Trisomi 21 (Downs Syndrom) Oplæg

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Trisomi 21 (Downs Syndrom) Oplæg"

Transkript

1 Hvorfor er vi der? Cytogenetisk diagnostik 2005 (PCR, FISH, CGH) Thue Bryndorf Kromosomlaboratoriet Klinisk Genetisk Afdeling Dr. Lejeune Trisomi 21 (Downs Syndrom) Oplæg Klassisk cytogenetik (kromosomer) Nye metoder Kromosom-PCR til hurtigt at diagnosticere de hyppigste fosterkromosomfejl FISH og CGH til mere sensitiv kromosomdiagnostik 1

2 Prænatale prøvetyper Chorion villus biopsi Fra 11u+0d Amniocentese Fra 15u+0d Kromosomundersøgelse I Cirka 7.500/år i DK. Dyrkning af fostervands- eller chorion villus celler i dage Standsning i delingsfase og herefter fremstilling af karyotype (d.v.s. samlet billede af alle fostrets kromosomer) og Kromosomoptælling Svartid: 2-3 uger Metafasekromosomer Karyotype 2

3 Kromosomundersøgelse II Hyppigste fund er NY-opståede sygdomme med ekstra eller manglende kromosomer (numeriske aneuploidier) Prænatalt detekterede kromosomfejl i DK, Trisomi 21 Trisomi 18 Trisomi 13 Trisomi 13, 18, 21 i alt Kønskromosomfejl Andre 31 % 10 % 4 % 44 % 16 % 40 % Kromosom 13, 18, 21, X og Y aneuploidier udgør 60-75% af alle prænatalt detekterede kromosomfejl, men 90-95% af alle de klinisk betydende kromosomfejl hos nyfødte Kromo-fejl i fostervandsprøver Kromosomundersøgelse III Maternel alder Alle kromosomfejl % Relativ andel af trisomi ,9 0, ,0 0, ,2 0, ,5 0, ,8 0, ,3 0, ,9 0, ,7 0, ,5 0, ,0 0, ,2 0, ,7 0, ,6 0,73 Fra Practical genetic counselling af P. S. Harper, Oxford Sensivitet Cirka 10 millioner DNA-basepar 3

4 F508del CACTGTAGCTGTACTACCTTCCATCTCCTCACCTATTCCAACTATCTGAATCATGTGCC CTTCTCTGTGAACCTCTATCATAATACTTGTCACACTGTATTGTAATTGTCTCTTTTACT TTCCCTTGTATCTTTTGTGCATAGCAGAGTACCTGAAACAGGAAGTATTTTAAATATTTT GAATCAAATGAGTTAATAGAATCTTTACAAATAAGAATATACACTTCTGCTTAGGATGAT AATTGGAGGCAAGTGAATCCTGAGCGTGATTTGATAATGACCTAATAATGATGGGTTTTA TTTCCAGACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCAT TAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAA AGCATGCCAACTAGAAGAGGTAAGAAACTATGTGAAAACTTTTTGATTATGCATATGAAC CCTTCACACTACCCAAATTATATATTTGGCTCCATATTCAATCGGTTAGTCTACATATAT TTATGTTTCCTCTATGGGTAAGCTACTGTGAATGGATCAATTAATAAAACACATGACCTA TGCTTTAAGAAGCTTGCAAACACATGAAATAAATGCAATTTATTTTTTAAATAATGGGTT CATTTGATCACAATAAATGCATTTTATGAAATGGTGAGAATTTTGTTCACTCATTAGTGA GACAAACGTCTCAATGGTTATTTATATGGCATGCATATAGTGATATGTGGT e Lys Glu Asn Ile Ile Phe Gly Val Ser Tyr Asp Glu Tyr Arg T AAA GAA AAT ATC ATC TTT GGT GTT TCC TAT GAT GAA TAT AGA Kromosom-PCR Nakkefoldsscanning: Færre prøver. Flere abnorme. Mere nervøse gravide. Sundhedsstyrelsen 2004: Konsekvenserne ved de ofte betydelige ventetider ved kromosomdiagnostikken søges afbødet gennem anvendelse af analysemetoder med kort svartid. Hvad er kromosom-pcr? PCR Nobelpris 1993 Kvantitativ PCR anvendes til at måle antallet af kromosomerne 13, 18, 21, X & Y Analysetid: 1½ døgn. Svartid: 4-5 dage. 4

5 PCR Polymerase Chain Reaction Redskab til kopiering af udvalgte DNA-segmenter gange Kromosom-PCR 1. cyklus 2. cyklus 3. cyklus n cykler = 2 n kopier Kapillær-elektroforesemaskine Kromosom-PCR resultater 5

6 Kromosom-PCR resultater Svarbrev på Kromosom-PCR Resultatet af kromosom-pcr på din fostervandsprøve den hurtige prænatale undersøgelse for kromosom 13, 18, 21 og kønskromosomerne viser normale forhold. Det endelige resultat, som omfatter analyse af alle kromosomer, forventes inden for 3 uger og du modtager endnu et brev. Såfremt vi finder forhold, der fraviger det første resultat, bliver du kontaktet telefonisk. Perspektiv Kromosom-PCR teknikken bliver allerede nu anvendt til andre analyser udredning af mentalt retarderede børn skal til at anvendes inden for udredning af cancer og fostre med hjertefejl Hvad er FISH? DNA-baseret teknik Specifik farvning af kromosomer eller dele af kromosomer 6

7 FISH FISH FISH Interfase-FISH disomi Interfase-FISH FISH på cellekerner Metafase-FISH FISH på kromosompræparater 7

8 Interfase-FISH trisomi Interfase-FISH multicolor Normal (18/21-hybridisering) Trisomi 21 Aneuploidi screening for 13, 16, 18, 21, og 22 Mor med balanceret 1;5 translokation Prober: gul, rød, mørkeblå, lyseblå og grøn fluorescens 8

9 Balancerede translokationsbærere Risiko for ubalancerede fejl i kønsceller Nedsat fertilitet Spontane aborter Misdannede/retarderede børn Præimplantatorisk diagnostik (PGD) PGD ubalanceret 1;5 translokation Metafase FISH Afklaring af indviklede karyotyper 9

10 Translokation (ekstra materiale på kr. 18) Metafase FISH (kr. 18 maleprobe) Metafase FISH (kr. 11 maleprobe) Henvisning fra UL Hjertemisdannelse hos fostret (truncus arteriosus), obs. del 22q11 10

11 Mikrodeletioner Undersøgelse for 22q11 deletion 22q11 deletions-syndrom Medfødte hjertefejl Aplasi/hypoplasi af thyroidea/parathyroidea Craniofaciale misdannelser - Deletion + Deletion (A ) Metafase FISH Fordel Sikker identifikation af translokeret og ekstra eller manglende materiale Metafase FISH Ulemper Man skal have en mistanke om, hvilket materiale som er translokeret og/eller duplikeret Prober er dyre Varierende probe signal kvalitet Visse områder dækkes ikke af maleprober Proberne er vanskelige at kombinere i stort tal i samme reaktion 11

12 Perspektiv CGH FISH teknikken finder ikke nye anvendelsesområder. Multi-PCR overtager bortset fra ved præimplantatorisk diagnostik CGH hybridisering på normale kromosomer CGH-analyse 12

13 CGH analyse af Tali, 3 år gammel pige Mor Fysisk og mentalt retarderet Mikrocefali Bred og flad næse Lavtsiddende ører Tynd øverste læbe Lang philtrum Høj gane Mor gravid (10 uger) B , No. 36 Dim(21q22->ter) Enh(22q13->qter CGH på Tali Dim(21q22->ter) Enh(22q13->qter) CGH på foster Enh(21q22->qter) Dim(22q13->qter) CVS - foster 13

14 Mb chip 3000 kloner med cirka 1 million basepars afstand 470 særligt udvalgte kloner fra områder, som er involveret i mental retardering Array-CGH Måske den endelige afløser for almindelig kromosomanalyse evt. i kombination med kromosom-pcr En masse nye syndromer vil blive defineret ligesom det skete i erne, da det blev muligt at lave almindelig kromosomanalyse. Vi skal være med til at definere, hvad der er normalt Prænatal diagnostik Udviklingen af prænatal diagnostik CVS AC 14

15 Prænatal diagnostik af gravide > 35 år Præ- og postnatal diagnostik af trisomi 21, PD +PD prænatal postnatal Provokerede aborter Antal abn. Ab. Prov % , XXY XYY XXX X De novo transl Genetik på nettet Pubmed OMIM (Online Mendelian Inheritance in Man) Books Genetics Home Reference 15

16 Pubmed.com /.org /.gov Genetics Home Reference CDC Centers for Disease Control 16

Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008

Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008 Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2008 Susanne Kjærgaard Overlæge, dr.med. Klinisk Genetisk Afdeling Udredning af det syge foster Anamnese Familieanamnese Klinisk undersøgelse

Læs mere

5. februar Kompetencekort Cytogenetik

5. februar Kompetencekort Cytogenetik Kompetencekort Cytogenetik 5. februar 2015 Kompetencer i målbeskrivelsen (I= introduktionsstilling, H= Hoveduddannelse) som er dækket af denne konkretisering: I I I H H H Beskrive (1) kromosomstruktur,

Læs mere

Genetiske undersøgelser i graviditeten

Genetiske undersøgelser i graviditeten Til patienter og pårørende Genetiske undersøgelser i graviditeten Vælg billede Vælg farve Klinisk Genetisk Afdeling (KGA) Denne folder henvender sig til dig, der er gravid, og som har fået tilbudt en genetisk

Læs mere

Brugervejledning: prænatal genetisk analyse og analyser på aborter og dødfødte.

Brugervejledning: prænatal genetisk analyse og analyser på aborter og dødfødte. OUH - Klinisk Genetik, OUH - 2 KERNEYDELSER - 2.01 Almene forløb - 2.01.16 Præanalyse - 2.01.16.01 Vejledninger til diverse prøvetagninger Klinisk Genetik, OUH Udskrevet er dokumentet ikke dokumentstyret.

Læs mere

Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse

Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse Side 1 af 5 Procedure/vejledning Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse Udarbejdet af Lægerne, Kennedy Centret 1 Hvad er kromosom mikroarray analyse? Kromosom mikroarray

Læs mere

Risikovurdering og prænatal diagnostik Sundhedsstyrelsens retningslinjer. Risikovurdering. Diagnostik. Ann Tabor

Risikovurdering og prænatal diagnostik Sundhedsstyrelsens retningslinjer. Risikovurdering. Diagnostik. Ann Tabor Risikovurdering og prænatal diagnostik Sundhedsstyrelsens retningslinjer Undersøgelse for kromosomsygdomme Diagnostik moderkageprøve fostervandsprøve Ann Tabor Risikovurdering biokemiske undersøgelser

Læs mere

Genetisk udredning af det syge foster

Genetisk udredning af det syge foster Genetisk udredning af det syge foster U-Kursus i Føtal Medicin 2009 Susanne Kjærgaard Overlæge, dr.med. Klinisk Genetisk Afdeling Anamnese Familieanamnese Klinisk undersøgelse Laboratorieundersøgelser

Læs mere

Spørgsmål til tirsdag. U-kursus i føtal medicin GE 21/

Spørgsmål til tirsdag. U-kursus i føtal medicin GE 21/ Spørgsmål til tirsdag U-kursus i føtal medicin GE 21/10 2009 Ul-Screening Nævn diagnostiske og screenings (risikovurdering) metoder indenfor prænatal diagnostik Screening: Ultralyd, biokemi. Diagnostik:

Læs mere

Prænatal diagnostik Etiske dilemmaer

Prænatal diagnostik Etiske dilemmaer Prænatal diagnostik Etiske dilemmaer Eva Hoseth Specialeansvarlig overlæge Ambulatorium for Graviditet og Ultralyd KLINIK KVINDE-BARN OG URINVEJSKIRURGI AALBORG UNIVERSITETSHOSPITAL Retningslinjer for

Læs mere

UL misdannelser og aneuploidisyndromerne. UL diagnostik af syndromer og monogene sygdomme. Trisomi 21 hyppigheder! Down syndrom cytogenetisk fordeling

UL misdannelser og aneuploidisyndromerne. UL diagnostik af syndromer og monogene sygdomme. Trisomi 21 hyppigheder! Down syndrom cytogenetisk fordeling UL diagnostik af syndromer og monogene sygdomme A-kursus i føtal medicin Minikursus i klinisk genetik RH 4. oktober 2005 UL misdannelser og aneuploidisyndromerne Èn misdannelse: ca. 8-10 % vil have kromosomfejl

Læs mere

Modul 8, fagpakke 1 Kromosomabnormaliteter, FISH og CGH Stud. udgave (minus billeder) 1

Modul 8, fagpakke 1 Kromosomabnormaliteter, FISH og CGH Stud. udgave (minus billeder) 1 Modul 8, fagpakke 1 Kromosomabnormaliteter, FISH og CGH Stud. udgave (minus billeder) kako@viauc.dk 1 Karyotypering Foruden mutationer kan genetiske sygdomme skyldes kromosomabnormalite ter. Typisk fejl

Læs mere

Personlig medicin i genetisk rådgivning og udredning

Personlig medicin i genetisk rådgivning og udredning Personlig medicin i genetisk rådgivning og udredning Elsebet Østergaard Overlæge, Klinisk Genetisk Klinik, Rigshospitalet Formand, Dansk Selskab for Medicinsk Genetik Genetisk rådgivning og udredning før

Læs mere

Prænatal diagnostik af kromosomsygdomme efter indførelse af risikovurdering for Downs syndrom

Prænatal diagnostik af kromosomsygdomme efter indførelse af risikovurdering for Downs syndrom 1152 Prænatal diagnostik af kromosomsygdomme efter indførelse af risikovurdering for Downs syndrom Originalartikel Afdelingslæge Susanne Kjærgaard, afdelingslæge Johanne M.D. Hahnemann, overlæge Lillian

Læs mere

Kromosomforandringer. Information til patienter og familier

Kromosomforandringer. Information til patienter og familier Kromosomforandringer Information til patienter og familier 2 Kromosomforandringer Den følgende information er en beskrivelse af kromosomforandringer, hvorledes de nedarves og hvornår dette kan medføre

Læs mere

Sjældne kromosomafvigelser

Sjældne kromosomafvigelser Sjældne kromosomafvigelser Et informationshæfte udgivet af Forældreforeningen UniqueDanmark Lægerne på Kennedy Instituttet - Statens Øjenklinik Center for Små Handicapgrupper Indholdsfortegnelse Om dette

Læs mere

Kromosomforandringer. Information til patienter og familier

Kromosomforandringer. Information til patienter og familier 12 Odense: Odense Universitetshospital Sdr.Boulevard 29 5000 Odense C Tlf: 65 41 17 25 Kromosomforandringer Vejle: Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 Århus:

Læs mere

Nye retningslinjer under udarbejdelse aktuelt. Behov for nye retningslinjer pga nye metoder i den prænatale diagnostik.

Nye retningslinjer under udarbejdelse aktuelt. Behov for nye retningslinjer pga nye metoder i den prænatale diagnostik. Prænatal Diagnostik Overlæge Christina Fagerberg, Molekylærbiolog Charlotte Brasch Andersen, PhD, Klinisk Genetisk Afdeling, OUH Afdelingslæge Geske Bak, Føtalmedicinsk Klinik, Gynækologisk-Obstestrisk

Læs mere

Genetisk udredning af det syge foster

Genetisk udredning af det syge foster Genetisk udredning af det syge foster Kursus i Føtal Medicin 2014 Susanne Kjærgaard Overlæge, dr.med. Kromosomlaboratoriet Klinisk Genetisk Afdeling Udredning af det syge foster Anamnese Familieanamnese

Læs mere

Kategori Variabelnavn i Analyseportal Datakilde Maternelle oplysninger CPR mor Astraia, LPR, DCCR, Fødselsregisteret

Kategori Variabelnavn i Analyseportal Datakilde Maternelle oplysninger CPR mor Astraia, LPR, DCCR, Fødselsregisteret Variabel-liste FØTOdatabasen Kategori Variabelnavn i Analyseportal Datakilde Maternelle oplysninger CPR mor, LPR, DCCR, Fødselsregisteret Fødselsdata CPR barn DCCR, Fødselsregisteret Maternelle oplysninger

Læs mere

Ultralydscanning af underlivet hos gynækologen

Ultralydscanning af underlivet hos gynækologen Ultralydscanning af underlivet hos gynækologen 9.9.2006 Suzan Lenz Ultralydscanning er et af gynækologens bedste redskaber til at vurdere om din livmoder og æggestokke er normale. Scanningen foregår gennem

Læs mere

Høringsudkast: Retningslinjer for fosterdiagnostik 2016 prænatal information, risikovurdering, ra dgivning og diagnostik

Høringsudkast: Retningslinjer for fosterdiagnostik 2016 prænatal information, risikovurdering, ra dgivning og diagnostik Høringsudkast: Retningslinjer for fosterdiagnostik 2016 prænatal information, risikovurdering, ra dgivning og diagnostik 2. juni 2016 Indhold 1. Indledning... 4 2. Formålet med fosterdiagnostik... 7 3.

Læs mere

Gravid UNDERSØGELSER AF BARNET I MAVEN

Gravid UNDERSØGELSER AF BARNET I MAVEN Gravid UNDERSØGELSER AF BARNET I MAVEN TILLYKKE MED GRAVIDITETEN! Alle gravide får tilbud om to scanninger i løbet af graviditeten for at se, om fostret udvikler sig, som det skal. Det er naturligvis dig,

Læs mere

Screening. Definition. Formål med screening. Eksempler. Sygdommen. Eksempler. Ulrik Kesmodel Institut for Folkesundhed Afdeling for Epidemiologi

Screening. Definition. Formål med screening. Eksempler. Sygdommen. Eksempler. Ulrik Kesmodel Institut for Folkesundhed Afdeling for Epidemiologi Definition Screening Ulrik Kesmodel Institut for Folkesundhed Afdeling for Epidemiologi Systematisk undersøgelse af asymptomatiske befolkningsgrupper for en eller flere sygdomme mhp. at vurdere om (det

Læs mere

Kromosomtranslokationer

Kromosomtranslokationer 12 Kromosomtranslokationer December 2009 Oversat af Anja Lisbeth Frederiksen, reservelæge, ph.d. Klinisk Genetisk Afdeling, Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet

Læs mere

OM TESTEN OM VIRKSOMHEDEN

OM TESTEN OM VIRKSOMHEDEN OM VIRKSOMHEDEN Sequenom Laboratories er et datterselskab, som er 100 % ejet af Sequenom, Inc. Det er et CAPakkrediteret og CLIA-certificeret laboratorium (Clinical Laboratory Improvement Amendment) med

Læs mere

Information til gravide om. Nakkefoldsskanning og doubletest Tilbud til gravide om risikoberegning for Downs syndrom

Information til gravide om. Nakkefoldsskanning og doubletest Tilbud til gravide om risikoberegning for Downs syndrom Information til gravide om Nakkefoldsskanning og doubletest Tilbud til gravide om risikoberegning for Downs syndrom Alle gravide kvinder i Danmark har mulighed for at få lavet en risikoberegning for Downs

Læs mere

Hunting for Down syndrom. Etik. Etik. Etik. Risikovariable. Overordnet 06-02-2009. Etik Teknik

Hunting for Down syndrom. Etik. Etik. Etik. Risikovariable. Overordnet 06-02-2009. Etik Teknik Hunting for Down syndrom Etik Teknik Handlingsplan Information Etik DK har i 25 år tilbudt karyotype ved øget risiko for Down syndrom DK har i 25 år screenet: hvor gammel er du Etik DK har i 25 år tilbudt

Læs mere

INFORMATION TIL GRAVIDE. Risikovurdering og fosterdiagnostik

INFORMATION TIL GRAVIDE. Risikovurdering og fosterdiagnostik INFORMATION TIL GRAVIDE Risikovurdering og fosterdiagnostik Indhold Tillykke med graviditeten 1 Du kan få information om undersøgelserne 2 Information giver dig mulighed for at vælge 3 Forskellige typer

Læs mere

Fostervandsprøve ve og moderkageprøve

Fostervandsprøve ve og moderkageprøve Fostervandsprøve ve og moderkageprøve U-kursus i føtalmedicin 2008 Teknik UL-vejledt Erfaren operatør Nåletykkelse 0,9 mm 2 punkturer max. Undgå placenta? Teknik Antal indstik > 2 øger aborthyppigheden

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

Denne pdf-fil er downloadet fra Illustreret Videnskabs website (www.illvid.dk) og må ikke videregives til tredjepart.

Denne pdf-fil er downloadet fra Illustreret Videnskabs website (www.illvid.dk) og må ikke videregives til tredjepart. Kære bruger Denne pdf-fil er downloadet fra Illustreret Videnskabs website (www.illvid.dk) og må ikke videregives til tredjepart. Af hensyn til copyright indeholder den ingen fotos. Mvh Redaktionen Indblik

Læs mere

Reciprok translokation

Reciprok translokation Patientinformation Reciprok translokation Ægsortering Præimplantationsdiagnostik (PGD) Fertilitetsklinikken Gynækologisk Obstetrisk Afdeling D Ægsortering Hvad er præimplantationsdiagnostik? Ved præimplantationsdiagnostik,

Læs mere

FØTOSandbjerg Forslag til prænatal a-cgh Guideline Januar 2013. FØTOSandbjerg Guideline ENDELIGE 160116

FØTOSandbjerg Forslag til prænatal a-cgh Guideline Januar 2013. FØTOSandbjerg Guideline ENDELIGE 160116 FØTOSandbjerg Guideline ENDELIGE 160116 Prænatal array-cgh(comparativ Genomisk Hybridisering) Arbejdsgruppens medlemmer: Charlotte Ekelund, Christina Fagerberg, Susanne Kjærgaard, Maiken Lundstrøm, Lone

Læs mere

Årsrapport. (udgivet november 2012)

Årsrapport. (udgivet november 2012) Årsrapport 2011 (udgivet november 2012) Indholdsfortegnelse Forord... 3 Konklusion... 4 Anbefalinger... 5 Baggrund og formål... 6 Screening for kromosomfejl og misdannelser... 8 Historik... 9 Organisation...

Læs mere

Første trimester screening

Første trimester screening Første trimester screening Charlo.e Ekelund, læge, PhD Gynækologisk/Obstetrisk Afdeling Rigshospitalet U- kursus 28.10.2014 Formål Screening test 6-7 uger PAPP- A og frit beta hcg 9-11 uger nakkefoldsskanning

Læs mere

Principles of Clinical Cytogenetics

Principles of Clinical Cytogenetics Principles of Clinical Cytogenetics Cytogenese handler om studiet af kromosomer, deres struktur og arvelighed. Det er vigtige for at kunne diagnosticere kromosomdefekter og syndromer. For at kunne analysere

Læs mere

Årsrapport. (udgivet november 2012)

Årsrapport. (udgivet november 2012) Årsrapport 2011 (udgivet november 2012) Indholdsfortegnelse Forord... 3 Konklusion... 4 Anbefalinger... 5 Baggrund og formål... 6 Screening for kromosomfejl og misdannelser... 8 Historik... 9 Organisation...

Læs mere

INFORMATION TIL GRAVIDE. Risikovurdering og fosterdiagnostik

INFORMATION TIL GRAVIDE. Risikovurdering og fosterdiagnostik INFORMATION TIL GRAVIDE Risikovurdering og fosterdiagnostik Indhold Tillykke med graviditeten 1 Du kan få information om undersøgelserne 2 Information giver dig mulighed for at vælge 3 Forskellige typer

Læs mere

NIPT og prænatal screening

NIPT og prænatal screening NIPT og prænatal screening Møderække med SST: DFMS, DSMG, DSOG, (DSKB) 13. Januar, 24. Februar, 31. Marts, 15. Maj 2014 Off. Sygehuse: Roskilde Ålborg Alle? Private klinikker: Mange! 2 1 Abnorme karyotyper

Læs mere

Noninvasiv prænatal test er et gennembrud inden for prænatal screening

Noninvasiv prænatal test er et gennembrud inden for prænatal screening 2 Noninvasiv prænatal test er et gennembrud inden for prænatal screening Louise Stig Hornstrup 1, Louise Ambye 2, Steen Sørensen 2 & Finn Stener Jørgensen 1 Statusartikel 1) Ultralydklinikken, Gynækologisk

Læs mere

Tillykke, du er gravid.

Tillykke, du er gravid. Tillykke, du er gravid. Denne informationsfolder kan være relevant for dig og din familie hvis: 1. I overvejer at få lavet en test for at se, om jeres barn har Downs syndrom 2. Nakkefoldscanningen viser

Læs mere

Teknik. Teknik. Fostervandsprøve og moderkageprøve. Teknik. UL-vejledt Erfaren operatør Nåletykkelse 0.9 mm 2 punkturer max. Undgå placenta?

Teknik. Teknik. Fostervandsprøve og moderkageprøve. Teknik. UL-vejledt Erfaren operatør Nåletykkelse 0.9 mm 2 punkturer max. Undgå placenta? Teknik Fostervandsprøve og moderkageprøve UL-vejledt Erfaren operatør Nåletykkelse.9 mm 2 punkturer max. Undgå placenta? U-kursus i føtalmedicin 25 Teknik Antal indstik > 2 øger aborthyppigheden Operatørens

Læs mere

Jacobsens syndrom. Jacobsens syndrom. Beskrivelse Mere faglig viden Betydningen af en god udredning Støttemuligheder Andre med samme diagnose?

Jacobsens syndrom. Jacobsens syndrom. Beskrivelse Mere faglig viden Betydningen af en god udredning Støttemuligheder Andre med samme diagnose? Jacobsens syndrom Beskrivelse Mere faglig viden Betydningen af en god udredning Støttemuligheder Andre med samme diagnose? Links A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Ø 0-9 Jacobsens syndrom

Læs mere

Dansk Føtalmedicinsk Database (FØTOdatabasen) www.dfms.dk. National årsrapport 2013

Dansk Føtalmedicinsk Database (FØTOdatabasen) www.dfms.dk. National årsrapport 2013 Dansk Føtalmedicinsk Database (FØTOdatabasen) www.dfms.dk National årsrapport 2013 1. januar 2013 31. december 2013 Indeværende rapport er udarbejdet i et samarbejde mellem databasens styregruppe, Kompetencecenter

Læs mere

Gastrointestinalkanalen

Gastrointestinalkanalen Gastrointestinalkanalen Normal udvikling og malformationer U-kursus oktober 2006 Connie Jørgensen, Rigshospitalet Områder hvor stenoser/atresier hyppigst forekommer Gastrointestinalkanalen 10 uger Uge

Læs mere

PRÆNATAL GENETISK DIAGNOSTIK

PRÆNATAL GENETISK DIAGNOSTIK BETÆNKNING om PRÆNATAL GENETISK DIAGNOSTIK Afgivet af et udvalg nedsat af indenrigsministeriet BETÆNKNING NR. 803 København 1977 ISBN 87-503-2236-2 Statens trykningskontor In 00-348-bet. IN DHOLDSFORTEGNELSE

Læs mere

UNDERSØGELSER AF DET UFØDTE BARN URDU

UNDERSØGELSER AF DET UFØDTE BARN URDU UNDERSØGELSER AF DET UFØDTE BARN URDU Allerede nu kan du få information om undersøgelser af dit ufødte barn for visse medfødte sygdomme og handicap. Hvis du gerne vil vide mere om dette, er det en god

Læs mere

Tillykke, du er gravid.

Tillykke, du er gravid. Tillykke, du er gravid. Denne informationsfolder kan være relevant for dig og din familie hvis: 1. I overvejer at få lavet en test for at se, om jeres barn har Downs syndrom. 2. Nakkefoldscanningen viser,

Læs mere

Dilemmaer omkring 12 ugers grænsen for legal abort. Oplæg til Folketingets Sundhedsudvalg torsdag d 17. januar 2007

Dilemmaer omkring 12 ugers grænsen for legal abort. Oplæg til Folketingets Sundhedsudvalg torsdag d 17. januar 2007 Dilemmaer omkring 12 ugers grænsen for legal abort Oplæg til Folketingets Sundhedsudvalg torsdag d 17. januar 2007 Birgit Petersson, lektor, speciallæge i psykiatri, medlem af ankenævnet for abort og sterilisation

Læs mere

Vejledning til eksterne rekvirenter om prøver til analyse eller opbevaring på Kennedy Centret

Vejledning til eksterne rekvirenter om prøver til analyse eller opbevaring på Kennedy Centret Side 1 af 5 Vejledning til eksterne rekvirenter om prøver til analyse eller opbevaring på Kennedy Centret Før og ved Jeres prøvetagning: 1. Hvem kan rekvirere vore analyser? Læger på danske hospitalsafdelinger,

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab At stifte familie med HD

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab At stifte familie med HD Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab At stifte familie med HD At stifte familie med HD: HDBuzz' nye temaartikel om teknikker der kan

Læs mere

Information om fosterdiagnostik

Information om fosterdiagnostik Klinisk vejledning Information om fosterdiagnostik Genetisk rådgivning Risikovurdering Misdannelsesskanning Dansk selskab for almen medicin - 2005 Information om fosterdiagnostik Genetisk rådgivning Risikovurdering

Læs mere

Uddannelsesprogram for HOVEDUDDANNELSEN i klinisk genetik ved Klinisk Genetisk Afdeling, Århus Sygehus og Klinisk Genetik, Odense Universitetshospital

Uddannelsesprogram for HOVEDUDDANNELSEN i klinisk genetik ved Klinisk Genetisk Afdeling, Århus Sygehus og Klinisk Genetik, Odense Universitetshospital Uddannelsesprram for HOVEDUDDANNELSEN i klinisk genetik ved Klinisk Genetik, Odense Universitetshospital Beskrivelse af uddannelsen: Århus, Afd. Skejby, Pædiatrisk Afd. Odense Universitetshospital, Afd.

Læs mere

Sp 1:Fosterbevægelser

Sp 1:Fosterbevægelser Sp 1:Fosterbevægelser A. De fleste gravide vil have registreret fosterbevægelser fra: Uge 16 uge 20 uge 24 uge 28 B. Antallet af fosterbevægelser aftager normalt efter 34 uge Sp 2: Episiotomi Hvilke(t)

Læs mere

Fosterdiagnostik Hum-Tek 3.semester Hus 14.2 gruppe 9. Abstract

Fosterdiagnostik Hum-Tek 3.semester Hus 14.2 gruppe 9. Abstract Abstract The aim of this assignment has been to explore the advantages and/or disadvantages of the vastly increasing development in prenatal genetic testing. These changes raise a series of ethical questions,

Læs mere

Gældende fra: April 2014 (Hold SB512) Version: Endelig Side 1 af 5

Gældende fra: April 2014 (Hold SB512) Version: Endelig Side 1 af 5 Molekylærbiologiske analyser og teknikker har viden om teorien og principperne bag udvalgte molekylærbiologiske analyser og teknikker Analyser og analyseprincipper på biomolekylært, celle- og vævs- samt

Læs mere

Logbog for Hoveduddannelsen i Klinisk Genetik

Logbog for Hoveduddannelsen i Klinisk Genetik Logbog for Hoveduddannelsen i Klinisk Genetik Nedenfor er opført de kompetencer, der skal erhverves. Den uddannelsessøgende er selv ansvarlig for at få godkendt de opnåede kompetencer og for at indsamle

Læs mere

H I G H L I G H T S Føtosandbjerg 2008. På vej. Til Sandbjerg. Føto-Sandbjerg 2008. Astraia arbejdsgruppen

H I G H L I G H T S Føtosandbjerg 2008. På vej. Til Sandbjerg. Føto-Sandbjerg 2008. Astraia arbejdsgruppen H I G H L I G H T S Føtosandbjerg 2008 På vej Til Sandbjerg Arbejdsgrupper Guidelinegrupper Føto-Sandbjerg 2008 Arbejdsgrupper Styregruppe ASTRAIA-udvalg Forsknings-udvalg Undervisnings- og kursusaktiviteter

Læs mere

Recessiv (vigende) arvegang

Recessiv (vigende) arvegang 10 Recessiv (vigende) arvegang Anja Lisbeth Frederiksen, reservelæge, ph.d., Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet af Guy s and St Thomas Hospital, London, Storbritanien;

Læs mere

Revideret specialevejledning for klinisk genetik (version til ansøgning)

Revideret specialevejledning for klinisk genetik (version til ansøgning) Revideret specialevejledning for klinisk genetik (version til ansøgning) Specialevejledningen er udarbejdet som led i Sundhedsstyrelsens specialeplanlægning, jf. sundhedslovens 208, som omhandler organiseringen

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

Gastrointestinalkanalen

Gastrointestinalkanalen Gastrointestinalkanalen Normal udvikling og malformationer U-kursus oktober 2006 Connie Jørgensen, Rigshospitalet Esofgus Normal eosofagus Øsofagusatresi Øsofagusstenose eller atresi forekomst 3.3:10,000

Læs mere

Coffin-Lowrys syndrom

Coffin-Lowrys syndrom Coffin-Lowrys syndrom Beskrivelse Mere faglig viden Betydningen af en god udredning Støttemuligheder Andre med samme diagnose? Links A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Ø 0-9 Coffin-Lowrys

Læs mere

Restriktionsenzymer findes Genkendelsessekvens

Restriktionsenzymer findes Genkendelsessekvens Restriktionsenzymer Skanning Restriktionsenzymer findes i bakterier (forsvarsmekanisme) IKKE i eukaryote celler 3-5 - 5-3 - Restriktionsenzyme Genkendelsessekvens Palindromisk Otto, Anna, radar Madam I

Læs mere

PCR (Polymerase Chain Reaction): Opkopiering af DNA

PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR (Polymerase Chain Reaction): Opkopiering af DNA PCR til at opkopiere bestemte DNA-sekvenser i en prøve er nu en af genteknologiens absolut vigtigste værktøjer. Peter Rugbjerg, Biotech Academy PCR (Polymerase

Læs mere

Alkoholforbrug og graviditet: Risici, holdninger og informationspraksis.

Alkoholforbrug og graviditet: Risici, holdninger og informationspraksis. Alkoholforbrug og graviditet: Risici, holdninger og informationspraksis. Ulrik Schiøler Kesmodel Institut for Klinisk Medicin Københavns Universitet Gynækologisk Obstetrisk Afd. Herlev og Gentofte Hospital

Læs mere

MOLEKYLÆR GENETIK - MCAD DEFICIENS - NEONATAL SCREENING

MOLEKYLÆR GENETIK - MCAD DEFICIENS - NEONATAL SCREENING MOLEKYLÆR GENETIK - MCAD DEFICIENS - NEONATAL SCREENING Brage Storstein Andresen Molekylær Medicinsk Forskningsenhed, Skejby Sygehus og Institut for Biokemi og Molekylær Biologi, Syddansk Universitet Nyfødt

Læs mere

Artikulationsvanskeligheder

Artikulationsvanskeligheder Artikulationsvanskeligheder Læbe-kæbe-ganespalte Dyslalier Dysartrier ALS 30. oktober 2007 Hyppighed 2 promille af en fødselsårgang 130 140 nye tilfælde pr. år i DK 75 80 nye pr. år i vest-dk, ses alle

Læs mere

UNDERSØGELSER AF DET UFØDTE BARN URDU

UNDERSØGELSER AF DET UFØDTE BARN URDU UNDERSØGELSER AF DET UFØDTE BARN URDU Information Allerede nu kan du få information om undersøgelser af dit ufødte barn for visse medfødte sygdomme og handicap. Ja? Hvis du gerne vil vide mere om dette,

Læs mere

Årsrapport 2008-2009-2010. (udgivet november 2011)

Årsrapport 2008-2009-2010. (udgivet november 2011) Årsrapport 2008-2009-2010 (udgivet november 2011) Indholdsfortegnelse Forord... 3 Konklusion... 4 Anbefalinger... 4 Baggrund og formål... 5 Sygdomme, der screenes for... 7 Historik... 8 Organisation...

Læs mere

Overvågning af misdannelser og andre medfødte lidelser Helweg-Larsen, Karin; Hermansen, Thomas Stig; Andersen, Anne-Marie Nybo

Overvågning af misdannelser og andre medfødte lidelser Helweg-Larsen, Karin; Hermansen, Thomas Stig; Andersen, Anne-Marie Nybo Syddansk Universitet Overvågning af misdannelser og andre medfødte lidelser Helweg-Larsen, Karin; Hermansen, Thomas Stig; Andersen, Anne-Marie Nybo Publication date: 2006 Document Version Også kaldet Forlagets

Læs mere

Kodevejledning til forandringer i placenta, fosterhinder og navlestreng (T88)

Kodevejledning til forandringer i placenta, fosterhinder og navlestreng (T88) Kodevejledning til forandringer i placenta, fosterhinder og navlestreng (T88) Alle patoanatomiske koder (SNOMED-koder) overføres fra alle danske patologiafdelinger til den landsdækkende patologidatabase

Læs mere

Organisation. Obstetrisk UL TERMIN & UL. Niveau 1. Kranium 06-05-2011

Organisation. Obstetrisk UL TERMIN & UL. Niveau 1. Kranium 06-05-2011 Obstetrisk UL Organisation Organisation Niveau 1 enhver obstetriker Niveau 2 certificering Uge 12 (med serum-screening): Down Uge 19 Misdannelse 3 trimester: fosterets trivsel www.gads-forlag.dk/ultralydskanning

Læs mere

Dansk Føtalmedicinsk Database (FØTO-databasen) www.dfms.dk. National årsrapport 2014

Dansk Føtalmedicinsk Database (FØTO-databasen) www.dfms.dk. National årsrapport 2014 Dansk Føtalmedicinsk Database (FØTO-databasen) www.dfms.dk National årsrapport 2014 1. januar 2014 31. december 2014 Rapporten udgår fra Statistisk bearbejdning af data og epidemiologisk kommentering af

Læs mere

Gastrointestinalkanalen

Gastrointestinalkanalen Gastrointestinalkanalen Normal udvikling og malformationer U-kursus oktober 2009 Connie Jørgensen, Rigshospitalet 1 Esofgus Normal oesofagus 2 Oesofagusatresi Oesofagusstenose eller atresi forekomst 3.3:10,000

Læs mere

Føtalmedicinsk Database (FØTO databasen) www.dfms.dk

Føtalmedicinsk Database (FØTO databasen) www.dfms.dk Føtalmedicinsk Database (FØTO databasen) www.dfms.dk National årsrapport 2012 1. januar 2012 31. december 2012 National database for føtalmedicin FØTO Databasen. National årsrapport 2012 Regionernes Kliniske

Læs mere

X bundet arvegang. Information til patienter og familier

X bundet arvegang. Information til patienter og familier X bundet arvegang Information til patienter og familier 2 X bundet arvegang Følgende er en beskrivelse af, hvad X bundet arvegang betyder og hvorledes X bundne sygdomme nedarves. For at forstå den X bundne

Læs mere

Fostervandsprøve ve og moderkageprøve

Fostervandsprøve ve og moderkageprøve Fostervandsprøve ve og moderkageprøve U-kursus i føtalmedicin 2009 Invasive undersøgelser 1996-2006 4500 4000 3500 3000 2500 2000 1500 1000 500 0 1996 1998 2000 2002 2004 2006 AC CVS 1 Tidlige komplikationer

Læs mere

Invasive prøver. Fostervandsprøve og moderkageprøve. Ann Tabor v Karin Sundberg U-kursus i føtalmedicin 2014. Abortrate Komplikationer hos børnene

Invasive prøver. Fostervandsprøve og moderkageprøve. Ann Tabor v Karin Sundberg U-kursus i føtalmedicin 2014. Abortrate Komplikationer hos børnene Fostervandsprøve og moderkageprøve Ann Tabor v Karin Sundberg U-kursus i føtalmedicin 2014 Invasive prøver Abortrate Komplikationer hos børnene 1 Abortrate - uden invasiv procedure n US (uger) Abort (uger)

Læs mere

Spørgsmål til torsdag

Spørgsmål til torsdag Spørgsmål til torsdag U-kursus i føtal medicin GE 22/10 2009 U-kursus: Spørgsmål til torsdag 1 Ul-Screening/sen gennemskanning Nævn de 3 overordnede formål for misdannelsesscreening? Bekræfte normalitet

Læs mere

Case 1. Case 1. Case 1. Symfyse Fundus mål. Case 1. Case 1. 1 gravida, 0 para 27+2, henvist med SF mål på 19 cm (hvad

Case 1. Case 1. Case 1. Symfyse Fundus mål. Case 1. Case 1. 1 gravida, 0 para 27+2, henvist med SF mål på 19 cm (hvad 27+2, henvist med SF mål på 19 cm 380 g Negativt flow i navlesnor 27+2, henvist med SF mål på 19 cm (hvad er normalt symfyse fundus mål? UL 380 g Negativt flow i navlesnor Symfyse Fundus mål SF (cm) =

Læs mere

22q11-deletionssyndrom

22q11-deletionssyndrom 22q11-deletionssyndrom Beskrivelse Mere faglig viden Betydningen af en god udredning Andre med samme diagnose? Links A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Ø 0-9 22q11-deletionssyndrom Andre

Læs mere

Externt review Guideline gennemgået af.forud for plenar-gennemgang på guidelinemødet COI for referees: Se appendiks 1

Externt review Guideline gennemgået af.forud for plenar-gennemgang på guidelinemødet COI for referees: Se appendiks 1 FØTO-Sandbjerg guideline 2017 Titel Prænatal kromosom mikroarray analyse (CMA) Forfattere Ida Vogel, overlæge, Klinisk genetisk afdeling, Aarhus Universitetshospital Christina Fagerberg, overlæge, Klinisk

Læs mere

Modul 3: Sandsynlighedsregning

Modul 3: Sandsynlighedsregning Forskningsenheden for Statistik ST01: Elementær Statistik Bent Jørgensen Modul 3: Sandsynlighedsregning 3.1 Sandsynligheder................................... 1 3.2 Tilfældig udtrækning fra en mængde........................

Læs mere

BIOTEKNOLOGI HØJT NIVEAU

BIOTEKNOLOGI HØJT NIVEAU STUDENTEREKSAMEN 2007 2007-BT-1 BITEKNLGI HØJT NIVEAU Torsdag den 31. maj 2007 kl. 9.00 14.00 Sættet består af 1 stor og 2 små opgaver samt 1 bilag i 2 eksemplarer. Det ene eksemplar af bilaget afleveres

Læs mere

Sp 5: 28 årig kvinde med SLE, gravid i 8.uge. Nævn tre faktorer relateret til SLE, der har prognostisk betydning for denne kvindes graviditet?

Sp 5: 28 årig kvinde med SLE, gravid i 8.uge. Nævn tre faktorer relateret til SLE, der har prognostisk betydning for denne kvindes graviditet? VELKOMMEN HUSK: Eksamensnummer øverst på alle 4 svarark KUN 1½ minut per lysbillede 30 lysbilleder i alt Læs titlen/overskriften på hvert lysbillede Tekstbøger må ikke være fremme under eksaminationen

Læs mere

Svangerskabsjournal Side 1 af 2

Svangerskabsjournal Side 1 af 2 Svangerskabsjournal Side 1 af 2 Personnummer, navn og adresse Lægens navn og adresse E-mail E-mail Tlf. privat/mobil Tlf. arbejde Telefonnummer Sociale oplysninger Civilstand Sæt x Ugift Gift Separeret

Læs mere

Trine Rolighed Thomsen (seniorkonsulent, lektor, mikrobiolog) Center for Kemi- og Bioteknik, TI, Afd. for Bioteknologi, AAU, 7220 1828,

Trine Rolighed Thomsen (seniorkonsulent, lektor, mikrobiolog) Center for Kemi- og Bioteknik, TI, Afd. for Bioteknologi, AAU, 7220 1828, Hvorfor opstår legionella i varmt brugsvand og hvorfor er det farligt? Trine Rolighed Thomsen (seniorkonsulent, lektor, mikrobiolog) Center for Kemi- og Bioteknik, TI, Afd. for Bioteknologi, AAU, 7220

Læs mere

Uddannelsesprogram for introduktionsuddannelsen i Klinisk Genetik ved Vejle Sygehus

Uddannelsesprogram for introduktionsuddannelsen i Klinisk Genetik ved Vejle Sygehus Beskrivelse af faget Uddannelsesprram for introduktionsuddannelsen i Klinisk Genetik ved Vejle Sygehus Klinisk genetik er et tværgående klinisk diagnostisk speciale, der omfatter diagnostik rådgivning

Læs mere

X bundet arvegang. Information til patienter og familier. 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55

X bundet arvegang. Information til patienter og familier. 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 X bundet arvegang Århus Sygehus, Bygn. 12 Århus Universitetshospital Nørrebrogade 44 8000 Århus C Tlf: 89 49 43 63

Læs mere

Overvågning af misdannelser og andre medfødte lidelser

Overvågning af misdannelser og andre medfødte lidelser Overvågning af misdannelser og andre medfødte lidelser Forslag til en fremtidig opdatering af misdannelsesregistreringen i Danmark Karin Helweg-Larsen Thomas Stig Hermansen Anne-Marie Nybo Andersen 2006

Læs mere

Abstract! Indholdsfortegnelse

Abstract! Indholdsfortegnelse Abstract! This project attempts, through an analysis of arguments for and against prenatal testing, to discuss the ethical challenges they imply. A prenatal test seeks to determine whether the fetus will

Læs mere

Der er i et vist omfang mulighed for afholdelse af genetiske konsultationstimer på de øvrige regionshospitaler i Region Midtjylland.

Der er i et vist omfang mulighed for afholdelse af genetiske konsultationstimer på de øvrige regionshospitaler i Region Midtjylland. !""# $ %!&$ Klinisk genetik varetager ambulante forløb i form af genetisk rådgivning, og laboratoriediagnostik. Fraset diagnostik og behandling af medfødte stofskiftesygdomme hos nyfødte børn, der er centraliseret

Læs mere

Retningslinjer for fosterdiagnostik

Retningslinjer for fosterdiagnostik Sundheds- og Ældreudvalget 2016-17 SUU Alm.del Bilag 164 Offentligt Retningslinjer for fosterdiagnostik PRÆNATAL INFORMATION, RISIKOVURDERING, RÅDGIVNING OG DIAGNOSTIK 2017 Retningslinjer for fosterdiagnostik

Læs mere

Undersøgelse og eventuelt behandling af gentagne ufrivillige aborter (abortus habitualis)

Undersøgelse og eventuelt behandling af gentagne ufrivillige aborter (abortus habitualis) Undersøgelse og eventuelt behandling af gentagne ufrivillige aborter (abortus habitualis) I er blevet henvist til os, fordi I har haft gentagne ufrivillige aborter også kaldet abortus habitualis. I denne

Læs mere

Indholdsfortegnelse MONOGENE EGENSKABERS ARVEGANGE... 2 MUTATIONER... 8 MOLEKYLÆR GENETIK, NORMALE GENER, SYGDOMSGENER... 11 GENERS FUNKTION...

Indholdsfortegnelse MONOGENE EGENSKABERS ARVEGANGE... 2 MUTATIONER... 8 MOLEKYLÆR GENETIK, NORMALE GENER, SYGDOMSGENER... 11 GENERS FUNKTION... Opdateret: 30. April 2003 Indholdsfortegnelse MONOGENE EGENSKABERS ARVEGANGE... 2 MUTATIONER... 8 MOLEKYLÆR GENETIK, NORMALE GENER, SYGDOMSGENER... 11 GENERS FUNKTION... 15 GENETISK KOBLING OG GENKORTLÆGNING...

Læs mere