Biologi A. Studentereksamen. Tirsdag den 28. august 2012 kl Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Størrelse: px
Starte visningen fra side:

Download "Biologi A. Studentereksamen. Tirsdag den 28. august 2012 kl. 9.00-14.00. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares"


1 Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Vejledende opgavesæt 1 Tirsdag den 28. august 2012 kl

2 Side 1 af 8 sider Opgave 1. Respiratorisk udvekslingskvotient (R) 1 Muskler anvender især kulhydrater og fedt som energigivende stoffer under arbejde. Man kan bestemme, hvilke stoffer en person nedbryder ud fra måling af den respiratoriske udvekslingskvotient (R). R er defineret som forholdet mellem iltoptagelse og udskillelse af carbondioxid: R= CO 2 afgivelsen O 2 optagelsen Figur 1 viser reaktionsskemaer for nedbrydning af glucose og fedtsyren palmitinsyre. C 6 12 O O 2 6 CO O C COO + 23 O 2 16 CO O Figur 1. Reaktionskemaer for nedbrydning af glucose og palmitinsyre. Ved kulhydratforbrænding er R = Beregn den respiratoriske udvekslingskvotient (R) for nedbrydning af palmitinsyre. Vis dine beregninger. 2. Giv forslag til, hvordan man eksperimentelt kan bestemme R hos en forsøgsperson. Figur 2 viser en afbildning af R som funktion af iltoptagelse. 1,0 100/0 R-værdi 0,90 0,85 0,80 0,70 75/25 50/50 25/75 0/100 Kulhydrat, % Fedt, % % af maksimal iltoptagelse Figur 2. R som funktion af iltoptagelse. Iltoptagelsen er angivet i % af forsøgspersonernes maksimale iltoptagelse. øjre lodrette akse angiver den procentvise fordeling mellem kulhydrat og fedt ved den pågældende R-værdi. 3. Skriv en konklusion på baggrund af resultaterne vist i figur 2. 1 Respiratorisk udvekslingskvotient (R) beregnes ud fra en måling af indholdet af CO 2 og O 2 i udåndingsluften. Visse lærebøger bruger RQ for denne kvotient. RQ måles på CO 2 -produktionen og O -forbruget i musklerne. 2

3 Side 2 af 8 sider Figur 3 viser sammenhængen mellem R og varighed af et langvarigt arbejde efter indtagelse af forskellig kost. R-værdi 1,00 0,95 0,90 0,85 Normal kost Kulhydratdiæt 0,80 0,75 Fedtdiæt 0, Tid (Minutter) Figur 3. Sammenhængen mellem R og varighed af et langvarigt arbejde efter indtagelse af forskellig kost. Det stiplede stykke på graferne angiver, at der ikke er foretaget målinger ved overgangen mellem hvile og arbejde. De lodrette pile angiver tidspunkt for udmattelse. 4. Forklar forløbet af kurven vist i figur 3, for den person der har været på kulhydratdiæt. 5. Vurder, hvad forsøgsresultaterne vist i figur 2 og figur 3 kan anvendes til i forbindelse med planlægning og gennemførelse af idrætsaktiviteter.

4 Side 3 af 8 sider Opgave 2. Endosymbiose Endosymbionter er organismer der lever symbiotisk indeni en anden organisme. Under Galathea 3-ekspeditionen fandt en gruppe forskere en encellet heterotrof planktonorganisme, Amphisolenia bidentata, som lever i symbiose med en encellet algeart, se figur 1. A 25 μm B 5 μm Endosymbiont A.bidentata s cellekerne Figur 1. A: Amphisolenia bidentata. B: Encellede alger i A. bidentata. 1. Giv forslag til, hvad A. bidentata får ud af symbiosen med de encellede alger. ele celler af Amphisolenia bidentata indeholder to forskellige udgaver af et gen, der koder for rrna. Forskerne har isoleret og opformeret genet for rrna fra: A. ele celler af A. bidentata. B. Amphisolenia bidentatas cellekerne. C. Endosymbionters cellekerner. De opformerede gener blev efterfølgende analyseret ved hjælp af elektroforese. Resultatet fremgår af figur 2. M A B C K 1353 bp 1078 bp 872 bp 603 bp 310 bp 281 bp Figur 2. Elektroforeseresultat. M: Størrelsesmarkør. A: DNA fra hele celler af A. bidentata. B: DNA fra A. bidentatas kerne. C: DNA fra symbiontens kerne. K: Kontrol uden DNA. 2. Forklar, hvordan det ud fra resultatet vist i figur 2 kan ses, at hele celler af A. bidentata indeholder to forskellige udgaver af genet for rrna.

5 Side 4 af 8 sider For at bestemme hvilken algeart, der er tættest beslægtet med endosymbionten i A. bidentata er 1379 basepositioner i et gen hos endosymbionten blevet sammenlignet med basepositionerne i samme gen hos 7 andre algearter. Resultatet fremgår af figur 3. Endosymbiont Endosymbiont 1,75 1,97 1,67 3,72 5,17 5,97 5,90 1 2,04 1,89 3,35 5,10 5,97 5,46 2 1,46 3,43 5,68 6,70 6,04 3 3,57 5,68 6,33 5,90 4 5,03 5,91 5, ,62 1,75 2,55 Figur 3. Forskel i procent ved sammenligning af 1379 basepositioner mellem den endosymbionte alge i A. bidentata og 7 andre algearter Forklar, hvorfor forskel i basepositionerne kan bruges som et udtryk for, hvor tæt beslægtede de 7 alger er med endosymbionten. 4. Angiv hvilken af de 7 algearter, der er tættest beslægtet med endosymbionten. Begrund dit svar. Kloroplaster har deres eget DNA. Det forklares ved, at kloroplaster har udviklet sig fra fotosyntetiserende endosymbionter. Gener fra den fotosyntetiserende endosymbiont, er gennem evolutionen, flyttet til værtscellens kromosomer. Kloroplasters kromosomer indeholder derfor kun gener, som koder for en lille del af kloroplastproteinerne. Forskere vil isolere endosymbionter fra A. bidentata for at undersøge om de kan overleve uden for værtscellen. 5. Giv forslag til, hvilken viden dyrkningsforsøget kan give forskerne. Begrund dit svar.

6 Side 5 af 8 sider Opgave 3. Lactosetolerans I mælk findes lactose. Lactose nedbrydes af fordøjelsesenzymet lactase, se figur 1. O C 2 O O O O O C 2 O O O O O + 2 O Lactase O C 2 O O O O O + O C 2 O O O O O Figur 1. Nedbrydning af lactose. 1. Beskriv den reaktion, der katalyseres af lactase. Se figur 1. Evnen til som voksen at nedbryde lactose skyldes en mutation. Det kaldes lactosetolerans. Figur 2 viser basesekvenserne for den del af genet, hvor mutationen forekommer. a. 5 - GGCAATACAGATAAGATAATGTAGCCCCTGGCCT - 3 b. 5 - GGCAATACAGATAAGATAATGTAGTCCCTGGCCT - 3 Figur 2. Basesekvenser for a: Lactoseintolerans og b: Lactosetolerans. 2. Angiv hvilken type mutation, der er vist på figur 2. Begrund dit svar.

7 Side 6 af 8 sider Personer med lactosetolerans er homozygote med genotypen kk og personer med lactoseintolerans har genotyperne Kk eller KK. Forekomsten af lactosetolerans varierer i verdens befolkning, som vist i figur 3. 70% 50% 10% 50% 90% 50% 10% 70% 30% 10% 80% Figur 3. Procentvis forekomst af lactosetolerans. I den europæiske befolkning findes 90%, der er lactosetolerante med genotypen kk. 3. Bestem allelfrekvensen for K og k i Europa under antagelse af at ardy-weinbergmodellen gælder. Det forventes at allelfrekvensen for lactosetolerans vil ændres i Europa. 4. Angiv en populationsgenetisk faktor, der kan medføre en ændring i allelfrekvensen for lactosetolerans i Europa. Begrund dit svar. 5. Giv forslag til en evolutionær forklaring på den variation, der ses i lactosetolerans på verdensplan. Inddrag figur 3.

8 Side 7 af 8 sider Opgave 4. Biokonservering Bakterien Listeria monocytogenes kan forekomme i fødevarer, der opbevares ved køleskabstemperatur. Infektion med L. monocytogenes kan i værste fald medføre døden. Ved biokonservering udnyttes uskadelige bakterier der i forvejen er i produktet fx mælkesyrebakterier. Mælkesyrebakterier producerer bakteriociner. Bakteriocinet nisins virkning på cellemembranen hos L. monocytogenes er vist i figur 1. Nisin Membranmolekyle Figur 1. Nisins virkning på cellemembranen hos L. monocytogenes 1. Beskriv nisins virkning på cellemembranen hos L. monocytogenes. Inddrag figur 1.

9 Side 8 af 8 sider Man har undersøgt mælkesyrebakteriers indflydelse på væksten af L. monocytogenes i kødpålæg opbevaret ved 5 C. Ved eksperimentets begyndelse blev der tilsat 10 4 L. monocytogenes pr. gram kødpålæg. Det ene eksperiment blev yderligere tilsat 6,3 x 10 6 mælkesyrebakterier pr. gram kødpålæg. Resultaterne af eksperimentet fremgår af figur 2. Tid (døgn) L. monocytogenes (Gennemsnitligt antal kolonier pr. gram kødpålæg) Ingen tilsætning af mælkesyrebakterier Tilsætning af mælkesyrebakterier , , , , , , , , , , ,1 Antal kolonier 10 9 /gram 1,0 0,9 0,8 0,7 0,6 0,5 0,4 0,3 y = 23590e 0,3808x R2 = 0,9811 Ingen tilsætning af mælkesyrebakterier Tilsætning af mælkesyrebakterier 0,2 0,1 0,0 y = 5850e -0,281x R2 = 0,92-0, Figur 2. Resultaterne fra eksperimentet. Døgn 2. Vurder, om en eksponentiel vækstmodel er en god beskrivelse af resultaterne for forsøget uden tilsætning af mælkesyrebakterier. 3. Skitser hvordan du forventer bakterieantallet ville udvikle sig, hvis man fortsatte forsøget. Benyt bilag 1 og begrund dit svar. 4. Giv forslag til en evolutionær fordel, mælkesyrebakterier kan have af at producere bakteriociner. 5. Vurder, hvilke undersøgelser der bør foretages, inden der gives tilladelse til anvendelse af mælkesyrebakterier til biokonservering.


11 Kilder: Opgave 1: Biologi A, skriftligt studentereksamen 1998, opgavesæt 2, opgave 3 Opgave 2: Daugbjerg, N., Jensen, M.. & ansen, P.J.: Novel type of endosymbiont in Dinophyceae - Amphisolenia bidentata and its endosymbiont identified using gene sequences. 9th International Phycological Congress, Tokyo, Japan, 2-8 August Page 24 in abstract book. Foto: N. Daugbjerg Opgave 3: Jørgensen, Mikala Klok, Jørgen Thode, Bogi Davidsen, Christian Gerner & Lise Bathum: Diagnosticering af laktoseintolerans hos voksne. Ugeskrift for Læger 170/42, 2008, s Vestergaard, Else Marie, Jesper Troelsen og Aksel Lange: Gentest forenkler og forbedrer diagnostikken, Ugeskrift for læger nr 170/42, 13. okt Opgave 4: Budde, Birgitte Bjørn m.fl.: Leuconostoc carnosum 4010 has the potential for use as a protective culture for vacuumpacked meats: culture, isolation, bacteriocin identification, and meat application experiments. International. Journal of Food Microbiology 83, 2003, s Tegninger: MarkR grafik/ans Marker


13 STUDENTEREKSAMEN Vejledende opgavesæt 1 BILAG Ark af i alt ark Navn: Skole / kursus: Klasse: 1,10 x ,0 x 108 9,0 x 108 Ingen tilsætning af mælkesyrebakterier Antal kolonier/gram 8,0 x 108 7,0 x 108 6,0 x 108 5,0 x 108 4,0 x 108 3,0 x 108 2,0 x 108 1,0 x 108 0,0 Tilsætning af mælkesyrebakterier Døgn

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares stx112-bio/a-16082011 Tirsdag den 16. august 2011 kl. 9.00-14.00 Side 1 af 8 sider Opgave 1. Dyreplankton

Læs mere

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares 2stx111-BIO/A-27052011 Fredag den 27. maj 2011 kl. 9.00-14.00 Side 1 af 8 sider Opgave 1. Pig City På figur

Læs mere

Biologi A - Niveau. Torsdag d. 14. april Kl ud af 4 opgaver skal besvares

Biologi A - Niveau. Torsdag d. 14. april Kl ud af 4 opgaver skal besvares Biologi A - Niveau Torsdag d. 14. april 2016 Kl. 9.00 14.00 3 ud af 4 opgaver skal besvares Opgave I: CMT Sygdommen Charcot-Mane- looth (CMI) nedarves autosomalt dommant. Sygdommen findes i flere varianter.

Læs mere

Energistofskifte 04-01-04 Leif & Thorbjørn Kristensen Side 1 af 6

Energistofskifte 04-01-04 Leif & Thorbjørn Kristensen Side 1 af 6 Leif & Thorbjørn Kristensen Side 1 af 6 Energistofskifte De fleste af de processer, der sker i kroppen, skal bruge energi for at fungere. Kroppen skal således bruge en vis mængde energi for at holde sig

Læs mere

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b.

Opgave 1 Listeria. mørkviolette bakteriekolonier, se figur 1a. og b. 1. Angiv reaktionstypen for reaktion. 1 vist i figur 1b. Opgave 1 Listeria Bakterien Listeria monocytogenes kan være sygdomsfremkaldende for personer, der i forvejen er svækkede. For at identificere Listeria kan man anvende indikative agarplader. Her udnyttes

Læs mere

Elevens uni-login: Skolens navn: Tilsynsførendes underskrift: FP9. 9.-klasseprøven BIOLOGI

Elevens uni-login: Skolens navn: Tilsynsførendes underskrift: FP9. 9.-klasseprøven BIOLOGI Elevens uni-login: Skolens navn: Tilsynsførendes underskrift: FP9 9.-klasseprøven BIOLOGI Maj 2016 B1 Indledning Rejsen til Mars Det er blevet muligt at lave rumrejser til Mars. Muligheden for bosættelser

Læs mere

EKSAMENSOPGAVER. Eksamensopgaver uden bilag

EKSAMENSOPGAVER. Eksamensopgaver uden bilag EKSAMENSOPGAVER Eksamensopgaver uden bilag Eksaminator: Morten Sigby-Clausen (MSC) 1. Celler, fotosyntese og respiration 2. Den naturlige å og vandløbsforurening 3. Kost og ernæring 4. DNA og bioteknologi

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2001 kl

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2001 kl STUDENTEREKSAMEN AUGUST 2001 2001-6-2 BIOLOGI HØJT NIVEAU Mandag den 13. august 2001 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares.

Læs mere

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 19. august 2008. Kl. 09.00 14.00 STX082-BIA STUDENTEREKSAMEN AUGUST 2008 STUDENTEREKSAMEN AUGUST 2008 BIOLOGI A-NIVEAU Tirsdag den 19. august 2008 NY ORDNING Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX082-BIA Undervisningsministeriet

Læs mere

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares stx132-bio/a-27082013 Tirsdag den 27. august 2013 kl. 9.00-14.00 Side 1 af 8 sider Opgave 1. Den arvelige

Læs mere

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares.

Bioteknologi A. Studentereksamen. Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. Bioteknologi A Studentereksamen Af opgaverne 1 og 2 skal begge opgaver besvares. Af opgaverne 3 og 4 skal en og kun en af opgaverne besvares. frs111-btk/a-31052011 Tirsdag den 31. maj 2011 kl. 9.00-14.00

Læs mere

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares 2stx131-BIO/A-03062013 Mandag den 3. juni 2013 kl. 9.00-14.00 Side 1 af 8 sider Opgave 1. Pelsfarve hos ulve

Læs mere

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares 2stx101-BIO/A-28052010 Fredag den 28. maj 2010 kl. 9.00-14.00 Side 1 af 9 sider Opgave 1. Hormonforstyrrende

Læs mere

Organismer inddeles i tre fundamentale stofomsætningstyper:

Organismer inddeles i tre fundamentale stofomsætningstyper: Stofskiftetyper Organismer inddeles i tre fundamentale stofomsætningstyper: autotrofe organismer: organismer som opbygger organisk stof ved fotosyntese (eller i nogle tilfælde kemosyntese); de kræver foruden

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Vintereksamen 2014-15 Institution 414 Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold HF-e Biologi B

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Termin Maj-juni 2014-2015 Institution Favrskov Gymnasium Uddannelse Fag og niveau Lærer Hold stx Biologi C Jeppe Lund (JL) 2a bic Oversigt over gennemførte undervisningsforløb

Læs mere

Eksamensspørgsmål Biologi C maj-juni 2014 Sygeeksamen: 4cbicsy1

Eksamensspørgsmål Biologi C maj-juni 2014 Sygeeksamen: 4cbicsy1 Eksamensspørgsmål Biologi C maj-juni 2014 Sygeeksamen: 4cbicsy1 HF og VUC Nordsjælland. Helsingørafdelingen Lærer: Lisbet Heerfordt, Farumgårds Alle 11, 3520 Farum, tlf. 4495 8708, mail:

Læs mere

Undervisningsbeskrivelse for: 1bic14e 0813 Biologi C, HFE

Undervisningsbeskrivelse for: 1bic14e 0813 Biologi C, HFE Undervisningsbeskrivelse for: 1bic14e 0813 Biologi C, HFE Fag: Biologi C, HFE Niveau: C Institution: VUC Fredericia (607247) Hold: Biologi C enkeltfag Alle Termin: Juni 2014 Uddannelse: HF-enkeltfag Lærer(e):

Læs mere

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve

Bioteknologi A. Gymnasiale uddannelser. Vejledende opgavesæt 1. Mandag den 31. maj 2010 kl. 9.40-14.40. 5 timers skriftlig prøve Vejledende opgavesæt 1 Bioteknologi A Gymnasiale uddannelser 5 timers skriftlig prøve Vejledende opgavesæt 1 Mandag den 31. maj 2010 kl. 9.40-14.40 Side 1 af 8 sider pgave 1. Genmodificeret ris Vitamin

Læs mere

Eksamen: Biologi C-niveau 2a bi

Eksamen: Biologi C-niveau 2a bi Eksamen: Biologi C-niveau 2a bi Dato: 3.6.2015 Eksaminator: Carsten Sejer Christiansen Censor: Hans Christian Ihler Hold: 2a bi Elever: 8 Eksamensform: - Trækning af eksamensspørgsmål inkl. bilag - 24

Læs mere


Cellemembrantransportprocesser 1. Cellemembrantransportprocesser 1. En redegørelse for forskellige celletypers opbygning og de måder stoffer kan transporteres hen over cellemembranen. 2. En forklaring af hvordan en nerveimpuls opstår

Læs mere

Stofskiftets afhængighed af temperatur og aktivitet hos vekselvarme dyr

Stofskiftets afhængighed af temperatur og aktivitet hos vekselvarme dyr Stofskiftets afhængighed af temperatur og aktivitet hos vekselvarme dyr Besøget retter sig primært til elever med biologi på B eller A niveau Program for besøget Hvis besøget foretages af en hel klasse,

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin December 2015 Institution Vestegnen HF & VUC Uddannelse Fag og niveau Lærer Hold Hfe Biologi C, jf. bekendtgørelse

Læs mere

Opgave 2a.01 Cellers opbygning. Spørgsmålene her kan besvares ved at læse teksten Cellen livets byggesten

Opgave 2a.01 Cellers opbygning. Spørgsmålene her kan besvares ved at læse teksten Cellen livets byggesten Opgave 2a.01 Cellers opbygning Spørgsmålene her kan besvares ved at læse teksten Cellen livets byggesten Vakuole - Lager-rum med energi Grønkorn Cellekerne (DNA) Cellemembran Cellevæg Mitokondrier 1. Hvad

Læs mere

Eksamensspørgsmål uden bilag - 2b bi 2013

Eksamensspørgsmål uden bilag - 2b bi 2013 Eksamen: Biologi C-niveau Eksaminator: Tonje Kjærgaard Petersen Censor: Jørgen B. Bech Elever: 3 Eksamensform: - Spørgsmål trækkes - 24 min. forberedelse - 24 min. eksamination Spørgsmål 1: Spørgsmål 2:

Læs mere

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 20. maj 2008. Kl. 09.00 14.00 STX081-BIA STUDENTEREKSAMEN MAJ 2008

BIOLOGI A-NIVEAU NY ORDNING. Tirsdag den 20. maj 2008. Kl. 09.00 14.00 STX081-BIA STUDENTEREKSAMEN MAJ 2008 STUDENTEREKSAMEN MAJ 2008 BIOLOGI A-NIVEAU Tirsdag den 20. maj 2008 NY ORDNING Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX081-BIA Undervisningsministeriet Side

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2015 Institution Voksenuddannelsescenter Frederiksberg Uddannelse Fag og niveau Lærer(e) Hold STX

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 206 Institution Fredericia VUC Uddannelse Fag og niveau Lærer(e) Hold Hf Biologi C Thomas Nielsen

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Sommereksamen 2015 Institution 414 Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold HFe Biologi B Torben

Læs mere

Eksamen: Biologi C-niveau

Eksamen: Biologi C-niveau Eksamen: Biologi C-niveau Eksaminator: Tonje Kjærgaard Petersen Censor: Peter Kusk Mott Elever: 2 Eksamensform: - Trækning af eksamensspørgsmål inkl. bilag - 24 min. forberedelse - 24 min. Eksamination

Læs mere

Folkeskolens afgangsprøve August 2007 Biologi Facitliste

Folkeskolens afgangsprøve August 2007 Biologi Facitliste Folkeskolens afgangsprøve August 2007 1/23 B5 Indledning Den danske skov Ca. 12 % af Danmarks areal er dækket af skov. Det mest almindelige skovtræ er rødgran. Det skyldes, at de danske skove er produktionsskove,

Læs mere

Folkeskolens afgangsprøve Maj 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B3

Folkeskolens afgangsprøve Maj 2012. Biologi. Elevnavn: Elevnummer: Skole: Hold: 1/22 B3 Folkeskolens afgangsprøve Maj 2012 B3 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B3 afgangsprøver maj 2012 Sæt 3 Levende organismers udvikling og livsytringer

Læs mere

Eksamen: Biologi C-niveau

Eksamen: Biologi C-niveau Eksamen: Biologi C-niveau Eksaminator: Carsten Sejer Christiansen Censor: Boline Albæk Ravn Elever: 2 Eksamensform: - Trækning af eksamensspørgsmål inkl. bilag - 24 min. forberedelse - 24 min. Eksamination

Læs mere

Velkommen. Probiotika og Præbiotika. Undervisningsdag på DTU Systembiologi. Undervisere: Sandra og Sebastian Wingaard Thrane

Velkommen. Probiotika og Præbiotika. Undervisningsdag på DTU Systembiologi. Undervisere: Sandra og Sebastian Wingaard Thrane Velkommen Probiotika og Præbiotika Undervisningsdag på DTU Systembiologi Undervisere: Sandra og Sebastian Wingaard Thrane Hvem er vi? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvem er I? 3 DTU

Læs mere

Fotosyntese og respiration

Fotosyntese og respiration Biologi Fotosyntese og respiration Kasper Angelo, Klasse 1.3, HTX Roskilde 16/12 2007 Formål Der uføres og analyseres nogle forsøg der kan besvare: Forbruger en grøn plante kuldioxid (CO 2), når den udsættes

Læs mere

BIOLOGI HØJT NIVEAU. Tirsdag den 15. maj 2001 kl. 9.00-14.00

BIOLOGI HØJT NIVEAU. Tirsdag den 15. maj 2001 kl. 9.00-14.00 STUDENTEREKSAMEN MAJ 2001 2001-6-1 BIOLOGI HØJT NIVEAU Tirsdag den 15. maj 2001 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5, 6 og 7 må kun to besvares.

Læs mere

Svarark for (navn) Skole: Opgave 22 besvares DIREKTE her i opgaven.

Svarark for (navn) Skole: Opgave 22 besvares DIREKTE her i opgaven. Opgave 22 besvares DIREKTE her i opgaven. 22. Den røde farve i kød skyldes myoglobin som er et globulært protein. Myoglobin indeholder ligesom hæmoglobin en organisk gruppe (hæm) med en tilknyttet jern(ii)-ion

Læs mere

1. Lactase tilhører enzymklassen hydrolase

1. Lactase tilhører enzymklassen hydrolase Arvelig immundefekt a. Immundefekt skyldes en arvelig gendefekt eller mutation i generne. Det kan ramme begge køn, som et slags usynligt handicap, og kan, hvis det ikke bliver behandlet, være dødeligt.

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin August-December 2014 Institution Vestegnens hf og VUC Uddannelse Fag og niveau Lærer(e) Hold Hfe Biologi C

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2007 kl

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2007 kl TUDENTEREKAMEN AUGUT 2007 2007-6-2 BILGI ØJT NIVEAU Mandag den 13. august 2007 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares. TRE

Læs mere

BIOLOGI HØJT NIVEAU. Onsdag den 10. maj 2000 kl. 9.00-14.00

BIOLOGI HØJT NIVEAU. Onsdag den 10. maj 2000 kl. 9.00-14.00 STUDENTEREKSAMEN MAJ 2000 2000-6-1 BIOLOGI HØJT NIVEAU Onsdag den 10. maj 2000 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5, 6 og 7 må kun to besvares. STORE

Læs mere

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod.

Til denne udfordring kan du eksperimentere med forsøg 4.2 i kemilokalet. Forsøg 4.2 handler om kuliltens påvirkning af kroppens blod. Gå op i røg Hvilke konsekvenser har rygning? Udfordringen Denne udfordring handler om nogle af de skader, der sker på kroppen, hvis man ryger. Du kan arbejde med, hvordan kulilten fra cigaretter påvirker

Læs mere

FP9 BIOLOGI. Elevnavn: Elevnummer: Skole: Hold: 1/22 B2. 9.-klasseprøven. December 2015

FP9 BIOLOGI. Elevnavn: Elevnummer: Skole: Hold: 1/22 B2. 9.-klasseprøven. December 2015 FP9 9.-klasseprøven BIOLOGI December 2015 B2 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B2 Indledning Menneskets krop og sundhed Gennem millioner af år har

Læs mere

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste Folkeskolens afgangsprøve Maj 2007 1/23 B3 Indledning Livsbetingelser og global opvarmning Klimaet på Jorden er under forandring. De mange menneskelige aktiviteter påvirker efterhånden temperaturen i et

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Termin Institution Uddannelse Fag og niveau Lærer(e) Hold Termin hvori undervisningen afsluttes Maj-juni 2010 Teknisk Gymnasium Grenaa HTX-student Biologi C Ejner Læsøe Madsen

Læs mere


HVAD GØR RØGEN VED KROPPEN? 42 www.op-i-rø GÅ OP I RØG Kræftens Bekæmpelse KAPITEL 5: HVAD GØR RØGEN VED KROPPEN? www.op-i-rø 43 Kapitel 5: Indhold Dette kapitel tager udgangspunkt i, hvad der sker med røgen i kroppen på

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2015/2016, eksamen dec/jan 2015 Institution VUC Vest Uddannelse Fag og niveau Lærer(e) Hold Hfe

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-Jun 2010 Institution Sukkertoppen Uddannelse Fag og niveau Lærer(e) Hold htx Biologi B Thomas Haack Den

Læs mere

Projekt 4.2. Nedbrydning af rusmidler

Projekt 4.2. Nedbrydning af rusmidler Projekt 4.2. Nedbrydning af rusmidler Dette projekt lægger op til et samarbejde med biologi eller idræt, men kan også gennemføres som et projekt i matematik, hvor fokus er at studere forskellen på lineære

Læs mere

Læseplan for faget biologi

Læseplan for faget biologi Læseplan for faget biologi Undervisningen i biologi bygger bl.a. på de kundskaber og færdigheder, som eleverne har erhvervet sig i natur/teknik. De centrale kundskabs- og færdighedsområder er: De levende

Læs mere

Eksamensspørgsmål Biologi C - sygeeksamen den 19. december 2013 Hold: 3bbicfh2

Eksamensspørgsmål Biologi C - sygeeksamen den 19. december 2013 Hold: 3bbicfh2 Eksamensspørgsmål Biologi C - sygeeksamen den 19. december 2013 Hold: 3bbicfh2 HF og VUC Nordsjælland. Hillerødafdelingen Lærer: Lisbet Heerfordt, Farumgårds Alle 11, 3520 Farum, tlf. 4495 8708, mail:

Læs mere

FP9 BIOLOGI. Elevnavn: Elevnummer: Skole: Hold: 1/22 B1. 9.-klasseprøven. Maj 2015 B1

FP9 BIOLOGI. Elevnavn: Elevnummer: Skole: Hold: 1/22 B1. 9.-klasseprøven. Maj 2015 B1 FP9 9.-klasseprøven BIOLOGI Maj 2015 B1 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/22 B1 Indledning Mennesket - krop og sundhed Mennesket er tilpasset livet på

Læs mere

Biokonservering af koldrøget laks

Biokonservering af koldrøget laks Af Lilian Nilsson og Lone Gram Afdeling for Fiskeindustriel Forskning, Danmarks Fiskeriundersøgelser Biokonservering af koldrøget laks - hvordan man forhindrer vækst af Listeria i fiskeprodukter er en

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2014/2015, eksamen maj/juni 2015 Institution Kolding HF & VUC Uddannelse Fag og niveau Lærer(e)

Læs mere

RTG. Algers vækst. Louise Regitze Skotte Andersen, klasse 1.4. Vejleder: Anja Bochart. Biologi. 28-05-2008

RTG. Algers vækst. Louise Regitze Skotte Andersen, klasse 1.4. Vejleder: Anja Bochart. Biologi. 28-05-2008 RTG Algers vækst Louise Regitze Skotte Andersen, klasse 1.4 Vejleder: Anja Bochart. Biologi. 28-05-2008 2 Algers vækst Indhold Indledning... 3 Materialer... 3 Metode... 3 Teori... 4 Hvad er alger?... 4

Læs mere

Sundheds CVU Nordjylland INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00

Sundheds CVU Nordjylland INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00 INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00 ANATOMI OG FYSIOLOGI Opgave 1 Den menneskelige organisme er opbygget af celler. a. Beskriv cellens opbygning, heri skal

Læs mere


STUDENTEREKSAMEN AUGUST-SEPTEMBER 2005 SPROGLIG LINJE NATURFAG. Fredag den 12. august 2005 kl. 9.00-13.00 2005-17-2 STUDENTEREKSAMEN AUGUST-SEPTEMBER 2005 SPROGLIG LINJE NATURFAG Fredag den 12. august 2005 kl. 9.00-13.00 Opgavesættet består af 8 opgaver med tilsammen 20 spørgsmål. De stillede spørgsmål indgår

Læs mere

Spørgsmål nr. 1. Fedme. Spørgsmål nr.2. Sukker som brændstof. Spørgsmål 3. Søens onde cirkel

Spørgsmål nr. 1. Fedme. Spørgsmål nr.2. Sukker som brændstof. Spørgsmål 3. Søens onde cirkel Spørgsmål nr. 1 Fedme skal du analysere fordøjelsessystemets form og funktion med fokus på fordøjelse af fedt. Nævnt kort relevante metoder som bruges til undersøgelse af fedme. Endeligt skal du redegøre

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 9. august 2004 kl

BIOLOGI HØJT NIVEAU. Mandag den 9. august 2004 kl STUDENTEREKSAMEN AUGUST 2004 2004-6-2 BIOLOGI HØJT NIVEAU Mandag den 9. august 2004 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares.

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2016/2017, eksamen december 2016 Institution Kolding HF & VUC Uddannelse Fag og niveau Lærer(e)

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2016 Institution København Syd Hf og VUC Uddannelse Fag og niveau Lærer(e) Hold Hfe Biologi niveau

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Dec 2015 Institution Uddannelse Fag og niveau Lærer(e) Hold VUC Lyngby Hfe (e-learning) Biologi B Bjarne Sveegaard

Læs mere

Undervisningsbeskrivelse. Termin maj-juni 14/15. Uddannelse. Inger Klit Schierup (IS) Oversigt over gennemførte undervisningsforløb

Undervisningsbeskrivelse. Termin maj-juni 14/15. Uddannelse. Inger Klit Schierup (IS) Oversigt over gennemførte undervisningsforløb Undervisningsbeskrivelse Termin maj-juni 14/15 Institution Favrskov Gymnasium Uddannelse Fag og niveau Lærer Hold stx Biologi B Inger Klit Schierup (IS) 3biB2 Oversigt over gennemførte undervisningsforløb

Læs mere

1. Planter. 1. Gør rede for eukaryote cellers opbygning og for funktionen af de forskellige dele. Beskriv forskellene på dyre- og planteceller.

1. Planter. 1. Gør rede for eukaryote cellers opbygning og for funktionen af de forskellige dele. Beskriv forskellene på dyre- og planteceller. 1. Planter 1. Gør rede for eukaryote cellers opbygning og for funktionen af de forskellige dele. Beskriv forskellene på dyre- og planteceller. 2. Beskriver plantecellens vigtige processer som fotosyntese

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 207 Institution Fredericia VUC Uddannelse Fag og niveau Lærer(e) Hold Hf Biologi C Thomas Nielsen

Læs mere

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste

Folkeskolens afgangsprøve Maj 2007 Biologi - facitliste Folkeskolens afgangsprøve Maj 2007 1/23 B4 Indledning Ozon, temperaturstigning og levende organismer Mennesker og andre levende organismer er meget afhængige af de vilkår, som hersker på Jorden. I de seneste

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin December/januar 13-14 Institution Vestegnen HF VUC Albertslund og Rødovre Uddannelse Fag og niveau Lærer(e)

Læs mere

Undervisningsbeskrivelse for: 13BI0C21 E13 Biologi C, HFE

Undervisningsbeskrivelse for: 13BI0C21 E13 Biologi C, HFE Undervisningsbeskrivelse for: 13BI0C21 E13 Biologi C, HFE Fag: Biologi C, HFE Niveau: C Institution: VUC Vest, Esbjerg (561247) Hold: BI13 Biologi C HF Termin: Juni 2014 Uddannelse: HF-enkeltfag Lærer(e):

Læs mere

Jordens historie er inddelt i fire æoner: Hadal, Arkæikum, Protozoikum, Phanerozoikum

Jordens historie er inddelt i fire æoner: Hadal, Arkæikum, Protozoikum, Phanerozoikum Livets udvikling Teori: Solsystemet dannedes for 4,6 mia. år siden Ældste sten på jorden: 4 mia. år gamle Livets alder Mikrofossiler - ældste spor af liv - 3,4 mia. år siden Livet kan være opstået for

Læs mere

Folkeskolens afgangsprøve Maj-juni 2006 Biologi - Facitliste

Folkeskolens afgangsprøve Maj-juni 2006 Biologi - Facitliste Folkeskolens afgangsprøve Maj-juni 2006 1/25 B5 Indledning Mange mennesker har køkkenhave, hvor de dyrker forskellige grøntsager. Nogle har også et drivhus i haven. På den måde kan man i sommerhalvåret

Læs mere

Højere Teknisk Eksamen maj Kemi A. - løse opgaverne korrekt. - tegne og aflæse grafer. Ved bedømmelsen vægtes alle opgaver ens.

Højere Teknisk Eksamen maj Kemi A. - løse opgaverne korrekt. - tegne og aflæse grafer. Ved bedømmelsen vægtes alle opgaver ens. 054129 18/05/06 12:21 Side 1 Højere Teknisk Eksamen maj 2006 Kemi A Ved bedømmelsen lægges der vægt på eksaminandens evne til at - løse opgaverne korrekt - begrunde løsningerne med relevante beregninger,

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Termin maj-juni 2014/2015 Institution Favrskov Gymnasium Uddannelse Fag og niveau Lærer Hold stx Biologi C Jeppe Lund (JL) 2.b bic Oversigt over gennemførte undervisningsforløb

Læs mere

Udbytteberegning ved fermentering

Udbytteberegning ved fermentering Bioteknologi 2, Tema 3 Opgave 6 Udbytteberegning ved fermentering Opgaven bygger videre på Bioteknologi 2, side 11-18. Ved fermenteringsprocesser er det af stor teknisk og økonomisk betydning

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Institution Uddannelse Fag og niveau Lærer(e) Hold Termin hvori undervisningen afsluttes: maj-juni 2015 Marie

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin maj-juni 2012 Institution VUC Vejle Uddannelse Fag og niveau Lærer Hold Hfe Biologi C Odd Frederiksen biocu

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin maj-juni, 2015-2016 Institution Uddannelse Fag og niveau Lærer Hold Horsens HF og VUC Hfe Biologi C Mette

Læs mere

1. Kost og fordøjelse

1. Kost og fordøjelse 1. Kost og fordøjelse - Gøre rede for kostens bestanddele og give en oversigt over de enkelte bestanddeles opgaver i kroppen. - Gennemgå fordøjelsessystemets opbygning og beskrive fordøjelsen af kulhydratet

Læs mere

Med udgangspunkt i det vedlagte materiale og eventuelt eksperimentelt arbejde skal du forberede en fremlæggelse.

Med udgangspunkt i det vedlagte materiale og eventuelt eksperimentelt arbejde skal du forberede en fremlæggelse. 1. Primærproducenter og fotosyntese Med udgangspunkt i det vedlagte materiale og eventuelt eksperimentelt arbejde skal du forberede en Din fremlæggelse skal blandt andet indeholde: En analyse og diskussion

Læs mere

Ernæring, fordøjelse og kroppen

Ernæring, fordøjelse og kroppen Ernæring, fordøjelse og kroppen Modul 4 Kernestof a) Kost & fordøjelse b) Kroppens opbygning & motion Mål med modulet Ernæring og fordøjelse At give kursisten vished om næringsstoffers energiindhold, herunder

Læs mere

Eksponentielle sammenhænge

Eksponentielle sammenhænge Eksponentielle sammenhænge Udgave 009 Karsten Juul Dette hæfte er en fortsættelse af hæftet "Lineære sammenhænge, udgave 009" Indhold 1 Eksponentielle sammenhænge, ligning og graf 1 Procent 7 3 Hvad fortæller

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Januar 2016 Institution VUC Hvidovre-Amager Uddannelse Fag og niveau Lærer(e) Hold Hfe Biologi C Stig Haas

Læs mere

Eksamen: Biologi B-niveau

Eksamen: Biologi B-niveau Eksamen: Biologi B-niveau Fredag den 7. juni på Ikast-Brande Gymnasium Eksaminator: Tonje Kjærgaard Petersen Censor: Karen Seierøe Barfod Elever: 12 Eksamensform: - Opgaven trækkes minimum 24 timer før

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Sommereksamen 2015 Institution HF VUC Thy-Mors Uddannelse Fag og niveau Lærer(e) Hold hfe Biologi C Karsten

Læs mere

Undervisningen på trin 1 skal lede frem mod at eleverne har tilegnet sig kundskaber og færdigheder der sætter dem i stand til at :

Undervisningen på trin 1 skal lede frem mod at eleverne har tilegnet sig kundskaber og færdigheder der sætter dem i stand til at : Biologi I biologi arbejder eleverne med naturen i al dens mangfoldighed. Dyr, planter, svampe, mennesker og samspillet herimellem udgør fagets arbejdsområder. Praktiske og undersøgende aktiviteter, hvor

Læs mere

Elevnavn: Elevnummer: Skole: Hold:

Elevnavn: Elevnummer: Skole: Hold: Folkeskolens afgangsprøve Maj 2011 Elevnavn: Elevnummer: Skole: Hold: Elevens underskrift Tilsynsførendes underskrift 1/23 B3 Indledning Bioteknologi Teknikker som for eksempel gensplejsning anvendes i

Læs mere

Opgave 1. EPO og bloddoping

Opgave 1. EPO og bloddoping Side 1 af 8 sider Opgave 1. EPO og bloddoping Nogle sportsfolk snyder ved at få tilført hormonet erythropoietin, EPO, eller røde blodceller (bloddoping) før en konkurrence, fordi det øger præstationsevnen.

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Januar 2017 Institution KBH SYD, HF & VUC, Hvidovre afd. Uddannelse Fag og niveau Lærer(e) Hold Hfe Biologi

Læs mere

Probiotika i akvakultur en strategi til forebyggelse af fiskesygdom

Probiotika i akvakultur en strategi til forebyggelse af fiskesygdom Bettina Spanggaard & Lone Gram Danmarks Fiskeriundersøgelser, Afdeling for Fiskeindustriel Forskning Probiotika i akvakultur en strategi til forebyggelse af fiskesygdom Sygdom hos fisk i opdræt behandles

Læs mere

Genetisk drift og naturlig selektion

Genetisk drift og naturlig selektion Genetisk drift og naturlig selektion Denne vejledning indeholder en gennemgang af simulationsværktøjer tilgængeligt online. Værktøjerne kan bruges til at undersøge effekten af populationsstørrelse på genetisk

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2016 Institution Herning HF og VUC Uddannelse Fag og niveau Lærer(e) Hold hfe Biologi C Morten Sigby-Clausen

Læs mere

SPEKTRUM HALSE WÜRTZ FYSIK C. Fysiks optakt til et AST-forløb om kroppen af Niels Henrik Würtz. Energiomsætninger i kroppen

SPEKTRUM HALSE WÜRTZ FYSIK C. Fysiks optakt til et AST-forløb om kroppen af Niels Henrik Würtz. Energiomsætninger i kroppen HALSE WÜRTZ SPEKTRUM FYSIK C Fysiks optakt til et AST-forløb om kroppen af Niels Henrik Würtz Energiomsætninger i kroppen Kondital Glukoseforbrænding Fedtforbrænding Artiklen her knytter sig til kapitel

Læs mere

BIOLOGI A. Torsdag den 14. maj 2009. Kl. 09.00 14.00 STX091-BIA STUDENTEREKSAMEN MAJ 2009

BIOLOGI A. Torsdag den 14. maj 2009. Kl. 09.00 14.00 STX091-BIA STUDENTEREKSAMEN MAJ 2009 STUDENTEREKSAMEN MAJ 2009 BILGI A Torsdag den 14. maj 2009 Kl. 09.00 14.00 Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares STX091-BIA Undervisningsministeriet Side 1 af 8 sider pgave

Læs mere

Biologisk rensning Fjern opløst organisk stof fra vand

Biologisk rensning Fjern opløst organisk stof fra vand Øvelse E Biologisk rensning Fjern opløst organisk stof fra vand Formål: På renseanlægget renses spildevandet mekanisk, biologisk og kemisk. I den biologiske rensning på renseanlægget benyttes mikroorganismer

Læs mere

gl. Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

gl. Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares gl. Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares gl-1stx131-bio/a-30052013 Torsdag den 30. maj 2013 kl. 9.00-14.00 Side 1 af 8 sider Opgave 1. Alger til

Læs mere


BIOLOGI B-NIVEAU - SPØRGSMÅL 1 BIOLOGI B-NIVEAU - SPØRGSMÅL 1 Kvælstof, fosfor og vandmiljøplaner Gør kort rede for kvælstof og fosfors kredsløb i naturen - og kom ind på følgerne ved udledning af næringssalte til vandmiljøet. Med udgangspunkt

Læs mere

Cola, kost og sukkersyge

Cola, kost og sukkersyge Cola, kost og sukkersyge Naturfagsprojekt 2, december 2010 Side 1 af 8 Indledning: Med denne synopsis vil vi forklare kostens indhold af kulhydrater og hvad der sker med dem i fordøjelsessystemet. Vi vil

Læs mere

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares. Vejledende opgavesæt 3

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares. Vejledende opgavesæt 3 Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Vejledende opgavesæt 3 Efterår 2012 Side 1 af 8 sider Opgave 1. Muskelsvind hos labradorhunde CNM (centronuclear

Læs mere

Eksamensspørgsmål Biologi C e-learning Sommeren 2014 Hold: 3cbicel1

Eksamensspørgsmål Biologi C e-learning Sommeren 2014 Hold: 3cbicel1 Eksamensspørgsmål Biologi C e-learning Sommeren 2014 Hold: 3cbicel1 NB! Hvis censor ønsker det, kan der komme ændringer i eksamensspørgsmålene. Eventuelle ændringer vil blive offentliggjort i holdets Fronter

Læs mere


Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Vintereksamen 2014 Institution Københavns VUC Uddannelse Fag og niveau Lærer(e) Hold hfe Biologi C Marie Gottschalk

Læs mere

Vejledende besvarelse

Vejledende besvarelse Ib Michelsen Svar: stx B 29. maj 2013 Side 1 1. Udfyld tabellen Vejledende besvarelse Givet funktionen f (x)=4 5 x beregnes f(2) f (2)=4 5 2 =4 25=100 Den udfyldte tabel er derfor: x 0 1 2 f(x) 4 20 100

Læs mere