSIGTET BRUG BD ProbeTec ET Chlamydia trachomatis (CT) amplificeret DNA-analyse anvender, når det testes med BD ProbeTec ET systemet, Strand Displacement

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin August 2015 Juni 2016 Institution Hansenberg Gymnasium Uddannelse Fag og niveau Lærer(e) Hold Htx Bioteknologi

Læs mere

Grundbog: Marianne Frøsig m.fl., Biologi i Udvikling (BiU), i-bogen, Nucleus 2014

Grundbog: Marianne Frøsig m.fl., Biologi i Udvikling (BiU), i-bogen, Nucleus 2014 Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2017/2018, eksamen december 2017 Institution Kolding HF & VUC Uddannelse Fag og niveau Lærer(e)

Læs mere

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve Vejledende opgavesæt 1 Bioteknologi A Gymnasiale uddannelser 5 timers skriftlig prøve Vejledende opgavesæt 1 Mandag den 31. maj 2010 kl. 9.40-14.40 Side 1 af 8 sider pgave 1. Genmodificeret ris Vitamin

Læs mere

Undervisningsbeskrivelse fra august 2014

Undervisningsbeskrivelse fra august 2014 Undervisningsbeskrivelse fra august 2014 Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Oktober 2015 Institution Hansenberg Gymnasium Uddannelse Fag og niveau Lærer(e) Hold HTX Bioteknologi

Læs mere

Fremstilling af ferrofluids

Fremstilling af ferrofluids Fremstilling af ferrofluids Eksperiment 1: Fremstilling af ferrofluids - Elevvejledning Formål I dette eksperiment skal du fremstille nanopartikler af magnetit og bruge dem til at lave en magnetisk væske,

Læs mere