Role of Epigenetic Regulation by the REST/CoREST/HDAC Corepressor Complex of Moderate NANOG Expression in Chicken Primordial Germ Cells
|
|
- Henrik Bundgaard
- 4 år siden
- Visninger:
Transkript
1 STEM CELLS AND DEVELOPMENT Volume 27, Number 17, 2018 Ó Mary Ann Liebert, Inc. DOI: /scd Role of Epigenetic Regulation by the REST/CoREST/HDAC Corepressor Complex of Moderate NANOG Expression in Chicken Primordial Germ Cells Hyun Gyo Jung,* Young Sun Hwang,* Young Hyun Park, Ho Yeon Cho, Deivendran Rengaraj, and Jae Yong Han Primordial germ cells (PGCs), the precursors of gametes, have regulatory mechanisms involving transcription factors and epigenetic modifications. The transcription factor NANOG is a key regulator of germ cell and embryonic stem cell characteristics. However, the epigenetic regulation of NANOG with a histone deacetylase (HDAC) complex in PGCs has not been studied. In this study, we investigated the epigenetic regulation, and in particular the histone acetylation, of NANOG in chicken PGCs. Intriguingly, although NANOG was highly activated in chicken PGCs, the upstream region of its promoter was moderately suppressed by histone deacetylation. HDAC inhibition induced histone H3 lysine 9 acetylation (H3K9ac) and derepressed NANOG expression. Furthermore, knockdown studies revealed that HDAC complex members, such as RE1-silencing transcription factor (REST) and REST corepressor 3 (RCOR3), are important epigenetic modulators of NANOG expression in chicken PGCs. We demonstrate that moderate regulation of NANOG by the REST/CoREST/HDAC complex might be crucial for maintaining the integrity of PGCs. Keywords: chicken, primordial germ cells, NANOG, RE1-silencing transcription factor, REST corepressor, histone deacetylation Introduction Primordial germ cells (PGCs) are the precursors of sperm and oocytes, which are the only cells that transmit genetic information to the next generation. PGCs undergo epigenetic dynamics during embryogenesis to establish cellular specification and suppress somatic lineage differentiation [1]. The epigenetic status of PGCs is regulated by DNA methylation and histone modifications (histone acetylation or deacetylation), which have roles in regulating the expression of genes related to pluripotency and germness [2]. Specifically, histone H3 lysine 9 acetylation (H3K9ac) transiently and markedly increases in PGCs to establish transcriptional activation of chromatin at the point of entry into the genital ridge and decreases during colonization [3]. Also, maintenance of H3K9ac is involved in proper chromosomal segregation during the formation of gametes [4,5]. Thus, histone acetylation is a crucial epigenetic marker of germ cell specification and development. Avian PGCs are important for biotechnology and germ cell biology due to their unique characteristics [6]. Chicken PGCs are specified by maternally inherited germ plasm, including VASA and deleted in azoospermia like (DAZL), in a predetermined manner [7,8]. In contrast with mammals, chicken PGCs migrate to the genital ridge through blood vessels after specification [9]. In terms of epigenetic regulation, the dynamics and landscape of histone modification have not been established yet in avian PGCs. In recent study, global enrichment of H3K9 trimethylation (H3K9me3) was observed in chicken PGCs [10]. Also, H3K9ac formed foci in euchromatin in chicken PGCs as the activating histone acetylation marker [10], indicating this mark could play an important role in epigenetic regulation in chicken PGCs. However, gene expression regulation by histone modification in chicken PGCs has been largely unknown. NANOG is an important transcription factor that regulates pluripotency in early embryos, embryonic stem cells (ESCs), and induced pluripotent stem cells (ipscs) [11]. In mammals, NANOG expression was also found from migrating germ cells to gonadal germ cells [12,13], and shown to prevent apoptosis of migrating germ cells [14]. Moreover, in later stage, NANOG is involved in differentiation and maturation of mouse PGCs in genital ridge [15 17]. In chicken, NANOG is required for the maintenance of pluripotency in chicken ESCs [18] and was Department of Agricultural Biotechnology, Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul, Korea. *These authors contributed equally to this work. 1215
2 1216 JUNG ET AL. detected during early embryonic development from preovulatory oocyte to intrauterine stages [19]. Also, Jak1/Stat3 signaling supports NANOG expression and pluripotency in early chicken embryos [20]. In chicken PGCs, NANOG is expressed in the germinal crescent at Hamburger and Hamilton stage 5 (HH5) to HH8 [21]. In addition, NANOG expression was similar to the PGC-specific genes CVH and dead end homolog 1 (DND1) during PGC migration and colonization in gonads [21], indicating a role for NANOG in maintaining the self-renewal ability of chicken PGCs in various stages. The recent report showed that NANOG solely activated enhancers upstream of germ cell specifiers to generate PGC-like cells from epiblast-like cells, but not in ESCs in mouse [22], indicating that its function differs according to cell type. The role of histone acetylation and regulation of the histone deacetylase (HDAC) complex in pluripotency and somatic cell reprogramming in ESCs and ipscs has been reported [23 25]. Despite the emerging role of NANOG in germ cell development, the role of histone acetylation and the HDAC complex in the regulation of NANOG expression in avian PGCs is unclear. In this study, we demonstrated the epigenetic regulation of NANOG expression by H3K9ac and the HDAC corepressor complex in chicken PGCs. We used an HDAC inhibitor to induce aberrant histone acetylation and evaluated the expression of germ cell-specific genes, including NANOG. In addition, upstream regulators of NANOG, such as DNAdependent factors and HDAC complexes, were examined to evaluate epigenetic regulation in chicken PGCs. This study increases our understanding of the molecular mechanisms involved in the fundamental specification of germ cells. Materials and Methods Experimental animals and care The care and experimental use of White Leghorn (WL) chickens were approved by the Institute of Laboratory Animal Resources, Seoul National University (SNU ). Chickens were maintained according to a standard management program at the University Animal Farm, Seoul National University, Korea. The procedures for animal management, reproduction, and embryo manipulation adhered to the standard operating protocols of our laboratory. Culture of chicken PGCs and chemical treatment Chicken PGCs were cultured in accordance with our standard procedure [26,27]. Briefly, PGCs from male WL embryonic gonads at 6 days old (HH stage 28) were maintained in knockout Dulbecco s modified Eagle s medium (DMEM; Gibco, Grand Island, NY) supplemented with 20% fetal bovine serum (FBS; Hyclone, South Logan, UT), 2% chicken serum (Sigma-Aldrich, St. Louis, MO), 1 nucleosides (Millipore, Billerica, MA), 2 mm L-glutamine (Gibco), 1 nonessential amino acids (Gibco), b-mercaptoethanol (Gibco), 1 mm sodium pyruvate (Gibco), and 1 antibiotic/antimycotic (Gibco). Human basic fibroblast growth factor (Koma Biotech, Seoul, Korea) at 10 ng/ml was used for PGC self-renewal. The cultured PGCs were subcultured onto mitomycin-inactivated mouse embryonic fibroblasts at 5- to 6-day intervals by gentle pipetting without any enzyme treatment. DF-1 was cultured in DMEM (Gibco) supplemented with 10% FBS. The cultured PGCs and DF-1 were treated with HDAC inhibitors, 0.25 mm valproic acid (VPA; Sigma-Aldrich), and 50 nm romidepsin (Selleckchem, Boston, MA), for three consecutive days. Immunostaining VPA- and romidepsin-treated cells were harvested and washed twice in phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde for 20 min. After permeabilization with 0.1% Tween-20 and 1% Triton X-100, nonspecific binding was blocked with 1% normal goat serum. Cells were then incubated with rabbit anti-acetyl-histone H3K9 antibody (06-942; Millipore, Bedford, MA), mouse anti-acetyl-histone H3 lysine 27 (H3K27ac) antibody (GTX50903; GeneTex, CA), rabbit antitrimethyl-histone H3K9 antibody (07-442; Millipore), and rabbit anti-trimethyl-histone H3K27 (H3K27me3) (07-449, Millipore) at 4 C overnight. Cells incubated in the absence of primary antibody were used as a negative control. After extensive washing, cells were incubated with Alexa Fluor 594-conjugated goat anti-rabbit IgG H&L (ab150080; Abcam, Cambridge, United Kingdom), Alexa Fluor 488-conjugated goat antirabbit IgG H&L (ab150077; Abcam), and FITC-conjugated goat anti-mouse IgG (sc-2010; Santa Cruz, CA) for 1 h. After washing, cells were mounted with 4,6-diamidino-2- phenylindole (DAPI) and visualized using Ti-U fluorescence microscope (Nikon, Tokyo, Japan). RNA isolation and reverse transcription-quantitative polymerase chain reaction Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer s protocol. One microgram of total RNA from each sample was reversetranscribed using the Superscript III First-strand Synthesis System (Invitrogen) according to the manufacturer s protocol. The polymerase chain reaction (PCR) mixture contained 2 ml of PCR buffer, 0.5 ml of 10 mm dntp mixture, 10 pmole each of forward and reverse primers (Table 1), 1 ml of complementary DNA (cdna), and 1 U of Taq DNA polymerase in a 20 ml final volume. PCR amplification involved an initial incubation at 95 C for 10 min, followed by 40 cycles at 95 C for 30 s, 60 C for 30 s, and 72 C for 30 s. PCR was terminated with a final incubation at 72 C for 5 min, and at the dissociation temperature. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed using a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA) with EvaGreen (Biotium, Hayward, CA). Each test sample was assayed in triplicate. Relative quantification of target gene expression was performed using the following formula: 2 -DDCt,whereDDCt = (Ct of the target gene - (Ct of GAPDH + Ct of ACTB)/2) treatment - (Ct of the target gene - (Ct of GAPDH + Ct of ACTB)/2) control. Histone extraction and western blot analysis Cells were harvested and washed in ice-cold PBS for two times. Harvested cells were resuspended in Triton extraction buffer [TEB; PBS containing 0.5% Triton 100 (v/v), 2 mm phenylmethylsulfonyl fluoride, 0.02% (w/v) NaN3]. PBS and TEB contain 5 mm sodium butyrate to preserve levels of histone acetylation. After harvest of cell pellets, the nuclear pellets were extracted with 0.2 N HCl for overnight at
3 THE MODERATE EXPRESSION OF NANOG IN CHICKEN PGCS 1217 Table 1. Primers Used for Reverse Transcription-Quantitative Polymerase Chain Reaction Gene symbol Description Accession no. Primer sequence (5 / 3 ) NANOG Nanog homeobox NM_ F: AACTCTGCGGGGCTGTCTTG R: AAAAGTGGGGCGGTGAGATG POUV/POU5F3 POU domain class 5 transcription factor 3 NM_ F: TGAAGGGAACGCTGGAGAGC R: ATGTCACTGGGATGGGCAGAC VASA Chicken VASA homolog NM_ F: CCTTGCAGCCTTTCTTTGTC R: ACGACCAGTTCGTCCAATTC DAZL Deleted in azoospermia like NM_ F: CAACTATCAGGCTCCACCAC R: CTCAGACGGTTTTCAGGGTT BRACHYURY T brachyury transcription factor NM_ F: ACGCCATGTACTCCTTCCTG R: TGTTGGTGAGCTTGACCTTG GSC Goosecoid homeobox NM_ F: AACGGAGCTGCAGTTACTCAA R: TTCCATTTCTGTGCATTTTCC SOX7 SRY (sex determining region Y)- box 7 XM_ F: CTGGGAGAGATGGACCGTAA R: CCTTCCTCAGCAGGTCTACG GATA4 GATA-binding protein 4 NM_ F: ACCAGTCAGCCATCAGCCAG R: AGAGCAGGGGAGGAGGGAAA SOX3 SRY (sex determining region Y)- box 3 NM_ F: GACAAAACGAAAAACCGACCC R: ATTGCGGACACGAACCGAG AFP Alpha-fetoprotein XM_ F: CTCCTATGCTCTCAGGAGGC R: TTCTTTGCAGCACTGTTCCC MMP7 Matrix metallopeptidase 7 NM_ F: GCTGCCATTCTCCTACCTCA R: CACATCTGGGCTGTTGCATT NR6A1 Nuclear receptor subfamily 6 group A member 1 XM_ F: GTTTGCCAGGACTTCACAGAG R: CGGGACATTCACCATCTTTC CXCR4 C-X-C motif chemokine receptor 4 NM_ F: TCTGTGGCTGACCTCCTCTT R: TCAGGCACTGTGAGAAGCAC REST RE1-silencing transcription factor XM_ F: AAAGAGCAAACAAAAGGGGA R: TTGCTCGTTGGCTTCTTTT SIN3A SIN3 transcription regulator family member A NM_ F: GGAAGAGGAGGAAGAAGAGG R: CTCTCCCTTGTCTCCTCTTC SIN3B SIN3 transcription regulator family member B XM_ F: GGGGAGAAAAGAAAAGACCAA R: CCTCGCTTCCTTTCGTTC MTA1 Metastasis-associated 1 NM_ F: AACAAGCCAAACCCCAACC R: GTTTGGTCCTGGTCTCTCTC MTA3 Metastasis-associated 1 family, member 3 XM_ F: GCTCTTCCTTTCTCGCCAGT R: ACGGTCTGTAAGGGGGCTAT RCOR1 REST corepressor 1 XM_ F: AACAGAGCGAAGAGGAAACC R: CTCTTTGCCGTGTTCTGC RCOR3 REST corepressor 3 NM_ F: ATCGACAGGCTCGAAAGCTTGCTA R: CATTCTCAGCGTTCCAAATGCCG GAPDH Glyceraldehyde-3-phosphate dehydrogenase NM_ F: GGTGGTGCTAAGCGTGTTAT R: ACCTCTGTCATCTCTCCACA ACTB Actin, beta NM_ F: AGGAGATCACAGCCCTGGCA R: CAATGGAGGGTCCGGATTCA 4 C. Supernatants containing histone protein are neutralized by 2 M NaOH at 10% volume of 0.2 N HCl. Protein (*10 mg) from total cell lysate was loaded in each lane for separation on 15% SDS-polyacrylamide gels. Resolved proteins were transferred onto a Hybond 0.45 PVDF membrane (GE Healthcare Life Sciences, Little Chalfont, United Kingdom) and blocked with 3% skim milk for 1 h at room temperature (Sigma-Aldrich). The blocked membrane was incubated overnight at 4 C in the presence of primary antibody (dilution: 1:3,000) and then for 1 h with horseradish peroxidase-conjugated secondary antibody (31460; Thermo Fisher Scientific, Inc., Waltham, MA) at a dilution of 1:4,000. Primary antibodies were as follows: anti-histone H3 (ab1791; Abcam) and anti-h3k9ac antibody (06-942; Millipore). Immunoreactive proteins were visualized with the ECL western blot detection system (Thermo Fisher Scientific, Inc.). All blots were performed in triplicate, and protein levels were quantitated with ImageJ (National Institutes of Health, Bethesda, MD) [28]. Prediction of the RE1-silencing transcription factor-binding site in the proximate promoter of NANOG, POUV, and VASA The region upstream of NANOG, POUV, and VASA transcriptional start site (TSS) was predicted by MatInspector, a Genomatix program ( using TRANSFAC matrices (vertebrate matrix; core similarity 1.0 and matrix similarity 0.8). Chromatin immunoprecipitation Treated cells were fixed in 1% methanol-free formaldehyde (Thermo Fisher Scientific, Inc.) in DMEM for 20 min at room temperature, followed by 10-min blocking in 125 mm
4 1218 JUNG ET AL. Table 2. Primers Used for Chromatin Immunoprecipitation-Polymerase Chain Reaction and Chromatin Immunoprecipitation-Quantitative Polymerase Chain Reaction Primer Description Primer sequence (5 / 3 ) ChIP-REST REST binding site on NANOG promoter F: GAGGCGTAGGTGGGTAGCAAGAC R: GTCAGTTGATTGGAGGGGAGTGG glycine. Cells were rinsed two times in ice-cold PBS and harvested. Suspension cultured cells were fixed in the plate and harvested by pipetting after washing with PBS. Fixed cell pellets were dissociated in radioimmunoprecipitation (RIPA) lysis buffer (10 mm Tris-HCl, ph 7.5, 1 mm EDTA, 0.5 M EGTA, 1% Triton X-100, 0.1% SDS, 0.1% Nadeoxycholate, and 140 mm NaCl; Thermo Fisher Scientific, Inc.) with protease and phosphatase inhibitors (Sigma- Aldrich). Chromatin was sheared to an average length of base pairs (bp) using a sonicator (Q500; Qsonica, Newtown, CT). DNA concentration and the efficiency of shearing were determined by agarose gel electrophoresis. An anti-h3k9ac antibody (06-942; Millipore) was used for immunoprecipitation. Ten micrograms of sonicated chromatin samples was used. Chromatin immunoprecipitation (ChIP) was performed using a One-Step ChIP Kit (ab117138; Abcam) according to the manufacturer s instructions (ab117138; Abcam) and nonimmune IgG was used as a negative control. The bound chromatin/antibody complex was incubated in reverse crosslinking buffer for 2 h at 65 C, followed by treatment with proteinase K. Chromatin immunoprecipitation-polymerase chain reaction and chromatin immunoprecipitationquantitative polymerase chain reaction For total chromatin control samples (inputs) purified before immunoprecipitation, add 10 ml of each chromatin sample to 88 ml of buffer and 2.5 ml of proteinase K. For chromatin immunoprecipitation-polymerase chain reaction (ChIP-PCR), the reaction mixture comprised 2 ml of PCR buffer, 0.5 ml of 10 mm dntp mixture, 10 pmol of each of the forward and reverse primers (Table 2), 1 ml of ChIP DNA, and 1 U of Taq DNA polymerase in a 20 ml final volume. ChIP-PCR amplification involved an initial incubation at 95 C for 10 min, followed by 30 cycles at 95 C for 30 s, 60 C for 30 s, and 72 C for 30 s. The reaction was terminated by a final incubation at 72 C for 5 min. For chromatin immunoprecipitation-quantitative polymerase chain reaction (ChIP-qPCR), the reaction mixture, thermal conditions, and all other procedures were as stated above. ChIP-qPCR was performed using a StepOnePlus real-time PCR system (Applied Biosystems) with EvaGreen (Biotium). Each test sample was assayed in triplicate. Relative quantification of gene expression was performed using the following formula: ((2 -DCt ) 100%), where DCt = (Ct [IP] - Ct [Input DF]). The DF (default input fraction) was 1%, which is a dilution factor of cycles (ie, log2 of 100). Small interfering RNA transfection in chicken PGCs Chicken PGCs were seeded at in 1 ml of medium per well of a 12-well plate. Cells were transfected with 100 pmol of each HDAC small interfering RNA (sirna) (Table 3) using RNAiMAX (Invitrogen). Negative control sirna with no complementary sequence in the chicken genome was used as a control. After transfection for 48 h, total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer s protocol. The knockdown efficiency of HDAC complex sirnas and their effects on the expression of pluripotency-, germ cell-, and three germ layer-specific marker genes were assayed by RT-qPCR. Table 3. List of Small Interfering RNA Sequences for Knockdown Experiments Gene symbol Accession no. Primer sequence (5 / 3 ) REST XM_ S: CAGAGACTGTCAGGAAGCTCAGAAA AS: UUUCUGAGCUUCCUGACAGUCUCUG SIN3A NM_ S: ACAUCUUCAUGAGGCUGCAUCAGAU AS: AUCUGAUGCAGCCUCAUGAAGAUGU SIN3B XM_ S: CAGCGGGCUGUUGUUGCAUUACUCA AS: UGAGUAAUGCAACAACAGCCCGCUG MTA1 NM_ S: CCGCCAAUGGAAAUGUGGAAGCAAA AS: UUUGCUUCCACAUUUCCAUUGGCGG MTA3 XM_ S: CAUGUACCGAGUGGGAGAUUAUGUU AS: AACAUAAUCUCCCACUCGGUACAUG RCOR1 XM_ S: CCGACGUCGUUUCAACAUAGAUGAA AS: UUCAUCUAUGUUGAAACGACGUCGG RCOR3 NM_ S: CGGAUCUCCCUAACUUCACUCCCUU AS: AAGGGAGUGAAGUUAGGGAGAUCCG Nonspecific sirna a S: CCUACGCCACCAAUUUCGU AS: GGAUGCGGUGGUUAAAGCA a Nonspecific sirna has no complementary sequence in the chicken genome and was used as a control for gene silencing. sirna, small interfering RNA.
5 THE MODERATE EXPRESSION OF NANOG IN CHICKEN PGCS 1219 Statistical analysis Data are expressed as mean standard error from three independent biological experiments. Student s t-test was performed to evaluate differences between experimental groups using GraphPad Prism v.5 (GraphPad Software, La Jolla, CA). A value of P < 0.05 was considered indicative of statistical significance (***P < 0.001, **P < 0.01, and *P < 0.05). Results Upregulation of H3K9ac and gene expression in PGCs by HDAC inhibitors To assess the influence of HDAC on epigenetic regulation and gene expression in chicken PGCs, we treated PGCs with 0.25 mm VPA, an inhibitor of class I HDACs, closely associated with transcriptional activity [29]. Treatment of PGCs with VPA in vitro resulted in a global increase in H3K9ac compared with untreated control PGCs (Fig. 1A). Next, PGCs were treated with 50 nm Romidepsin in vitro, a specific inhibitor of HDAC1 and 2 [30], which also resulted in a global increase in H3K9ac (Fig. 1A). Quantification of H3K9ac after chemical treatment confirmed the significant elevation of H3K9ac in VPA- and romidepsin-treated PGCs compared with control PGCs (Fig. 1B, C). However, romidepsin is a more effective HDAC inhibitor in PGCs compared with VPA (Fig. 1C). Therefore, only romidepsin was used for subsequent treatments. In addition to H3K9ac, we examined H3K27ac, H3K9me3, and H3K27me3 in romidepsin-treated PGCs (Supplementary Fig. S1; Supplementary Data are available online at scd). The global increase in H3K27ac and decrease in H3K9me3 and H3K27me3 were shown in chicken PGCs by romidepsin treatment, indicating the treatment modulated overall epigenetic marks in an active status. Next, we examined romidepsin effects on the expression of a set of genes in PGCs. FIG. 1. Effect of HDAC inhibitors on H3K9ac and expression of NANOG in chicken PGCs. (A) Cultured PGCs were treated with 0.25 mm VPA or 50 nm romidepsin for 3 days, and subjected to immunocytochemical analysis of H3K9ac levels. Scale bar, 100 mm. (B) Western blot analysis of H3K9ac after chemical treatment. Histone H3 was used as control. (C) Relative quantification of H3K9ac to H3 in B. (D) Expression of NANOG in PGCs treated with romidepsin by RTqPCR. RT-qPCR was conducted in triplicate, and the relative gene expression in treatments was normalized to expression of GAPDH and ACTB. Error bars represent SE of biological triplicate analyses. Significant differences between groups are indicated as ***P < and *P < H3K9ac, histone H3 lysine 9 acetylation; HDAC, histone deacetylase; PGCs, primordial germ cells; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; SE, standard error; VPA, valproic acid. Color images available online at
6 FIG. 2. Effect of romidepsin on acetylated H3K9 levels at the REST-binding site in the NANOG promoter. (A) The RESTbinding site in the proximal NANOG promoter. Arrows indicate primer-binding site. (B) Agarose gel electrophoresis of ChIP- PCR after treatment with HDAC inhibitor. %Input = 100-fold diluted DNA before selection; IgG = control for nonspecific antibody binding to DNA. (C) ChIP-qPCR amplification of the proximal REST-binding site (188 bp from the TSS) after treatment with HDAC inhibitor. Untreated PGCs were used as the control. Error bars represent SE of biological triplicate analyses. Significant differences between groups are indicated as *P < bp, base pairs; ChIP-PCR, chromatin immunoprecipitation-polymerase chain reaction; ChIP-qPCR, chromatin immunoprecipitation-quantitative polymerase chain reaction; H3K9ac, histone H3 lysine 9 acetylation; HDAC, histone deacetylase; IgG, immunoglobulin G; PGCs, primordial germ cells; RE1-silencing transcription factor; SE, standard error; TSS, transcriptional start site. Color images available online at FIG. 3. REST regulates H3K9ac to repress NANOG expression in chicken PGCs. (A) Expression of REST in DF-1 cells and chicken PGCs by RT-qPCR. (B) Effect of sirna-mediated knockdown of REST determined by RT-qPCR. (C) RTqPCR analysis of POUV, NANOG, VASA, and DAZL expression in PGCs after knockdown of REST. RT-qPCR was conducted in triplicate, and the relative gene expression in treatments was normalized to expression of GAPDH and ACTB. (D, E) Suppression of REST increased H3K9ac levels at the REST-binding site in the proximal NANOG promoter. %Input = 100-fold diluted DNA before selection; IgG = control for nonspecific antibody binding to DNA. Nonspecific sirna-treated PGCs were used as the control. Error bars represent SE of biological triplicate analyses. Significant differences between groups are indicated as ***P < 0.001, **P < 0.01, and *P < sirna, small interfering RNA; REST, RE1-silencing transcription factor; H3K9ac, histone H3 lysine 9 acetylation; PGCs, primordial germ cells; IgG, immunoglobulin G; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; SE, standard error. 1220
7 THE MODERATE EXPRESSION OF NANOG IN CHICKEN PGCS 1221 NANOG expression was significantly upregulated following romidepsin treatment (Fig. 1D). Furthermore, expression of the pluripotency and germness-related genes, POUV and VASA, was significantly upregulated following romidepsin treatment (Supplementary Fig. S2A), indicating that active genes in chicken PGCs, NANOG, POUV, and VASA, were further induced by HDAC inhibitor. Therefore, expression of these genes may be suppressed by an HDAC complex in chicken PGCs. In contrast, the expression of three germ layer markers, BRACHYURY, GSC, SOX7, GATA4, and SOX3, which are not constitutively expressed in chicken PGCs, was unchanged even following romidepsin treatment (Supplementary Fig. S2B). We found that the germ cell tumor markers, such as AFP, MMP7, and NR6A1, were upregulated in romidepsin-treated PGCs (Supplementary Fig. S2C). While romidepsin-treated PGCs showed downregulated expression of migration-related gene, CXCR4 (Supplementary Fig. S2D). In chicken DF-1 cells, only NANOG was expressed after romidepsin treatment than that of POUV, DAZL, and VASA (Supplementary Fig. S3). HDAC inhibitor increases acetylated H3K9 levels at RE1-silencing transcription factor-binding sites in the NANOG promoter To identify the transcriptional repressor involved in modulation of NANOG expression by romidepsin, we predicted the regions affected by HDAC inhibition in the putative promoter of NANOG.UpstreamofNANOG, we found a binding site of the transcriptional repressor, RE1-silencing transcription factor (REST), 188 bp from the TSS using MatInspector (Fig. 2A). Next, to examine the effect of the HDAC inhibitor on the REST-binding site, we performed ChIP analysis on this site of the NANOG promoter (188 bp from TSS). ChIP-PCR and ChIP-qPCR analyses showed that romidepsin treatment resulted in a significant increase of H3K9ac in the region nearby the REST-binding site in the NANOG promoter (Fig. 2B, C). Therefore, H3K9ac level and the expression of NANOG could be regulated by an HDAC complex possibly via the REST-binding site in chicken PGCs. REST represses NANOG expression via H3K9ac in chicken PGCs We next performed an expression and knockdown analysis of REST in chicken PGCs. RT-qPCR showed that REST expression was significantly higher in PGCs than DF-1 cells (Fig. 3A). Subsequently, we conducted a loss-of-function study of REST on gene expression in PGCs. REST expression was efficiently knocked down using REST-targeting sirna. Following successful knockdown of REST (Fig.3B),we quantified the expression of pluripotency- and germnessrelated genes by RT-qPCR. NANOG and VASA expression was significantly upregulated; the increase in NANOG expression was considerable. In contrast, POUV and DAZL expression was unchanged (Fig. 3C). REST-binding sites were also found in the proximal POUV and VASA promoters (Supplementary Fig. S4). Otherwise, REST knockdown increased VASA expression but not POUV expression (Fig. 3C), indicating REST to be involved in transcriptional regulation of VASA but not POUV. ChIP-PCR and ChIP-qPCR showed that suppression of REST increased H3K9ac at the RESTbinding site in the proximate NANOG promoter (Fig. 3D, E). These results indicate that the REST repressor regulates the level of H3K9ac to control NANOG transcription in chicken PGCs. The CoREST complex member RCOR3 mediates epigenetic regulation of NANOG expression Next, we elucidated the HDAC complex that mediates the change in H3K9ac in PGCs. We first determined the expression of candidate members of the HDAC complex, including metastasis-associated 1 (MTA1), MTA3, REST corepressor 1 (RCOR1), RCOR3, SIN3 transcription regulator family member A (SIN3A), and SIN3B, in chicken PGCs and DF-1 cells. Reverse transcription-polymerase chain reaction (RT- PCR) showed that all HDAC complex members, except for SIN3A, were expressed in PGCs and DF-1 cells (Fig. 4A). Second, the HDAC complex members MTA1, MTA3, RCOR1, RCOR3, and SIN3B were knocked down in PGCs using specific sirnas. After successful knockdown of HDAC complex members in PGCs (Fig. 4B), we examined the expression of POUV, NANOG, VASA, and DAZL using RT-qPCR. Among the five members of the HDAC complex, only knockdown of RCOR3 showed significant upregulation of NANOG expression (Fig. 4C). In addition, repression of RCOR3 by sirna enriched the acetylated H3K9 residue on the REST site in the NANOG promoter (Fig. 4D, E). These results suggest that RCOR3, together with REST, deacetylates the region upstream of the NANOG promoter, which represses NANOG expression in chicken PGCs. Discussion NANOG is a notable homeodomain transcription factor involved in maintaining and establishing pluripotency in mammals [11,31,32]. During somatic cell reprogramming FIG. 4. The CoREST complex member RCOR3 modulates epigenetic regulation of NANOG expression. (A) Expression of HDAC complexes in chicken PGCs and DF-1 cells by RT-PCR. (B) Effect of sirna-mediated knockdown of HDAC complex members by RT-qPCR. (C) RT-qPCR analysis of POUV, NANOG, VASA, and DAZL expression in PGCs after knockdown of HDAC complex members. RT-qPCR was conducted in triplicate, and the relative gene expression in treatments was normalized to expression of GAPDH and ACTB. (D, E) Suppression of RCOR3 resulted in an increased level of H3K9ac at the REST-binding site in the proximal NANOG promoter. %Input = 100-fold diluted DNA before selection; IgG = control for nonspecific antibody binding to DNA. Nonspecific sirna-treated PGCs were used as the control. Error bars represent SE of biological triplicate analyses. Significant differences between groups are indicated as ***P < 0.001, **P < 0.01, and *P < RCOR3, REST corepressor 3; HDAC, histone deacetylase; REST, RE1-silencing transcription factor; H3K9ac, histone H3 lysine 9 acetylation; PGCs, primordial germ cells; RT-PCR, reverse transcription-polymerase chain reaction; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; IgG, immunoglobulin G; sirna, small interfering RNA; SE, standard error.
8 1222
9 THE MODERATE EXPRESSION OF NANOG IN CHICKEN PGCS 1223 FIG. 5. Epigenetic regulation of NANOG expression in chicken PGCs. Epigenetic regulation of HDAC complex controls NANOG expression in chicken PGCs. HDAC inhibitor represses deacetylation activity of the HDAC, resulting in upregulation of NANOG. The transcription factor REST binds to the upstream region of the NANOG promoter and represses NANOG expression with RCOR3 and HDAC. REST/CoREST/HDAC complex maintains moderate NANOG expression in chicken PGCs. HDAC, histone deacetylase; REST, RE1-silencing transcription factor; RCOR3, REST corepressor 3; PGCs, primordial germ cells. Color images available online at and self-renewal in ESCs, NANOG cooperates with the SIN3A/HDAC corepressor complex to activate pluripotency genes and repress reprogramming barrier genes [25]. In terms of germ cell specification from the epiblast in vitro, NANOG activates the expression of germ cell-specific transcription factors such as PRDM1 and PRDM14 as an enhancer in mouse [22], suggesting a crucial role for NANOG in germ cells. In chicken, NANOG is expressed in both ESCs and PGCs [18,21]; however, epigenetic regulation of NANOG expression by the HDAC complex in PGCs has not been investigated. Generally, acetylation of histone tails, including H3K9ac, activates gene expression. In mouse, H3K9ac was increasing sharply in PGCs at embryonic day (E) 10.5 when entering into genital ridges, but decreasing after settlement [3]. In migrating chicken PGCs, H3K9ac was restricted in foci of loose chromatin structures, which could be involved in germ cell-specific gene expression [10]. Treatment with an HDAC inhibitor resulted in global elevation of the H3K9ac level. Indeed, treatment with the HDAC1/2-specific inhibitor romidepsin resulted in a greater elevation of the H3K9ac level, implying that HDAC1 or 2 could be the active deacetylase in chicken PGCs. Surprisingly, although NANOG, as well as POUV and VASA, is expressed at high levels in chicken PGCs, the expression was increased following the increase in H3K9ac or indirect effects induced by treatment with HDAC inhibitor. NANOG expression was also increased in romidepsin-treated chicken DF-1 cells, suggesting that the transcription of NANOG is epigenetically regulated in chicken, regardless of cell type. In contrast, the expression levels of differentiation markers were unaffected. In mammalian ESCs, treatment with low concentrations of HDAC inhibitors results in enrichment of H3K9ac to promote selfrenewal and pluripotency [33,34]. However, PGCs, unlike ESCs, generate sperm and oocytes and transmit genetic information to the next generation; therefore, gene expression in PGCs should be tightly regulated. In mammals, overexpression of NANOG causes germ cell tumors [35,36]; in contrast, suppression of NANOG induces apoptosis of germ cells [14]. Correspondingly, germ cell tumor markers, such as AFP, MMP7, and NR6A1 [37], could be upregulated by NANOG overexpression due to romidepsin treatment in chicken PGCs. Also, we found that the migration-related gene in chicken, CXCR4 [38], was downregulated, indicating the possibility of aberrant migration of those treated PGCs. The misallocated cells that could not undergo apoptosis in extragonadal sites could give rise to germ cell tumors [39]. Therefore, gene expression in PGCs may need to be regulated to the proper level. REST is a zinc finger transcription factor that represses the expression of multiple genes during embryogenesis, and regulates neuronal gene expression and neural stem cell (NSC) fate in vertebrates [40 42]. In mouse, Rest has differential regulatory roles in ESCs and NSCs [43]. Even, Rest shared common targets with pluripotency-related factors, including Nanog [43], indicating the possible interaction between REST and NANOG in other cell types. In the case of chicken PGCs, to moderately regulate gene expression, especially NANOG, repressors such as REST seem to promote histone deacetylation of gene promoters. According to our results, REST is involved in repression of NANOG expression and reduction of H3K9ac in promoter. Furthermore, among the members of HDAC corepressor complexes, such as CoREST [23], MTA [24], and SIN3 [25], RCOR3 is a major upstream regulator of histone acetylation in NANOG promoter in chicken PGCs. Mouse ESCs showed varying numbers of recruited corepressors with Rest in target sites, indicating different interactions among their complexes in diverse regions [44]. In terms of early neuronal differentiation in mouse ESCs, the REST-CoREST complex modulates gene expression [45]. In this study, our results demonstrated that the REST/CoREST/HDAC complex modulates the H3K9ac level in upstream of NANOG to regulate its moderate expression in chicken PGCs. In conclusion, we report that the CoREST/HDAC complex with REST, which binds to the NANOG promoter, functions as a transcriptional corepressor to regulate NANOG expression in chicken PGCs (Fig. 5). The CoREST/REST/ HDAC repressor complex in PGCs is involved in maintaining moderate expression of NANOG, which is a critical transcription factor for germ cell characteristics. Therefore, regulation of NANOG expression by the REST/CoREST/ HDAC complex could be involved in maintaining the PGC integrity. Acknowledgments This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government ( MSIP) (no. NRF-2015R1A3A ). This research was also supported by the International Research & Development Program of the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT and Future Planning of Korea (NRF-2016K1A3A1A ).
10 1224 JUNG ET AL. Author Disclosure Statement No competing financial interests exist. References 1. Tang WW, T Kobayashi, N Irie, S Dietmann and MA Surani. (2016). Specification and epigenetic programming of the human germ line. Nat Rev Genet 17: Strome S and D Updike. (2015). Specifying and protecting germ cell fate. Nat Rev Mol Cell Biol 16: Seki Y, K Hayashi, K Itoh, M Mizugaki, M Saitou and Y Matsui. (2005). Extensive and orderly reprogramming of genome-wide chromatin modifications associated with specification and early development of germ cells in mice. Dev Biol 278: Akiyama T, M Nagata and F Aoki. (2006). Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A 103: Steilmann C, A Paradowska, M Bartkuhn, M Vieweg, HC Schuppe, M Bergmann, S Kliesch, W Weidner and K Steger. (2011). Presence of histone H3 acetylated at lysine 9 in male germ cells and its distribution pattern in the genome of human spermatozoa. Reprod Fertil Dev 23: Han JY. (2009). Germ cells and transgenesis in chickens. Comp Immunol Microbiol Infect Dis 32: Tsunekawa N, M Naito, Y Sakai, T Nishida and T Noce. (2000). Isolation of chicken vasa homolog gene and tracing the origin of primordial germ cells. Development 127: Lee HC, HJ Choi, HG Lee, JM Lim, T Ono and JY Han. (2016). DAZL expression explains origin and central formation of primordial germ cells in chickens. Stem Cells Dev 25: Hamburger V and HL Hamilton. (1951). A series of normal stages in the development of the chick embryo. J Morphol 88: Kress C, G Montillet, C Jean, A Fuet and B Pain. (2016). Chicken embryonic stem cells and primordial germ cells display different heterochromatic histone marks than their mammalian counterparts. Epigenetics Chromatin 9: Yu J, MA Vodyanik, K Smuga-Otto, J Antosiewicz- Bourget, JL Frane, S Tian, J Nie, GA Jonsdottir, V Ruotti, et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318: Yamaguchi S, H Kimura, M Tada, N Nakatsuji and T Tada. (2005). Nanog expression in mouse germ cell development. Gene Expr Patterns 5: Irie N, WW Tang and M Azim Surani. (2014). Germ cell specification and pluripotency in mammals: a perspective from early embryogenesis. Reprod Med Biol 13: Yamaguchi S, K Kurimoto, Y Yabuta, H Sasaki, N Nakatsuji, M Saitou and T Tada. (2009). Conditional knockdown of Nanog induces apoptotic cell death in mouse migrating primordial germ cells. Development 136: Chambers I, J Silva, D Colby, J Nichols, B Nijmeijer, M Robertson, J Vrana, K Jones, L Grotewold and A Smith. (2007). Nanog safeguards pluripotency and mediates germline development. Nature 450: Western PS, JA van den Bergen, DC Miles and AH Sinclair. (2010). Male fetal germ cell differentiation involves complex repression of the regulatory network controlling pluripotency. FASEB J 24: Zhang M, HG Leitch, WWC Tang, N Festuccia, E Hall- Ponsele, J Nichols, MA Surani, A Smith and I Chambers. (2018). Esrrb complementation rescues development of Nanog-null germ cells. Cell Rep 22: Lavial F, H Acloque, F Bertocchini, DJ Macleod, S Boast, E Bachelard, G Montillet, S Thenot, HM Sang, et al. (2007). The Oct4 homologue PouV and Nanog regulate pluripotency in chicken embryonic stem cells. Development 134: Han JY, HG Lee, YH Park, YS Hwang, SK Kim, D Rengaraj, BW Cho and JM Lim. (2018). Acquisition of pluripotency in the chick embryo occurs during intrauterine embryonic development via a unique transcriptional network. J Anim Sci Biotechnol 9: Nakanoh S, N Fuse, R Tadokoro, Y Takahashi and K Agata. (2017). Jak1/Stat3 signaling acts as a positive regulator of pluripotency in chicken pre-gastrula embryos. Dev Biol 421: Cañón S, C Herranz and M Manzanares. (2006). Germ cell restricted expression of chick Nanog. Dev Dyn 235: Murakami K, U Günesdogan, JJ Zylicz, WWC Tang, R Sengupta, T Kobayashi, S Kim, R Butler, S Dietmann and MA Surani. (2016). NANOG alone induces germ cells in primed epiblast in vitro by activation of enhancers. Nature 529: Yang P, Y Wang, J Chen, H Li, L Kang, Y Zhang, S Chen, B Zhu and S Gao. (2011). RCOR2 is a subunit of the LSD1 complex that regulates ESC property and substitutes for SOX2 in reprogramming somatic cells to pluripotency. Stem Cells 29: dos Santos RL, L Tosti, A Radzisheuskaya, IM Caballero, K Kaji, B Hendrich and JC Silva. (2014). MBD3/NuRD facilitates induction of pluripotency in a context-dependent manner. Cell Stem Cell 15: Saunders A, X Huang, M Fidalgo, MH Reimer, Jr., F Faiola, J Ding, C Sánchez-Priego, D Guallar, C Sáenz, D Li and J Wang. (2017). The SIN3A/HDAC corepressor complex functionally cooperates with NANOG to promote pluripotency. Cell Rep 18: Park TS and JY Han. (2012). piggybac transposition into primordial germ cells is an efficient tool for transgenesis in chickens. Proc Natl Acad Sci U S A 109: Park TS, HJ Lee, KH Kim, JS Kim and JY Han. (2014). Targeted gene knockout in chickens mediated by TALENs. Proc Natl Acad Sci U S A 111: Ko MH, YS Hwang, JS Rim, HJ Han and JY Han. (2017). Avian blastoderm dormancy arrests cells in G2 and suppresses apoptosis. FASEB J 31: Kazantsev AG and LM Thompson. (2008). Therapeutic application of histone deacetylase inhibitors for central nervous system disorders. Nat Rev Drug Discov 7: Kwon HJ, MS Kim, MJ Kim, H Nakajima and KW Kim. (2002). Histone deacetylase inhibitor FK228 inhibits tumor angiogenesis. Int J Cancer 97: Mitsui K, Y Tokuzawa, H Itoh, K Segawa, M Murakami, K Takahashi, M Maruyama, M Maeda and S Yamanaka. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113: Loh YH, Q Wu, JL Chew, VB Vega, W Zhang, X Chen, G Bourque, J George, B Leong, et al. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet 38:
11 THE MODERATE EXPRESSION OF NANOG IN CHICKEN PGCS Ware CB, L Wang, BH Mecham, L Shen, AM Nelson, M Bar, DA Lamba, DS Dauphin, B Buckingham, et al. (2009). Histone deacetylase inhibition elicits an evolutionarily conserved self-renewal program in embryonic stem cells. Cell Stem Cell 4: Hezroni H, BS Sailaja and E Meshorer. (2011). Pluripotencyrelated, valproic acid (VPA)-induced genome-wide histone H3 lysine 9 (H3K9) acetylation patterns in embryonic stem cells. J Biol Chem 286: Hart AH, L Hartley, K Parker, M Ibrahim, LH Looijenga, M Pauchnik, CW Chow and L Robb. (2005). The pluripotency homeobox gene NANOG is expressed in human germ cell tumors. Cancer 104: Heaney JD, EL Anderson, MV Michelson, JL Zechel, PA Conrad, DC Page and JH Nadeau. (2012). Germ cell pluripotency, premature differentiation and susceptibility to testicular teratomas in mice. Development 139: Juric D, S Sale, RA Hromas, R Yu, Y Wang, GE Duran, R Tibshirani, LH Einhorn and BI Sikic. (2005). Gene expression profiling differentiates germ cell tumors from other cancers and defines subtype-specific signatures. Proc Natl Acad Sci U S A 102: Stebler J, D Spieler, K Slanchev, KA Molyneaux, U Richter, V Cojocaru, V Tarabykin, C Wylie, M Kessel and E Raz. (2004). Primordial germ cell migration in the chick and mouse embryo: the role of the chemokine SDF-1/ CXCL12. Dev Biol 272: Schneider DT, AE Schuster, MK Fritsch, J Hu, T Olson, S Lauer, U Göbel and EJ Perlman. (2001). Multipoint imprinting analysis indicates a common precursor cell for gonadal and nongonadal pediatric germ cell tumors. Cancer Res 61: Chong JA, J Tapia-Ramírez, S Kim, JJ Toledo-Aral, Y Zheng, MC Boutros, YM Altshuller, MA Frohman, SD Kraner and G Mandel. (1995). REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons. Cell 80: Chen ZF, AJ Paquette and DJ Anderson. (1998). NRSF/ REST is required in vivo for repression of multiple neuronal target genes during embryogenesis. Nat Genet 20: Grimes JA, SJ Nielsen, E Battaglioli, EA Miska, JC Speh, DL Berry, F Atouf, BC Holdener, G Mandel and T Kouzarides. (2000). The co-repressor msin3a is a functional component of the REST-CoREST repressor complex. J Biol Chem 275: Johnson R, CH Teh, G Kunarso, KY Wong, G Srinivasan, ML Cooper, M Volta, SS Chan, L Lipovich, et al. (2008). REST regulates distinct transcriptional networks in embryonic and neural stem cells. PLoS Biol 6:e Yu HB, R Johnson, G Kunarso and LW Stanton. (2011). Coassembly of REST and its cofactors at sites of gene repression in embryonic stem cells. Genome Res 21: Lee M, H Ji, Y Furuta, JI Park and PD McCrea. (2014). p120-catenin regulates REST and CoREST, and modulates mouse embryonic stem cell differentiation. J Cell Sci 127: Address correspondence to: Dr. Jae Yong Han Department of Agricultural Biotechnology College of Agriculture and Life Sciences Seoul National University 1 Gwanak-ro Gwanak-gu Seoul Korea jaehan@snu.ac.kr Received for publication March 16, 2018 Accepted after revision June 26, 2018 Prepublished on Liebert Instant Online July 21, 2018
Cell Physiol Biochem 2015;37: DOI: / Published online: September 11, 2015
www.karger.com/cpb 719 1421-9778/15/0372-0719$39.50/0 Qi Accepted: et al.: JMJD2A August Inhibition 06, 2015 Attenuates Neointimal Hyperplasia in Diabetic Rats Original Paper This is an Open Access article
Læs mereMicroRNA-150 Inhibits the Activation of Cardiac Fibroblasts by Regulating c-myb
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: May May 17, 17, 2016 2016 Published by S. Karger AG, Basel 2103 1421-9778/16/0386-2103$39.50/0 Accepted:
Læs mereCoordinator: Dr. Hsien-Ming Lee Coach Professor: Dr. Joseph J.-T. Huang Sit-in Professor: Dr. Su-Chang Lin. Presenter: Bagher Golzarroshan
Coordinator: Dr. Hsien-Ming Lee Coach Professor: Dr. Joseph J.-T. Huang Sit-in Professor: Dr. Su-Chang Lin Presenter: Bagher Golzarroshan 1 Outline Introduction Cancer Apoptosis Apoptosis and disease Scope
Læs mereBasic statistics for experimental medical researchers
Basic statistics for experimental medical researchers Sample size calculations September 15th 2016 Christian Pipper Department of public health (IFSV) Faculty of Health and Medicinal Science (SUND) E-mail:
Læs mereEvaluating Germplasm for Resistance to Reniform Nematode. D. B. Weaver and K. S. Lawrence Auburn University
Evaluating Germplasm for Resistance to Reniform Nematode D. B. Weaver and K. S. Lawrence Auburn University Major objectives Evaluate all available accessions of G. hirsutum (TX list) for reaction to reniform
Læs mereFEN1 DNA DNA DNA DNA DNA DNA DNA DNA DNA DT40 DNA RNA H3-K36. RNA H3-K36 Set2 RNA. Set2 DNA H3-K36 RNA H3-K36 H3-K36 TBS-I, -II, -III 3 TBS-I TBS-II
DNA DNA DNA DNA DNA RNA H3 36 Lys (K) H3-K36 H3-K36 24 DNA FEN1 DNA FEN1 DNA DNA 4 CAF1 DNA DNA DT40 DNA DNA RNA H3-K36 RNA H3-K36 Set2 Set2 RNA C RNA Set2 H3-K36 5 I 24 24 23 TBS-I, -II, -III 3 TBS-I
Læs mereflutamide 7.5mg Control (2) (p<0.005) 2 Kdm5a Sertoli Leydig Kdm5a lysine (K)-specific demethylase 5A 3 18 RT-PCR Kdm5a 3 Western Blotting
(3) H3K4 3 18 (4) GC-1 Kdm5a 1 RT-PCR (1) S-D 14-20 flutamide 7.5mg 9 UDT Control (2) Kdm5alysine (K)-specific demethylase 5A3 18 Kdm5a RT-PCR Western Blotting 1GC-1 Kdm5a (1) 9 24 (2) 24 Kdm5a 3 9 18
Læs mereX M Y. What is mediation? Mediation analysis an introduction. Definition
What is mediation? an introduction Ulla Hvidtfeldt Section of Social Medicine - Investigate underlying mechanisms of an association Opening the black box - Strengthen/support the main effect hypothesis
Læs mereapplies equally to HRT and tibolone this should be made clear by replacing HRT with HRT or tibolone in the tibolone SmPC.
Annex I English wording to be implemented SmPC The texts of the 3 rd revision of the Core SPC for HRT products, as published on the CMD(h) website, should be included in the SmPC. Where a statement in
Læs mereThe GAssist Pittsburgh Learning Classifier System. Dr. J. Bacardit, N. Krasnogor G53BIO - Bioinformatics
The GAssist Pittsburgh Learning Classifier System Dr. J. Bacardit, N. Krasnogor G53BIO - Outline bioinformatics Summary and future directions Objectives of GAssist GAssist [Bacardit, 04] is a Pittsburgh
Læs mereSystems Biology of C. elegans. Stuart Kim Stanford University
Systems Biology of C. elegans Stuart Kim Stanford University Overview Cell lineage Genome Mutant Phenotypes Protein interaction Gene Expression Early cell divisions B A S M E C D 4P C. elegans zygote
Læs mereBlack Jack --- Review. Spring 2012
Black Jack --- Review Spring 2012 Simulation Simulation can solve real-world problems by modeling realworld processes to provide otherwise unobtainable information. Computer simulation is used to predict
Læs mereMeasuring the Impact of Bicycle Marketing Messages. Thomas Krag Mobility Advice Trafikdage i Aalborg, 27.08.2013
Measuring the Impact of Bicycle Marketing Messages Thomas Krag Mobility Advice Trafikdage i Aalborg, 27.08.2013 The challenge Compare The pilot pictures The choice The survey technique Only one picture
Læs mereThe test can be performed on the following devices. In addition, the required cuvette and the absorption range of the photometer are indicated.
Formaldehyde 10 M. L 1.00-5.00 mg/l HCHO H 2 SO 4 / Chromotropic acid 175 Instrument specific information The test can be performed on the following devices. In addition, the required cuvette and the absorption
Læs mereUNISONIC TECHNOLOGIES CO.,
UNISONIC TECHNOLOGIES CO., 3 TERMINAL 1A NEGATIVE VOLTAGE REGULATOR DESCRIPTION 1 TO-263 The UTC series of three-terminal negative regulators are available in TO-263 package and with several fixed output
Læs mereBasic Design Flow. Logic Design Logic synthesis Logic optimization Technology mapping Physical design. Floorplanning Placement Fabrication
Basic Design Flow System design System/Architectural Design Instruction set for processor Hardware/software partition Memory, cache Logic design Logic Design Logic synthesis Logic optimization Technology
Læs mereDoodleBUGS (Hands-on)
DoodleBUGS (Hands-on) Simple example: Program: bino_ave_sim_doodle.odc A simulation example Generate a sample from F=(r1+r2)/2 where r1~bin(0.5,200) and r2~bin(0.25,100) Note that E(F)=(100+25)/2=62.5
Læs mereGeneralized Probit Model in Design of Dose Finding Experiments. Yuehui Wu Valerii V. Fedorov RSU, GlaxoSmithKline, US
Generalized Probit Model in Design of Dose Finding Experiments Yuehui Wu Valerii V. Fedorov RSU, GlaxoSmithKline, US Outline Motivation Generalized probit model Utility function Locally optimal designs
Læs mereSign variation, the Grassmannian, and total positivity
Sign variation, the Grassmannian, and total positivity arxiv:1503.05622 Slides available at math.berkeley.edu/~skarp Steven N. Karp, UC Berkeley FPSAC 2015 KAIST, Daejeon Steven N. Karp (UC Berkeley) Sign
Læs mereTo date, germ cell specification in vertebrates has
STEM CELLS AND DEVELOPMENT Volume 25, Number 1, 2016 Ó Mary Ann Liebert, Inc. DOI: 10.1089/scd.2015.0208 DAZL Expression Explains Origin and Central Formation of Primordial Germ Cells in Chickens Hyung
Læs mereIBM Network Station Manager. esuite 1.5 / NSM Integration. IBM Network Computer Division. tdc - 02/08/99 lotusnsm.prz Page 1
IBM Network Station Manager esuite 1.5 / NSM Integration IBM Network Computer Division tdc - 02/08/99 lotusnsm.prz Page 1 New esuite Settings in NSM The Lotus esuite Workplace administration option is
Læs mereUnitel EDI MT940 June 2010. Based on: SWIFT Standards - Category 9 MT940 Customer Statement Message (January 2004)
Unitel EDI MT940 June 2010 Based on: SWIFT Standards - Category 9 MT940 Customer Statement Message (January 2004) Contents 1. Introduction...3 2. General...3 3. Description of the MT940 message...3 3.1.
Læs mereStatistik for MPH: 7
Statistik for MPH: 7 3. november 2011 www.biostat.ku.dk/~pka/mph11 Attributable risk, bestemmelse af stikprøvestørrelse (Silva: 333-365, 381-383) Per Kragh Andersen 1 Fra den 6. uges statistikundervisning:
Læs mereVores mange brugere på musskema.dk er rigtig gode til at komme med kvalificerede ønsker og behov.
På dansk/in Danish: Aarhus d. 10. januar 2013/ the 10 th of January 2013 Kære alle Chefer i MUS-regi! Vores mange brugere på musskema.dk er rigtig gode til at komme med kvalificerede ønsker og behov. Og
Læs mereKey words: HSVE, Serological Diagnosis, ELISA
Key words: HSVE, Serological Diagnosis, ELISA Fig. 1 IgM and IgG antibody levels in acute phase CSF of patients with HSVE by age as determined by ELISA index at 1: 10 dilution of CSF age in years Fig.
Læs mereSlot diffusers. Slot diffusers LD-17, LD-18
LD-17, LD-18 Application LD-17 and LD-18 are designed for supply of cold or warm air in rooms with a height between. m and 4 m. They allow easy setting of air deflectors for different modes of operation
Læs mereGlioblastoma multiforme, an aggressive primary brain
STEM CELLS AND DEVELOPMENT Volume 21, Number 10, 2012 Ó Mary Ann Liebert, Inc. DOI: 10.1089/scd.2011.0424 Transcriptional Repression of Mad-Max Complex by Human Umbilical Cord Blood Stem Cells Downregulates
Læs mereUser Manual for LTC IGNOU
User Manual for LTC IGNOU 1 LTC (Leave Travel Concession) Navigation: Portal Launch HCM Application Self Service LTC Self Service 1. LTC Advance/Intimation Navigation: Launch HCM Application Self Service
Læs mereSupporting Information for Publication. Assessment of extracellular vesicles purity using proteomic standards
Supporting Information for Publication Assessment of extracellular vesicles purity using proteomic standards Tingting Wang #, Kyle W. Anderson,#, and Illarion V. Turko,#,* Biomolecular Measurement Division,
Læs mereGusset Plate Connections in Tension
Gusset Plate Connections in Tension Jakob Schmidt Olsen BSc Thesis Department of Civil Engineering 2014 DTU Civil Engineering June 2014 i Preface This project is a BSc project credited 20 ECTS points written
Læs mereApplication form for access to data and biological samples Ref. no
Application form for access to data and biological samples Ref. 2016-02 Project title: Applicant: Other partners taking part in the project Names and work addresses: "Skilsmisse og selvvurderet mentalt
Læs mereKvant Eksamen December 2010 3 timer med hjælpemidler. 1 Hvad er en continuous variable? Giv 2 illustrationer.
Kvant Eksamen December 2010 3 timer med hjælpemidler 1 Hvad er en continuous variable? Giv 2 illustrationer. What is a continuous variable? Give two illustrations. 2 Hvorfor kan man bedre drage konklusioner
Læs mereOn the complexity of drawing trees nicely: corrigendum
Acta Informatica 40, 603 607 (2004) Digital Object Identifier (DOI) 10.1007/s00236-004-0138-y On the complexity of drawing trees nicely: corrigendum Thorsten Akkerman, Christoph Buchheim, Michael Jünger,
Læs mereChapter 14. Mendel & Genetics. AP Biology
Chapter 14. Mendel & Genetics Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method used quantitative
Læs mereadulthood markedly, even when minimising potential effects of the underlying parental infertility. These results suggest that parental infertility is
ENGLISH SUMMARY Despite the severity of childhood cancer and a possible increase in incidence since the middle of the past century, its aetiology remains largely unknown. Many childhood cancers occur at
Læs mereMeasuring Evolution of Populations
Measuring Evolution of Populations 2007-2008 5 Agents of evolutionary change Mutation Gene Flow Non-random mating Genetic Drift Selection Populations & gene pools Concepts a population is a localized group
Læs mereSkriftlig Eksamen Kombinatorik, Sandsynlighed og Randomiserede Algoritmer (DM528)
Skriftlig Eksamen Kombinatorik, Sandsynlighed og Randomiserede Algoritmer (DM58) Institut for Matematik og Datalogi Syddansk Universitet, Odense Torsdag den 1. januar 01 kl. 9 13 Alle sædvanlige hjælpemidler
Læs merePARALLELIZATION OF ATTILA SIMULATOR WITH OPENMP MIGUEL ÁNGEL MARTÍNEZ DEL AMOR MINIPROJECT OF TDT24 NTNU
PARALLELIZATION OF ATTILA SIMULATOR WITH OPENMP MIGUEL ÁNGEL MARTÍNEZ DEL AMOR MINIPROJECT OF TDT24 NTNU OUTLINE INEFFICIENCY OF ATTILA WAYS TO PARALLELIZE LOW COMPATIBILITY IN THE COMPILATION A SOLUTION
Læs mereLovkrav vs. udvikling af sundhedsapps
Lovkrav vs. udvikling af sundhedsapps Health apps give patients better control User Data Social media Pharma Products User behaviour Relatives www Self monitoring (app) data extract Healthcare specialists
Læs mereATEX direktivet. Vedligeholdelse af ATEX certifikater mv. Steen Christensen stec@teknologisk.dk www.atexdirektivet.
ATEX direktivet Vedligeholdelse af ATEX certifikater mv. Steen Christensen stec@teknologisk.dk www.atexdirektivet.dk tlf: 7220 2693 Vedligeholdelse af Certifikater / tekniske dossier / overensstemmelseserklæringen.
Læs mere5) dn/ds ratio. / (dn/ds ratio) dn/ds ratio codon substitution model[3] 1) insulin GLP-1
Gekko japonicus insulin proglucagon insulin GLP-1 GLP-2 mrna insulin proglucagon 1) (Gekko japonicus) -80 2) RNA cdna Total RNA ISOGEN (Nippon Gene) RACE cdna SMART RACE cdna Amplification Kit (BD Bioscience
Læs mereProject Step 7. Behavioral modeling of a dual ported register set. 1/8/ L11 Project Step 5 Copyright Joanne DeGroat, ECE, OSU 1
Project Step 7 Behavioral modeling of a dual ported register set. Copyright 2006 - Joanne DeGroat, ECE, OSU 1 The register set Register set specifications 16 dual ported registers each with 16- bit words
Læs mereBilag. Resume. Side 1 af 12
Bilag Resume I denne opgave, lægges der fokus på unge og ensomhed gennem sociale medier. Vi har i denne opgave valgt at benytte Facebook som det sociale medie vi ligger fokus på, da det er det største
Læs mereMolio specifications, development and challenges. ICIS DA 2019 Portland, Kim Streuli, Molio,
Molio specifications, development and challenges ICIS DA 2019 Portland, Kim Streuli, Molio, 2019-06-04 Introduction The current structure is challenged by different factors. These are for example : Complex
Læs mereMelbourne Mercer Global Pension Index
15 October 2009 Melbourne Global Pension Index Dr David Knox www.mercer.com.au The Genesis Victorian Government wants to highlight the significant role that Melbourne plays in the pension and funds management
Læs mereCHAPTER 8: USING OBJECTS
Ruby: Philosophy & Implementation CHAPTER 8: USING OBJECTS Introduction to Computer Science Using Ruby Ruby is the latest in the family of Object Oriented Programming Languages As such, its designer studied
Læs mereTilladelse til vævscenter til håndtering af humane væv og celler Authorisation of tissue establishment for the handling of human tissues and cells
Tilladelse til vævscenter til håndtering af humane væv og celler Authorisation of tissue establishment for the handling of human tissues and cells Sundhedsstyrelsen godkender hermed, at: The Danish Health
Læs mereIntegrated Coastal Zone Management and Europe
Integrated Coastal Zone Management and Europe Dr Rhoda Ballinger Format of talk What is ICZM Europe and the coast non-iczm specific Europe and ICZM ICZM programme development ICZM Recommendation What is
Læs mereThe test can be performed on the following devices. In addition, the required cuvette and the absorption range of the photometer are indicated.
Formaldehyde 50 M. L 0.02-1.00 mg/l HCHO / Chromotropic acid 176 Instrument specific information The test can be performed on the following devices. In addition, the required cuvette and the absorption
Læs mereSpecial VFR. - ved flyvning til mindre flyveplads uden tårnkontrol som ligger indenfor en kontrolzone
Special VFR - ved flyvning til mindre flyveplads uden tårnkontrol som ligger indenfor en kontrolzone SERA.5005 Visual flight rules (a) Except when operating as a special VFR flight, VFR flights shall be
Læs mereTo the reader: Information regarding this document
To the reader: Information regarding this document All text to be shown to respondents in this study is going to be in Danish. The Danish version of the text (the one, respondents are going to see) appears
Læs mereJordbrug Traktorer Bagmonteret trepunktsophæng Kategori 1N, 1, 2N, 2, 3N, 3, 4N og 4
Dansk standard Tillæg DS/ISO 730/Amd 1 1. udgave 2014-08-05 Jordbrug Traktorer Bagmonteret trepunktsophæng Kategori 1N, 1, 2N, 2, 3N, 3, 4N og 4 Agricultural wheeled tractors Rear-mounted threepoint linkage
Læs mereA multimodel data assimilation framework for hydrology
A multimodel data assimilation framework for hydrology Antoine Thiboult, François Anctil Université Laval June 27 th 2017 What is Data Assimilation? Use observations to improve simulation 2 of 8 What is
Læs mereIPv6 Application Trial Services. 2003/08/07 Tomohide Nagashima Japan Telecom Co., Ltd.
IPv6 Application Trial Services 2003/08/07 Tomohide Nagashima Japan Telecom Co., Ltd. Outline Our Trial Service & Technology Details Activity & Future Plan 2 Outline Our Trial Service & Technology Details
Læs mereSouth Baileygate Retail Park Pontefract
Key Details : available June 2016 has a primary shopping catchment of 77,000 (source: PMA), extending to 186,000 within 10km (source: FOCUS) 86,000 sq ft of retail including Aldi, B&M, Poundstretcher,
Læs mereSand ell survey December/November 2009
Technical University of Denmark Danish Institute for Fisheries Research Survey Cruise leader Date of depart Date of arrival NS Sandeel-survey Dirk C. Tijssen 12/11-2009 05/12-2009 Sand ell survey December/November
Læs merePortal Registration. Check Junk Mail for activation . 1 Click the hyperlink to take you back to the portal to confirm your registration
Portal Registration Step 1 Provide the necessary information to create your user. Note: First Name, Last Name and Email have to match exactly to your profile in the Membership system. Step 2 Click on the
Læs mereFoderstoffer. Bestemmelse af fedtindhold
Dansk Standard DS/ISO 6492 1. udgave Godkendt:1999-09-13 Foderstoffer. Bestemmelse af fedtindhold Animal feeding stuffs - Determination of fat content DANSK STANDARD - Eftertryk uden tilladelse forbudt
Læs mereByg din informationsarkitektur ud fra en velafprøvet forståelsesramme The Open Group Architecture Framework (TOGAF)
Byg din informationsarkitektur ud fra en velafprøvet forståelsesramme The Open Group Framework (TOGAF) Otto Madsen Director of Enterprise Agenda TOGAF og informationsarkitektur på 30 min 1. Introduktion
Læs mereInterim report. 24 October 2008
Interim report 24 October 2008 2 2008 Key figures July-September 2008 Net sales were SEK 3,690 m (3,748) Organic growth was 1% Operating profit (EBIT) declined by 32% to SEK 186 m (272). Negative currency
Læs mereRug danner store mængder af sekundære indholdsstoffer i kernen og under spiring af betydning for plantens forsvar og vores kost.
Rug danner store mængder af sekundære indholdsstoffer i kernen og under spiring af betydning for plantens forsvar og vores kost. Per L. Gregersen Fariha Tanwir Institut for Molekylærbiologi og Genetik
Læs mereCross-Sectorial Collaboration between the Primary Sector, the Secondary Sector and the Research Communities
Cross-Sectorial Collaboration between the Primary Sector, the Secondary Sector and the Research Communities B I R G I T T E M A D S E N, P S Y C H O L O G I S T Agenda Early Discovery How? Skills, framework,
Læs mereLinear Programming ١ C H A P T E R 2
Linear Programming ١ C H A P T E R 2 Problem Formulation Problem formulation or modeling is the process of translating a verbal statement of a problem into a mathematical statement. The Guidelines of formulation
Læs mereDifferential Evolution (DE) "Biologically-inspired computing", T. Krink, EVALife Group, Univ. of Aarhus, Denmark
Differential Evolution (DE) Differential Evolution (DE) (Storn and Price, 199) Step 1 - Initialize and evaluate Generate a random start population and evaluate the individuals x 2 search space x 1 Differential
Læs mereAppendix 1 Properties of Fuels
Appendix 1 Properties of Fuels S. McAllister et al., Fundamentals of Combustion Processes, Mechanical Engineering Series, DOI 10.1007/978-1-4419-7943-8, # Springer Science+Business Media, LLC 2011 243
Læs mereOvl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn
Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn Disposition: Flere fødselskomplikationer hos kvinder der har anvendt
Læs mereTask Force on European Standard Population. Eurostat, Unit F5 Monica Pace
Task Force on European Standard Population Eurostat, Unit F5 Monica Pace Background Current "Standard population" in use by Eurostat: WHO 'Standard population' of 1976 Main use is of that standard population:
Læs merePrivat-, statslig- eller regional institution m.v. Andet Added Bekaempelsesudfoerende: string No Label: Bekæmpelsesudførende
Changes for Rottedatabasen Web Service The coming version of Rottedatabasen Web Service will have several changes some of them breaking for the exposed methods. These changes and the business logic behind
Læs mereCohort of HBV and HCV Patients
Cohort of HBV and HCV Patients Emanuel K. Manesis, MD Professor of Medicine In 2003 the Hellenic Center for Disease Prevention & Control (HCDPC) started a cohort study of chronic HBV, HDV and HCV infection
Læs mereTrolling Master Bornholm 2014
Trolling Master Bornholm 2014 (English version further down) Den ny havn i Tejn Havn Bornholms Regionskommune er gået i gang med at udvide Tejn Havn, og det er med til at gøre det muligt, at vi kan være
Læs mereSustainable use of pesticides on Danish golf courses
Indsæt nyt billede: Sustainable use of pesticides on Danish golf courses Anita Fjelsted - Danish EPA Ministry of the Environment 27 May 2015 - STERF The Danish Environmental Protection Agency 450 employees
Læs mereReexam questions in Statistics and Evidence-based medicine, august sem. Medis/Medicin, Modul 2.4.
Reexam questions in Statistics and Evidence-based medicine, august 2013 2. sem. Medis/Medicin, Modul 2.4. Statistics : ESSAY-TYPE QUESTION 1. Intelligence tests are constructed such that the average score
Læs mereChallenges for the Future Greater Helsinki - North-European Metropolis
Challenges for the Future Greater Helsinki - North-European Metropolis Prof. Dr.-Ing. / M.A. soc. pol. HafenCity University Hamburg Personal introduction background: - urban and regional planning - political
Læs mereTrolling Master Bornholm 2015
Trolling Master Bornholm 2015 (English version further down) Panorama billede fra starten den første dag i 2014 Michael Koldtoft fra Trolling Centrum har brugt lidt tid på at arbejde med billederne fra
Læs mereTM4 Central Station. User Manual / brugervejledning K2070-EU. Tel Fax
TM4 Central Station User Manual / brugervejledning K2070-EU STT Condigi A/S Niels Bohrs Vej 42, Stilling 8660 Skanderborg Denmark Tel. +45 87 93 50 00 Fax. +45 87 93 50 10 info@sttcondigi.com www.sttcondigi.com
Læs mereApplication form for access to data and biological samples Ref. no
Application form for access to data and biological samples Ref. no 2015-24 Project title: Applicant: Other partners taking part in the project Names and work addresses: Are prenatal maternal stress associated
Læs mereDanish National Birth Cohort (DNBC)
Danish National Birth Cohort (DNBC) Application form for access to data and biological samples ref. 2011-32 Project title: Applicant: Betydning af feber under graviditeten for barnets motoriske udvikling
Læs mereBatchstyring Del 1: Modeller og terminologi
Dansk Standard DS/EN 61512-1 1. udgave 2001-08-29 Batchstyring Del 1: Modeller og terminologi Batch control Part 1: Models and terminology DS/EN 61512-1 København DS projekt: 26009 ICS: 25.040.40 Deskriptorer:
Læs mereLearnings from the implementation of Epic
Learnings from the implementation of Epic Appendix Picture from Region H (2016) A thesis report by: Oliver Metcalf-Rinaldo, oliv@itu.dk Stephan Mosko Jensen, smos@itu.dk Appendix - Table of content Appendix
Læs mereTDC 4 Indoor voltage transformers
Medium Voltage Product TDC 4 Indoor voltage transformers Highest voltage for equipment [kv] 3.6-12 Power frequency test voltage, 1 min. [kv] 10 - Lightning impulse test voltage [kv] Max. rated burden,
Læs mereAnsøgning om godkendelse af pesticider. Gælder fra 1. januar 2014.
TABLE 1. Plant protection s: Chemical Category Product (new or renewal) Produktansøgni nger (nye eller forny) Type type 1. DK is the examining member state (E.g. Zonal RMS, new as in Dk, me-too or renewal
Læs mereECE 551: Digital System * Design & Synthesis Lecture Set 5
ECE 551: Digital System * Design & Synthesis Lecture Set 5 5.1: Verilog Behavioral Model for Finite State Machines (FSMs) 5.2: Verilog Simulation I/O and 2001 Standard (In Separate File) 3/4/2003 1 ECE
Læs mereChlorine dioxide 50 T mg/l ClO 2 DPD / Glycine
Chlorine dioxide 50 T 0.05-1 mg/l ClO 2 DPD / Glycine 119 Instrument specific information The test can be performed on the following devices. In addition, the required cuvette and the absorption range
Læs mereGlobal carbon cycle studies with LPJ-GUESS
Navn oplægsholder Navn KUenhed Global carbon cycle studies with LPJ-GUESS Guy Schurgers University of Copenhagen Introduction LPJ-GUESS The dynamic ecosystem model LPJ-GUESS simulates biogeography (geographical
Læs mereSTRABAG SE Q results 31 May 2010
STRABAG SE Q1 2010 results 31 May 2010 Record order backlog, harsh winter Output volume ( m) 1,837-16.1% 2,190 13,021 Output volume / Revenue Harsh winter conditions and finalised projects in the Middle
Læs mereResource types R 1 1, R 2 2,..., R m CPU cycles, memory space, files, I/O devices Each resource type R i has W i instances.
System Model Resource types R 1 1, R 2 2,..., R m CPU cycles, memory space, files, I/O devices Each resource type R i has W i instances. Each process utilizes a resource as follows: request use e.g., request
Læs mereOXFORD. Botley Road. Key Details: Oxford has an extensive primary catchment of 494,000 people
OXFORD Key Details: Oxford has an extensive primary catchment of 494,000 people Prominent, modern scheme situated in prime retail area Let to PC World & Carpetright and close to Dreams, Currys, Land of
Læs mereDynamic Voltage and Frequency Management Based on Variable Update Intervals
Dynamic Voltage and Frequency Management Based on Variable Update Intervals for Frequency Setting Mehrdad Najibi Mostafa Salehi Ali Afzali Kusha Massoud Pedram S. Mehdi Fakhraie Hossein Pedram Presentation
Læs mereCS 4390/5387 SOFTWARE V&V LECTURE 5 BLACK-BOX TESTING - 2
1 CS 4390/5387 SOFTWARE V&V LECTURE 5 BLACK-BOX TESTING - 2 Outline 2 HW Solution Exercise (Equivalence Class Testing) Exercise (Decision Table Testing) Pairwise Testing Exercise (Pairwise Testing) 1 Homework
Læs mereDesign til digitale kommunikationsplatforme-f2013
E-travellbook Design til digitale kommunikationsplatforme-f2013 ITU 22.05.2013 Dreamers Lana Grunwald - svetlana.grunwald@gmail.com Iya Murash-Millo - iyam@itu.dk Hiwa Mansurbeg - hiwm@itu.dk Jørgen K.
Læs mereVina Nguyen HSSP July 13, 2008
Vina Nguyen HSSP July 13, 2008 1 What does it mean if sets A, B, C are a partition of set D? 2 How do you calculate P(A B) using the formula for conditional probability? 3 What is the difference between
Læs mereSKRIFTLIG EKSAMEN I NUMERISK DYNAMIK Bygge- og Anlægskonstruktion, 7. semester Torsdag den 19. juni 2003 kl Alle hjælpemidler er tilladt
SKRIFTLIG EKSAMEN I NUMERISK DYNAMIK Bygge- og Anlægskonstruktion, 7. semester Torsdag den 9. juni 23 kl. 9.-3. Alle hjælpemidler er tilladt OPGAVE f(x) x Givet funktionen f(x) x, x [, ] Spørgsmål (%)
Læs mereComplete Solutions for Epigenetics
Complete Solutions for Epigenetics DNA Methylation Chromatin & Transcription 3 4 5 6 7 8 8 9 10 10 10 11 11 12 12 13 13 14 15 15 17 18 18 Gene Expression & Silencing 19 19 DNA Damage & Repair Phosphorylation
Læs mereSport for the elderly
Sport for the elderly - Teenagers of the future Play the Game 2013 Aarhus, 29 October 2013 Ditte Toft Danish Institute for Sports Studies +45 3266 1037 ditte.toft@idan.dk A growing group in the population
Læs mereF o r t o l k n i n g e r a f m a n d a l a e r i G I M - t e r a p i
F o r t o l k n i n g e r a f m a n d a l a e r i G I M - t e r a p i - To fortolkningsmodeller undersøgt og sammenlignet ifm. et casestudium S i g r i d H a l l b e r g Institut for kommunikation Aalborg
Læs mereStatistik for MPH: oktober Attributable risk, bestemmelse af stikprøvestørrelse (Silva: , )
Statistik for MPH: 7 29. oktober 2015 www.biostat.ku.dk/~pka/mph15 Attributable risk, bestemmelse af stikprøvestørrelse (Silva: 333-365, 381-383) Per Kragh Andersen 1 Fra den 6. uges statistikundervisning:
Læs mereRoE timestamp and presentation time in past
RoE timestamp and presentation time in past Jouni Korhonen Broadcom Ltd. 5/26/2016 9 June 2016 IEEE 1904 Access Networks Working Group, Hørsholm, Denmark 1 Background RoE 2:24:6 timestamp was recently
Læs mereThe X Factor. Målgruppe. Læringsmål. Introduktion til læreren klasse & ungdomsuddannelser Engelskundervisningen
The X Factor Målgruppe 7-10 klasse & ungdomsuddannelser Engelskundervisningen Læringsmål Eleven kan give sammenhængende fremstillinger på basis af indhentede informationer Eleven har viden om at søge og
Læs mereFejlbeskeder i SMDB. Business Rules Fejlbesked Kommentar. Validate Business Rules. Request- ValidateRequestRegist ration (Rules :1)
Fejlbeskeder i SMDB Validate Business Rules Request- ValidateRequestRegist ration (Rules :1) Business Rules Fejlbesked Kommentar the municipality must have no more than one Kontaktforløb at a time Fejl
Læs mereOVERORDNEDE RETNINGSLINJER FOR INCITAMENTSAFLØNNING AF DIREKTIONEN LAND & LEISURE A/S
OVERORDNEDE RETNINGSLINJER FOR INCITAMENTSAFLØNNING AF DIREKTIONEN LAND & LEISURE A/S OVERORDNEDE RETNINGSLINJER FOR INCITAMENTSAFLØNNING AF DIREKTIONEN I LAND & LEISURE A/S 1 Indledning 1.1 Nærværende
Læs mere