Frøbårne sygdomme- Skadetærskler samt nye muligheder for diagnostik

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Frøbårne sygdomme- Skadetærskler samt nye muligheder for diagnostik"

Transkript

1 Frøbårne sygdomme- Skadetærskler samt nye muligheder for diagnostik Bent J. Nielsen DJF, Forskningscenter Flakkebjerg DanSeed Symposium Vissenbjerg 20. marts 2007

2 Baggrund Udsædsbårne sygdomme hyppige i visse år Manglende viden om regulering og forebyggelse Manglende bekæmpelsesmuligheder Analysemetoder langsomme og upræcise Skadetærskler fra konventionelle system (bejdseskadetærskler) Store mængder sædekorn kasseres pga. sygdomsforekomst

3 Tolerancer (grænseværdier, tærskler) Grænseværdi fastsat ud fra tre principper: Spirehæmmende Blad- og aksangreb Risiko for virkning opformering og spredning

4 Tolerancer for såsæd i DK Fastsat i DK i samarbejde mellem Landscentret, Plantedirektoratet og DJF Økologisk såsæd: Forekomst af vigtige udsædsbårne sygdomme må ikke overskride fastsatte grænser (tolerancer) Konventionel såsæd: Vejledende!

5 Ærtesyge Ascochyta kompleks: Phoma medicaginis var. pinodella, Ascochyta pisi Mycosphaerella pinodes

6 Tab ved udsåning af udsæd med ærtesyge Konventionelle ærteforsøg forsøg, Landscentret 5 pct. frø med ærtesyge 10 pct. frø med ærtesyge 15 pct. frø med ærtesyge 20 pct. frø med ærtesyge 25 pct. frø med ærtesyge Tab, kr/ha Høj korrelation mellem ærtesyge og udbyttetab: 0,15 % tab pr. % ærtesyge Alternativ til dansk udsæd er import. Import af udsæd: + 40 kr/hkg eller + 96 kr/ha (udsædsmængde 240 kg/ha)

7 Tolerancer i ærter Fremavl: Konstateret forekomst Brugsærter: 5 % Ærter til helsæd 10 % Hvis der ikke kan skaffes udsæd der opfylder disse grænser udvides tolerancen til 20 % (gældende brancheaftale)

8 Stinkbrand: Stort potentiale for opformering og spredning Kvalitet og udbytte

9 Sammenhæng mellem smitte på kerner og markangreb Forsøg ved DJF ,0 % stinkbrand i mark 10,0 1, ,1 antal sporer/g hvede

10 Stinkbrand 1. År: 3 brandaks/10 m 2 0,04 % 100 sporer/g hvede (høst) 2. År: 40 brandaks/10 m 2 0,5 % Lugtgrænse: Ca. 300 sporer/g Ca sporer/g hvede (høst) Johnsson, 1991

11 Økologiske hvedepartier med konstateret forekomst af stinkbrand 40 % hvedepartier med stinkbrand Vårhvede Vinterhvede

12 Tolerancer for stinbkbrand C1 C2 T. caries 0 >10 sporer/g (Ændret fra 0) Tolerance bibeholdes Forekommer relativt hyppigt Nul-tolerance?

13 Hvedebrunplet Døde spirer Svag eller forkrøblet spire Forsinket fremspiring Svækkede planter Risiko for udvintringsskade

14 Smittevej

15 Bygbladplet Drechslera teres

16 Bygbladplet: Introduktion of sygdommen på nye arealer

17 sort & år % angrebne planter sort & år % smittede kerne Sammenhæng mellem smittede kerne og primær angreb i marken (% angrebne planter)

18 Tolerancer for bygbladplet C1 C2 D. teres % Forslag om sortsafhængig tolerance: Fuldt modtagelige sorter (PVO 3) 5 % Modtagelig moderat resistene sorter (PVO 1-2) 15% Resistente sorter (PVO 0) 25%

19 Tolerancer i hvede. OVERSIGT C1 C2 Stinkbrand 0 >10 sporer Brunplet 15 % 15 % Fusariose 15 % 15 % Vinterhvede 30 % 30 % Vårhvede

20 Tolerancer i byg. OVERSIGT C1 C2 Stribesyge 0 5 % Bladplet 5/15/25 % 5/15/25 % Nøgen brand Spore 2 % Fusariose 15 % 15 % Vinterbyg 30 % 30 % Vårbyg

21 Nye diagnosemetoder til udsædsbårne sygdomme Hurtigere og mere specifikke analysemetoder til udsædsbårne sygdomme

22 Usædsbårne sygdomme i byg Pyrenophora graminea Imperfect: Drechslera graminea Pyrenophora teres Imperfect: Drechslera teres

23 Konventionel test for Pyrenophora sp. Fryse-blotter metode, 7 døgn Væksthustest 4-5 uger

24 Udvikling af PCR metode P. graminea P. teres teres others K. Husted, 1993 GGGCCACAGTTGGAAACAGCTGCCGAGACCATAC CTCCATGACGTTTTCGCGCCGTGGTGCGTCAAGC GTTTCTTCCACAGTTTCGCAATCTTGATTATTGG TGCCCTTCTTTCGTTTGTTCGAGAAAGATGAGCC ACTAGCTTCACATGCGACCAAACCCACCCTTTTT CGCTTGAATGCCTGTGGCTGCCGCGTCTCTTGTT TGTGGCACAATCTAGCCAAGGTTTTCACAAATCG TATCCGGGCTTTGTCGTCCTGAATCGGCTTGAAG AGCATGCCAGCGATGGTACCTCGCTCCTGAAGTT CAAACTCAACGGCTGGTAGCGTCAGGACTTTGTC TGCGGCCATCCCGCTGAGTTGCCTGGCTATCTCG ATTGTGTCGATCGATTCATGGAACTCGCGGACGG CCGATTCTAATCGTTCTCTGTACAATCTCTGGTA TGTACTGCAATCTTTCGCTTCGTATCCTCGTATT TCTTATAAAGATCCGTCCCTTCAC P. graminea P. teres teres/maculata

25 Kvantificering af P. graminea DNA Fluorescence Cycle 1 Cycle 3 Cycle 5 Cycle 7 Cycle 9 Cycle 11 Cycle 13 Cycle 15 Cycle 17 Cycle 19 Cycle 21 Cycle 23 Cycle 25 Cycle 27 Cycle 29 Cycle 31 Cycle 33 Cycle 35 Cycle 37 Cycle Quantitative relationship between amount of starting target sample and amount of PCR product Cycle number 8 ng 800 pg 80 pg 8 pg 0.8 pg 10-fold dilution series

26 Sammenhæng mellem mængden af DNA og antallet af inficerede kerner

27 Sammenhæng mellem mængden af DNA og antallet af inficerede planter

28 Kassationsprocenter i økologisk udsæd af vårbyg med bladplet/stribesyge År Kass. % u. PCR Kass. % m. PCR PCR ikke anvendt PCR ikke anvendt Nielsen 2005, Planteavlsorientering Nr

29 Spireskadende svampe Fusarium graminearum Fusarium culmorum Fusarium avenaceum Microdochium nivale

30 Sammenhæng mellem konventionel/ PCR metode og fremspiring % fremspiring i mark % inficerede kerner (konventionel test) Fusarium/Microdochium DNA (PCR test)

31 Multiplex detektion med DNA-chip Cy3 Spot ~200 µm NH2-TTTTTTTTTTAGTCCTGCTGCACTCCCCAAATA NH2-TTTTTTTTTTAGTCCTGCTGCACTCCCCAAATA NH2-TTTTTTTTTTAGTCCTGCTGCACTCCCCAAATA TCAGGACGACGTGAGGGGTTTAT NH2-TTTTTTTTTTAGTCCTGCTGCACTCCCCAAATA NH2-TTTTTTTTTTAGTCCTGCTGCACTCCCCAAATA

32 Hybridiseringsresultater F. poae F. avenaceum F. graminearum F. graminearum specifikke prober

33 Hybridiseringsresultater F. poae F. avenaceum F. graminearum F. avenaceum specifikke prober

34 Multispektral visionmåling af korn og frø udvikling af billedanalyseteknik til bestemmelse af forekomst af frøbårne sygdomme kvalitetsegenskaber hos korn og frø, herunder også Fusariumtoksiner, vitalitet, spireevne

Bent J. Nielsen DJF, Århus Universitet

Bent J. Nielsen DJF, Århus Universitet Økologisk udsæd med fokus på udsædsbårne sygdomme Bent J. Nielsen DJF, Århus Universitet DanSeed Symposium Kobæk Strand 8 marts 2010 Økologisk udsæd Større udviklings- og forskningsindsats i forbindelse

Læs mere

Skadetærskler for bygbladplet, stribesyge og spiringsfusariose

Skadetærskler for bygbladplet, stribesyge og spiringsfusariose Skadetærskler for bygbladplet, stribesyge og spiringsfusariose ans O. Pinnschmidt, DF, Flakkebjerg ans.pinnschmidt@agrsci.dk inficeret såsæd reduceret fremspiring Fusarium spp. M. nivale reduceret plantevækst

Læs mere

Bejdsning af hvede og raps samt nyt om resistensudvikling mod skadegørere. Ghita Cordsen Nielsen, Videncentret for Landbrug, Skejby

Bejdsning af hvede og raps samt nyt om resistensudvikling mod skadegørere. Ghita Cordsen Nielsen, Videncentret for Landbrug, Skejby Bejdsning af hvede og raps samt nyt om resistensudvikling mod skadegørere Ghita Cordsen Nielsen, Videncentret for Landbrug, Skejby Fusarium angrebne hhv. uangrebne planter 2... 20. november 2014 Forsøg

Læs mere

Skadevoldere i økologisk produktion af bælgplanter

Skadevoldere i økologisk produktion af bælgplanter Skadevoldere i økologisk produktion af bælgplanter Ghita Cordsen Nielsen Landscentret, Skejby Workshop, den 4. december 2003 Svampesygdomme i ærter Sædskiftesygdomme: Ærterodråd (Aphanomyces) Sct. Hanssyge

Læs mere

Gulrust i hvede - nuværende og kommende udfordringer

Gulrust i hvede - nuværende og kommende udfordringer Gulrust i hvede - nuværende og kommende udfordringer Mogens S Hovmøller, Annemarie F Justsen & Jens G Hansen Aarhus Universitet, Institut for Agroøkologi Det Globale Rustcenter mogens.hovmoller@agrsci.dk

Læs mere

Strategier til regulering af udsædsbårne sygdomme i økologisk jordbrug

Strategier til regulering af udsædsbårne sygdomme i økologisk jordbrug This test is downloaded from the homepage of Anders Borgen (http//:www.agrologica.dk/anders.htm) Please consult his list of publications (http//:www.agrologica.dk/pub-list.htm) for reference of the publication

Læs mere

3. Bekæmpelse af septoria med triazoler og triazolblandinger

3. Bekæmpelse af septoria med triazoler og triazolblandinger 3. Bekæmpelse af septoria med triazoler og triazolblandinger Bekæmpelse af septoria Forskellige midler blev afprøvet imod bekæmpelse af septoria i 2010. Forsøgene var også tilsigtet til at vurdere effekten

Læs mere

Økologisk blandsæd. Markplan/sædskifte

Økologisk blandsæd. Markplan/sædskifte Side 1 af 5 Økologisk blandsæd Samdyrkning af korn og bælgsæd kan have flere formål: Dyrkning af proteinrigt foder. Dyrkning af bælgsæd med større dyrkningssikkerhed. Fremavl af ærter med mindre risiko

Læs mere

AARHUS UNIVERSITET. 4 oktober, SEED - High Quality Seed. Maintaining Integrity in Organic Farming. seedp

AARHUS UNIVERSITET. 4 oktober, SEED - High Quality Seed. Maintaining Integrity in Organic Farming. seedp - High Quality Seed Maintaining Integrity in Organic Farming seedp Problemstilling Utilstrækkelig forsyning af økologisk udsæd Kvantitet (triticale, ærter, roer, majs, hvidkløver) Kvalitet (bælgsæd, hvede

Læs mere

GRAINLEG Bælgsæd i økologisk dyrkningforbedring

GRAINLEG Bælgsæd i økologisk dyrkningforbedring GRAINLEG 20022005 Bælgsæd i økologisk dyrkningforbedring af sygdomsresistens Birgit Jensen og Lars Bødker, DJF Flakkebjerg Bjarne Jørnsgård, KVL Jens Chr. Knudsen, Toft Planteforædling WP2 Specificitet

Læs mere

STORKNOLDET KNOLDBÆGERSVAMP

STORKNOLDET KNOLDBÆGERSVAMP 14. JANUAR 2014 STORKNOLDET KNOLDBÆGERSVAMP (SCLEROTINIA SCLEROTIORUM) KAN PCR-TEST FORUDSIGE ANGREB? BENT J. NIELSEN & ANNEMARIE FEJER JUSTESEN, AGROØKOLOGI UNI VERSITET Storknoldet knoldbægersvamp (Sclerotinia

Læs mere

Grøn Viden. Ramularia-bladplet på byg. Danmarks JordbrugsForskning. Ministeriet for Fødevarer, Landbrug og Fiskeri

Grøn Viden. Ramularia-bladplet på byg. Danmarks JordbrugsForskning. Ministeriet for Fødevarer, Landbrug og Fiskeri Grøn Viden Ramularia-bladplet på byg Hans O. Pinnschmidt og Mogens S. Hovmøller, Afdeling for Plantebeskyttelse, Forskningscenter Flakkebjerg Ministeriet for Fødevarer, Landbrug og Fiskeri Danmarks JordbrugsForskning

Læs mere

Fusarium i korn. Ghita Cordsen Nielsen Landbrugets Rådgivningscenter Skejby

Fusarium i korn. Ghita Cordsen Nielsen Landbrugets Rådgivningscenter Skejby Fusarium i korn Ghita Cordsen Nielsen Landbrugets Rådgivningscenter Skejby Aksfusarium i hvede Fusarium i hvede Pct. kerner med Fusarium 8 6 4 2 0 2 2,5 mm 2,5 2,75 mm 2,75 3 mm > 3 mm (Piorr, 1991) Aksfusarium

Læs mere

Økologisk og GMI-fri såsæd

Økologisk og GMI-fri såsæd Forskning i økologisk jordbrug Nyhedsbrev fra Forskningscenter for Økologisk Jordbrug, FØJO marts/april 2001 4. Årgang nr. 2 Økologisk og GMI-fri såsæd I efteråret 2000 blev der i finanslovsforliget for

Læs mere

Seedron 1000 L. Svampemiddel. Svampemiddel UN 3082 ADVARSEL OG FØRSTEHJÆLP BRUGSANVISNING

Seedron 1000 L. Svampemiddel. Svampemiddel UN 3082 ADVARSEL OG FØRSTEHJÆLP BRUGSANVISNING Seedron Seedron Svampemiddel Må kun anvendes til bejdsning af korn i lukkede industrielle anlæg. Gældende fra 26. november 2015: Dette plantebeskyttelsesmiddel må kun købes af professionelle og anvendes

Læs mere

Bygbladplet, biologi og bekæmpelse

Bygbladplet, biologi og bekæmpelse Markbrug nr. 289 marts 2004 Bygbladplet, biologi og bekæmpelse Lise Nistrup Jørgensen, Hans Pinnschmidt og Bent J. Nielsen Afdeling for Plantebeskyttelse, Forskningscenter Flakkebjerg Ghita Cordsen Nielsen

Læs mere

B1: Fantastiske efterafgrøder og kåring af årets efterafgrødefrontløber

B1: Fantastiske efterafgrøder og kåring af årets efterafgrødefrontløber B1: Fantastiske efterafgrøder og kåring af årets efterafgrødefrontløber Projektets formål: At få økologiske landmænd til at udnytte efterafgrøders potentiale maksimalt for at få: * en bedre økonomi i økologisk

Læs mere

Erfaringer fra 2011 og. strategier for planteværn 2012

Erfaringer fra 2011 og. strategier for planteværn 2012 Erfaringer fra 2011 og strategier for planteværn 2012 Ved Ditte Clausen Korn: Disposition Svampesprøjtning i hvede, inkl. hvedebladplet Sadelgalmyg Raps: Erfaringer med angreb af glimmerbøsser i 2011 Nye

Læs mere

Konsulenttræf Nov 2017 Ditte Clausen

Konsulenttræf Nov 2017 Ditte Clausen Konsulenttræf Nov 2017 Ditte Clausen Agenda Rapsrødsot Opsummering fra sidste års emne Hvad viser DEKALBS europæiske projekt fra 2017? Kransskimmel Hvad betyder sygdommen for udbyttet? Hvad betyder sortsvalget?

Læs mere

Septoria i hvede alternative bekæmpelsesmetoder

Septoria i hvede alternative bekæmpelsesmetoder MARKBRUG NR. 216 DECEMBER 1999 Septoria i hvede alternative bekæmpelsesmetoder 1 Sygdomskomplekset Septoria består af 2 sygdomme som angriber hvede: Hvedegråplet (Septoria tritici) og hvedebrunplet (Stagonospora

Læs mere

Focus på udbyttejagt - tænk anderledes. DLG VækstForum 2013 v/jakob Skodborg-Jensen

Focus på udbyttejagt - tænk anderledes. DLG VækstForum 2013 v/jakob Skodborg-Jensen Focus på udbyttejagt - tænk anderledes 1 DLG VækstForum 2013 v/jakob Skodborg-Jensen Gefion s Planteavlsmøde - d. 22.11.2012 Set focus på udbyttejagt! Afgrødernes værdi forøget med ~1.300.000 kr. hos en

Læs mere

vårsæd og efterafgrøder

vårsæd og efterafgrøder vårsæd og efterafgrøder økologi produktinformation 2015 Stærkt sortiment af økologisk vårsæd og efterafgrøder Læs mere om sorterne og deres dyrkningsegenskaber Danish vårbyg agros kvægfoderprogram 2014

Læs mere

Hestebønne. Markplan/sædskifte. Etablering

Hestebønne. Markplan/sædskifte. Etablering Side 1 af 5 Hestebønne Der findes hestebønnesorter til både vår- og efterårssåning. Denne dyrkningsvejledning omhandler kun vårsåede hestebønner. Hestebønne dyrkes normalt til foderbrug. Afgrøden anvendes

Læs mere

det stærkeste svampemiddel til byg

det stærkeste svampemiddel til byg 2006 det stærkeste svampemiddel til byg slut med tankblanding beskytter mod sygdomme og stress optimerer udbytte og kvalitet The Chemical Company Svampebekæmpelse i byg betaler sig..! Opera Opera er det

Læs mere

Bekæmpelsestærskler for svampesygdomme

Bekæmpelsestærskler for svampesygdomme Bekæmpelsestærskler for svampesygdomme Nedenfor ses en oversigt over vejledende bekæmpelsestærskler for sygdomme i korn. Tærsklerne er fra Planteværn Online og disse tærskler er relativt godt belyst. Tærsklerne

Læs mere

Rapport vedrørende græsrodsforskningsprojekt: Sprøjtning med mælk til bekæmpelse af meldug

Rapport vedrørende græsrodsforskningsprojekt: Sprøjtning med mælk til bekæmpelse af meldug Rapport vedrørende græsrodsforskningsprojekt: Sprøjtning med mælk til bekæmpelse af meldug Ringe den 25.oktober 2001 J.nr.93S-2462-Å00-00891 Ved Freddy Madsen, Nørhavegård, Rudkøbing og økologikonsulent

Læs mere

Efterafgrøder. Lovgivning. Hvor og hvornår. Arter af efterafgrøder

Efterafgrøder. Lovgivning. Hvor og hvornår. Arter af efterafgrøder Side 1 af 6 Efterafgrøder Ved efterafgrøder forstås her afgrøder, der dyrkes med henblik på nedmuldning i jorden. Efterafgrøderne dyrkes primært for at reducere tab af specielt kvælstof, svovl og på sandjord

Læs mere

Det Europæiske Fællesskab og Ministeriet for Fødevarer, Landbrug og Fiskeri har deltaget i finansieringen af projektet.

Det Europæiske Fællesskab og Ministeriet for Fødevarer, Landbrug og Fiskeri har deltaget i finansieringen af projektet. Det Europæiske Fællesskab og Ministeriet for Fødevarer, Landbrug og Fiskeri har deltaget i finansieringen af projektet. Nye svampemidler i korn 2010 1,5 l Ceando = 1,0 l Opus + 0,5 l Flexity 1,0 l Prosaro

Læs mere

Kernemajs dyrkning og fodring i praksis

Kernemajs dyrkning og fodring i praksis Kernemajs dyrkning og fodring i praksis Af Planteavlskonsulent Hans Kristian Skovrup, Sønderjysk Landboforening Svineproduktionsrådgiver Jes Callesen, Syddansk Svinerådgivning Kongres 26. oktober 2010,

Læs mere

Relevante afgrøder i økologisk produktion Økologikonsulent Lars Egelund Olsen

Relevante afgrøder i økologisk produktion Økologikonsulent Lars Egelund Olsen Producentsammenslutningen Det Økologiske Akademi Relevante afgrøder i økologisk produktion Økologikonsulent Lars Egelund Olsen Hvordan adskiller afgrødevalget hos økologer sig fra det konventionelle? 2...

Læs mere

vårsæd og efterafgrøder

vårsæd og efterafgrøder vårsæd og efterafgrøder produktinformation 2015 Stærkt sortiment af vårsæd og efterafgrøder Læs mere om sorterne og deres dyrkningsegenskaber Danish vårbyg agros kvægfoderprogram 2014 Evergreen Unik sundhed

Læs mere

Clonostachys rosea en svamp, der kan bekæmpe sygdomme i korn

Clonostachys rosea en svamp, der kan bekæmpe sygdomme i korn Clonostachys rosea en svamp, der kan bekæmpe sygdomme i korn Birgit Jensen Hans Jørgen Lyngs Jørgensen Institut for Plante- og Miljøvidenskab 2 Hvad er mikrobiologisk plantebeskyttelse? Brug af gavnlige

Læs mere

Foders klimapåvirkning

Foders klimapåvirkning Foders klimapåvirkning Fodringsseminar 2010 Torsdag d. 15. april, Herning Søren Kolind Hvid, Planteproduktion Det Europæiske Fællesskab ved Den Europæiske Fond for Udvikling af Landdistrikter og Ministeriet

Læs mere

HAVRERØDSOT: HVORDAN KAN DET UNDGÅS? ERFARINGER FRA SÆSONEN 2014/2015

HAVRERØDSOT: HVORDAN KAN DET UNDGÅS? ERFARINGER FRA SÆSONEN 2014/2015 Webinar 10. december kl. 9.15 GHITA CORDSEN NIELSEN, GCN@SEGES.DK HAVRERØDSOT: HVORDAN KAN DET UNDGÅS? ERFARINGER FRA SÆSONEN 2014/2015 Integreret plantebeskyttelse (IPM) er at fremme en bæredygtig anvendelse

Læs mere

Producentsammenslutningen Det Økologiske Akademi. Dyrkning af korn til foder og konsum og frøgræs

Producentsammenslutningen Det Økologiske Akademi. Dyrkning af korn til foder og konsum og frøgræs Producentsammenslutningen Det Økologiske Akademi Dyrkning af korn til foder og konsum og frøgræs Korn til foder og konsum Havre Vårbyg Vårhvede Vårtriticale Rug Vintertriticale Vinterhvede (Spelt, emmer,

Læs mere

Plantebeskyttelse i økologisk jordbrug. Workshop på Forskningscenter Flakkebjerg 9. december 1998 i samarbejde med FØJO

Plantebeskyttelse i økologisk jordbrug. Workshop på Forskningscenter Flakkebjerg 9. december 1998 i samarbejde med FØJO Plantebeskyttelse i økologisk jordbrug Workshop på Forskningscenter Flakkebjerg 9. december 1998 i samarbejde med FØJO Program 9:00 Velkomst 9:15 Forskning i plantebeskyttelse Ilse A. Rasmussen 9:45 Problemer

Læs mere

ØKOLOGISK PLANTEAVLSBERETNING

ØKOLOGISK PLANTEAVLSBERETNING ØKOLOGISK PLANTEAVLSBERETNING 2008 Øklgisk rådgivning Brug af egen såsæd i øklgisk jrdbrug af Anders Brgen Der har i den danske landbrugspresse i smmeren 2008 været en debat m frdele g ulemper ved anvendelse

Læs mere

Dét skal vi forholde os til i 2017

Dét skal vi forholde os til i 2017 Dét skal vi forholde os til i 2017 1 Fungicideffekt mod septoria i 2006 % effekt (vurderet på de 2 øverste blade i st. 65-73) 100 90 80 70 60 Septoria DJF 2006 Semi-field forsøg Uddrag ¾ dosering Sort:

Læs mere

Ny dværgsort er den højestydende i 2008

Ny dværgsort er den højestydende i 2008 sorter Ny dværgsort er den højestydende i 2008 Dværgsorten Buggy har i årets landsforsøg givet hele 13 procent i merudbytte i forhold til målesorten Pergamon. Sidste års højestydende sort, Dominik, har

Læs mere

Det økonomiske økosædskifte

Det økonomiske økosædskifte Det økonomiske økosædskifte Peter Mejnertsen og Michael Tersbøl Emner i præsentationen: Økonomisk vurdering af sædskifterne Betydningen af dyrkningsfaktorer Bekæmpelse af rodukrudt økonomisk set Forslag

Læs mere

Landskonsulent Ghita Cordsen Nielsen

Landskonsulent Ghita Cordsen Nielsen Nyt fra Landsforsøgene: Strategier for bekæmpelse af svampe og skadedyr i korn, raps og majs Landskonsulent Ghita Cordsen Nielsen Det Europæiske Fællesskab ved Den Europæiske Fond for Udvikling af Landdistrikter

Læs mere

Korndyrkningsdag DLG/DLS

Korndyrkningsdag DLG/DLS Korndyrkningsdag DLG/DLS v/ planteavlskonsulent Bent Buchwald bbu@dlsyd.dk - 54840984 Agerrævehale - kommet for at blive - værre? Program Resistent ukrudt hvor langt er vi? Tokimbladet ukrudt Græsukrudt

Læs mere

GØDSKNING OG VÆKSTREGULERING

GØDSKNING OG VÆKSTREGULERING GØDSKNING OG VÆKSTREGULERING Indeholder uddrag fra SEGES Per Skodborg Nielsen, planterådgiver UDFASNING AF UNDERGØDSKNING RÅPROTEIN I KORN 1998-2015 MERVÆRDI AF 1 % MERE PROTEIN Kr. pr. 100 kg Soya Hvedepris,kr.

Læs mere

Sund jord for et sundt liv. Sæt fokus på bundlinjen!

Sund jord for et sundt liv. Sæt fokus på bundlinjen! Sund jord for et sundt liv Sæt fokus på bundlinjen! Torben Nielsen & Trine Leerskov Onsdag d. 2. november 2016 Producerede grise pr årsso Udvikling i svineproduktionen 32 30 28 26 24 22 20 2000 2001 2002

Læs mere

Nordic Field Trial System Version: 1.0.0.17002

Nordic Field Trial System Version: 1.0.0.17002 Nordic Field Trial System Version: 1.0.0.17002 020200808 Gødskning af vårsæd, forfrugt kløvergræs Til Oversigt Landscentret, Planteavl Udkærsvej 15, Skejby 8200 Århus N. Forsøgsplanen er sidst opdateret

Læs mere

Nyt til sæsonen Strategi mod svampesygdomme i korn Opera i majs

Nyt til sæsonen Strategi mod svampesygdomme i korn Opera i majs Nyt til sæsonen Strategi mod svampesygdomme i korn Opera i majs Ny vækstregulator Forventes godkendt til 2012 Aktive stoffer: prohexadione-ca (50 g/l) + mepiquat chlorid (300 g/l) Afgrøder: Dosering: vinterhvede,

Læs mere

Lise Nistrup Jørgensen, Bent J. Nielsen, Helene Saltoft Kristjansen, Hans-Peter Madsen & Hans Hansen

Lise Nistrup Jørgensen, Bent J. Nielsen, Helene Saltoft Kristjansen, Hans-Peter Madsen & Hans Hansen 2 Sygdomsangreb 2013 Lise Nistrup Jørgensen, Bent J. Nielsen, Helene Saltoft Kristjansen, Hans-Peter Madsen & Hans Hansen I dette afsnit nævnes fortrinsvis, hvilke forekomster der har været af svampesygdomme

Læs mere

Aksfusarium i korn. Danmarks JordbrugsForskning MARKBRUG

Aksfusarium i korn. Danmarks JordbrugsForskning MARKBRUG MARKBRUG NR. 219 MARTS 2000 Aksfusarium i korn I Danmark optræder svampesygdommen aksfusarium med års mellemrum med betydende angreb i korn. Disse angreb kan påvirke kornets udbytte, kvalitet og lagerstabilitet.

Læs mere

HØR HVORDAN DU UNDGÅR PLAGSOMME UKRUDTSARTER. NYE ARTER SOM EKSEMPELVIS VÆSELHALE SPREDER SIG VOLDSOMT I DISSE ÅR.

HØR HVORDAN DU UNDGÅR PLAGSOMME UKRUDTSARTER. NYE ARTER SOM EKSEMPELVIS VÆSELHALE SPREDER SIG VOLDSOMT I DISSE ÅR. Webinar 4. december kl. 9.15 LANDSKONSULENT POUL HENNING PETERSEN HØR HVORDAN DU UNDGÅR PLAGSOMME UKRUDTSARTER. NYE ARTER SOM EKSEMPELVIS VÆSELHALE SPREDER SIG VOLDSOMT I DISSE ÅR. Integreret plantebeskyttelse

Læs mere

MULIGHEDER FOR AT FOREBYGGE ANGREB AF SYGDOMME OG SKADEDYR I VINTERRAPS

MULIGHEDER FOR AT FOREBYGGE ANGREB AF SYGDOMME OG SKADEDYR I VINTERRAPS Webinar 5. november kl. 9.15 SPECIALKONSULENT MARIAN D. THORSTED MULIGHEDER FOR AT FOREBYGGE ANGREB AF SYGDOMME OG SKADEDYR I VINTERRAPS Integreret plantebeskyttelse (IPM) er at fremme en bæredygtig anvendelse

Læs mere

Hvede. Ingen regulering Fradrag: kr. 0,45 pr. 0,1% under 11,5% Afregnes som foderhvede Faldtal 250 225 250 og derover 249 225: 224 og derunder

Hvede. Ingen regulering Fradrag: kr. 0,45 pr. 0,1% under 11,5% Afregnes som foderhvede Faldtal 250 225 250 og derover 249 225: 224 og derunder HØSTINFO 2015 Hvede Brødhvede/vårhvede Handles individuelt mellem køber og sælger og på individuelle kontraktkrav til kvalitet og er derfor ikke omfattet af nærværende afregningsaftale. Eksporthvede Protein,

Læs mere

Ukrudtsbekæmpelse i økologisk jordbrug

Ukrudtsbekæmpelse i økologisk jordbrug Ukrudtsbekæmpelse i økologisk jordbrug Ilse A. Rasmussen Afd. for Plantebeskyttelse og Skadedyr Forskningscenter Flakkebjerg Danmarks JordbrugsForskning Frøukrudt Mekanisk ukrudtsbekæmpelse Afgrøde/ ukrudt

Læs mere

Nihal Tissera & Merete Halkjær Olesen

Nihal Tissera & Merete Halkjær Olesen Nihal Tissera & Merete Halkjær Olesen Blind seed disease (Gloeotinia temulenta) kan angribe 56 græsarter Kan skade spireevnen i rajgræs og strandsvingel Kun blomsterne og frøene angribes Der er ingen symptomer

Læs mere

Hvad siger landsforsøgene om udbytter i hestebønne og dyrkningsøkonomi? Landskonsulent Søren Kolind Hvid Videncentret for Landbrug

Hvad siger landsforsøgene om udbytter i hestebønne og dyrkningsøkonomi? Landskonsulent Søren Kolind Hvid Videncentret for Landbrug Hvad siger landsforsøgene om udbytter i hestebønne og dyrkningsøkonomi? Landskonsulent Søren Kolind Hvid Videncentret for Landbrug Hvorfor dyrke hestebønner? God vekselafgrøder forfrugtsværdi Proteinkilde

Læs mere

Svampestrategi 2017 Dit nettoudbytte

Svampestrategi 2017 Dit nettoudbytte Svampestrategi 2017 Dit nettoudbytte Hkg/ha 14 12 10 8 Bruttomerudbytter for svampebekæmpelse i mest dyrkede hvedesorter, landsforsøg i vinterhvede Omkostninger til delt akssprøjtning med samlet 75 procent

Læs mere

DanSeed Symposium Den 20. og 21. marts 2007

DanSeed Symposium Den 20. og 21. marts 2007 DanSeed Symposium Den 20. og 21. marts 2007 Vissenbjerg Storkro, Søndersøvej 30, 5492 Vissenbjerg Sted DanSeed Symposium afholdes den 20. og 21. marts 2007 på: Vissenbjerg Storkro Søndersøvej 30 5492 Vissenbjerg

Læs mere

Oversigt over Landsforsøgene 2014

Oversigt over Landsforsøgene 2014 Oversigt over Landsforsøgene 2014 vfl.dk Oversigt over Landsforsøgene 2014 Forsøg og undersøgelser i Dansk Landbrugsrådgivning Samlet og udarbejdet af LANDBRUG & FØDEVARER, PLANTEPRODUKTION ved chefkonsulent

Læs mere

Planteavl Planteavlskonsulent Torben B Hansen Virksomhedsrådgiver Jørgen Cæsar Jensen

Planteavl Planteavlskonsulent Torben B Hansen Virksomhedsrådgiver Jørgen Cæsar Jensen Planteavl 2016 Planteavlskonsulent Torben B Hansen Virksomhedsrådgiver Jørgen Cæsar Jensen Program Planteavl 2016 Regnskabstal Afgrødepriser Økonomi salgsafgrøder Økonomi grovfoder Udvikling udbytte Effekt

Læs mere

Sortben og nedvisningsmetoder. Endelig Rapport 2014

Sortben og nedvisningsmetoder. Endelig Rapport 2014 Sortben og nedvisningsmetoder Endelig Rapport 2014 Skrevet af: Henrik Pedersen og Claus Nielsen AKV Langholt AmbA Gravsholtvej 92 9310 Vodskov Indhold Resumé... 3 Baggrund... 4-5 Gennemførelse af forsøg...

Læs mere

Bedre plantesorter til økologisk jordbrug

Bedre plantesorter til økologisk jordbrug Bedre plantesorter til økologisk jordbrug Sven B. Andersen, Københavns Universitet Lars H. Jacobsen, Aarhus Universitet Thomas H. Thomsen, Landbrugets Kartoffelfond Christian S. Jensen, DLF-Trifolium Morten

Læs mere

Foreningen af Danske Handelsmøller Association of Danish Millers - Association Danoise de Meunerie

Foreningen af Danske Handelsmøller Association of Danish Millers - Association Danoise de Meunerie B R Ø D K O R N Møllernes anbefalinger og kvalitetskrav 2009 Foreningen af Danske Handelsmøller Association of Danish Millers - Association Danoise de Meunerie Brødkornskvalitet De vigtigste arter af korn

Læs mere

Går jorden under? Kvælstofforsyningen på økologiske plantebedrifter

Går jorden under? Kvælstofforsyningen på økologiske plantebedrifter Går jorden under? det historiske perspektiv og menneskets rolle Kvælstofforsyningen på økologiske plantebedrifter Professor Jørgen E. Olesen Kilder til kvælstofforsyningen i økologisk planteavl Deposition

Læs mere

Økologisk planteavl uden husdyrgødning Af Jesper Hansen

Økologisk planteavl uden husdyrgødning Af Jesper Hansen Økologisk planteavl uden husdyrgødning Af Jesper Hansen Debatten vedrørende anvendelse af ikke økologisk gødning på økologiske bedrifter har ligget stille i en periode. Der er dog ingen tvivl om, at det

Læs mere

Optimeret brug af svampemidler i korn

Optimeret brug af svampemidler i korn Optimeret brug af svampemidler i korn AgroPro Planteavlsdag Comwell 31. Januar 2018 v/hans Jørgen Bak, agropro Historiske merudbytter i 2017 Ikke set større siden 1998 Skyldes det fugtige år, med stort

Læs mere

Hundegræs til frø. Jordbund. Markplan/sædskifte. Etablering

Hundegræs til frø. Jordbund. Markplan/sædskifte. Etablering Side 1 af 5 Hundegræs til frø Formålet med dyrkning af hundegræs er et stort frøudbytte med en høj spireprocent, og frø som er fri for ukrudt. Hundegræs er langsom i udvikling i udlægsåret, hvorimod den

Læs mere

VINTERHVEDE (MED PLØJNING)

VINTERHVEDE (MED PLØJNING) IPM VINTERHVEDE (MED PLØJNING) REV. MAJ JUNI 2016 2016 Dyrk ikke hvede efter hvede på let sandjord. Risikoen for angreb af goldfodsyge er stor ved kontinuerlig dyrkning af vinterhvede på de lettere jordtyper.

Læs mere

Nyeste viden om betydning og bekæmpelse af skoldplet i byg

Nyeste viden om betydning og bekæmpelse af skoldplet i byg AARHUS UNIVERSITET Institut for Agroøkologi Nyeste viden om betydning og bekæmpelse af skoldplet i byg Lise Nistrup Jørgensen, Ghita C. Nielsen, Susanne Sindberg, Kristian Kristensen Indholdsfortegnelse

Læs mere

Risikovurdering af goldfodsyge i hvede

Risikovurdering af goldfodsyge i hvede Markbrug nr. 273 Marts 23 Risikovurdering af goldfodsyge i hvede Lise Nistrup Jørgensen & Camilla Møller, Danmarks JordbrugsForskning Ghita Cordsen Nielsen, Landbrugets Rådgivningscenter Ministeriet for

Læs mere

Danske forskere tester sædskifter

Danske forskere tester sædskifter Danske forskere tester sædskifter Jørgen E. Olesen, Ilse A. Rasmussen og Margrethe Askegaard, Danmarks Jordbrugsforskning Siden 1997 har fire forskellige sædskifter med forskellige andele af korn været

Læs mere

Økonomisk analyse. Sektoropgørelse - vegetabilier. 25. juli Highlights:

Økonomisk analyse. Sektoropgørelse - vegetabilier. 25. juli Highlights: Økonomisk analyse 25. juli 2013 Axelborg, Axeltorv 3 1609 København V T +45 3339 4000 F +45 3339 4141 E info@lf.dk W www.lf.dk Sektoropgørelse - vegetabilier Highlights: Den samlede vegetabilske produktion

Læs mere

HAVRE Sorter. > > har et stift strå, så der ikke er behov for vækstregulering.

HAVRE Sorter. > > har et stift strå, så der ikke er behov for vækstregulering. HAVRE Sorter > > LARS BONDE ERIKSEN, SEGES Landsforsøg To nummersorter NORD 14/314 og Nord 14/124 giver med forholdstal for udbytte på 4 og 2 de største udbytter i landsforsøgene med havresorter. De følges

Læs mere

Havre. Markplan/sædskifte. Etablering. Dyrkning af havre kan flere formål: produktion af foderkorn produktion af grynhavre dæksæd for udlæg

Havre. Markplan/sædskifte. Etablering. Dyrkning af havre kan flere formål: produktion af foderkorn produktion af grynhavre dæksæd for udlæg Side 1 af 6 Havre Dyrkning af havre kan flere formål: produktion af foderkorn produktion af grynhavre dæksæd for udlæg Foto: Jens Tønnesen Markplan/sædskifte Havre kan dyrkes på alle jordtyper. Ved dyrkning

Læs mere

Helsinge, tlf. 4879 5000 Dønnevælde, tlf. 4839 1461 Borup, tlf. 4828 9058 www.nag.dk HØSTINFORMATION

Helsinge, tlf. 4879 5000 Dønnevælde, tlf. 4839 1461 Borup, tlf. 4828 9058 www.nag.dk HØSTINFORMATION Helsinge, tlf. 4879 5000 Dønnevælde, tlf. 4839 1461 Borup, tlf. 4828 9058 www.nag.dk HØSTINFORMATION 2015 Hvede Brødhvede/vårhvede Handles individuelt mellem køber og sælger og på individuelle kontraktkrav

Læs mere

Skadedyr i korn- og frølagre. Karakteriseret ved: Stabilt klima ~ Beskyttet mod nedbør, vind, sol Lang tidsfaktor Mængder af tørre frø

Skadedyr i korn- og frølagre. Karakteriseret ved: Stabilt klima ~ Beskyttet mod nedbør, vind, sol Lang tidsfaktor Mængder af tørre frø AARHUS UNIVERSITET Skadedyr i korn- og frølagre Aarhus Universitet Det Jordbrugsvidenskabelige Fakultet Institut for Plantebeskyttelse og Skadedyr Skadedyrlaboratoriet LiseS.Hansen@agrsci.dk Lagre med

Læs mere

Foreningen af Danske Handelsmøller Association of Danish Millers - Association Danoise de Meunerie

Foreningen af Danske Handelsmøller Association of Danish Millers - Association Danoise de Meunerie B R Ø D K O R N Møllernes anbefalinger og kvalitetskrav 2012 Foreningen af Danske Handelsmøller Association of Danish Millers - Association Danoise de Meunerie Brødkornskvalitet De vigtigste arter af korn

Læs mere

I EN VERDEN MED MERE KVÆLSTOF NU ER DER GÅET HUL PÅ SÆKKEN HVAD SKAL JEG GØRE?

I EN VERDEN MED MERE KVÆLSTOF NU ER DER GÅET HUL PÅ SÆKKEN HVAD SKAL JEG GØRE? Kolding 3/2 2016 Jens Elbæk Seges I EN VERDEN MED MERE KVÆLSTOF NU ER DER GÅET HUL PÅ SÆKKEN HVAD SKAL JEG GØRE? Lav plads på kontoen 2,2 mia. er på vej! Ca. 800 kr/ha i gennemsnit Det kommer ikke alt

Læs mere

PRODUKTINFORMATION VÅRSÆD OG EFTERAFGRØDER 2016

PRODUKTINFORMATION VÅRSÆD OG EFTERAFGRØDER 2016 PRODUKTINFORMATION VÅRSÆD OG EFTERAFGRØDER 2016 Stærkt sortiment af vårsæd og efterafgrøder Læs mere om sorterne og deres dyrkningsegenskaber DANISH VÅRBYG AGROS KVÆGFODERPROGRAM 2014 VALG AF VÅRBYG Sortsvalget

Læs mere

Dyrkning af hestebønner i 2017 sådan! v. Casper Andersen

Dyrkning af hestebønner i 2017 sådan! v. Casper Andersen Dyrkning af hestebønner i 2017 sådan! v. Casper Andersen Indhold Jordtype og forfrugt Plantetal P og K? Sortsvalg Ukrudtsbekæmpelse Svampe Skadedyr Disciplin med sprøjten! Jordtype og forfrugt 4 foregående

Læs mere

HERBICIDRESISTENS I PRAKSIS

HERBICIDRESISTENS I PRAKSIS Koldkærgaard, 22. oktober 2015 Poul Henning Petersen og Jens Erik Jensen HERBICIDRESISTENS I PRAKSIS DET SIMPLE BUDSKAB OM HERBICIDRESISTENS Hver gang vi sprøjter, bliver der selekteret Frø fra planter

Læs mere

Økologisk dyrkning. Konklusioner. Artsvalg

Økologisk dyrkning. Konklusioner. Artsvalg Økologisk dyrkning Konklusioner Artsvalg Artsvalg i korn og oliefrø I fem forsøg med vintersædsarter har der i 2006, i modsætning til tidligere år, ikke været signifikant forskel på udbytterne. Se tabel

Læs mere

Arealanvendelse, husdyrproduktion og økologisk areal i 2003 til brug ved slutevaluering

Arealanvendelse, husdyrproduktion og økologisk areal i 2003 til brug ved slutevaluering Ministeriet for Fødevarer, Landbrug og Fiskeri Fødevareøkonomisk Institut Baggrundsnotat til Vandmiljøplan II slutevaluering Arealanvendelse, husdyrproduktion og økologisk areal i 2003 til brug ved slutevaluering

Læs mere

Aktuelt MarkNYT fra Hornsyld Købmandsgaard A/S 2016 uge 15

Aktuelt MarkNYT fra Hornsyld Købmandsgaard A/S 2016 uge 15 Aktuelt MarkNYT fra Hornsyld Købmandsgaard A/S 2016 uge 15 Så er det forår Det er NU sidste udkald for at bekæmpe de grove græsser i vintersæd, men er der kun behov for bekæmpelse af tokimbladet ukrudt,

Læs mere

Så har det for alvor rykket i høsten og min vurdering er, at det kun er det sidst modne vårbyg og vårhvede som står tilbage.

Så har det for alvor rykket i høsten og min vurdering er, at det kun er det sidst modne vårbyg og vårhvede som står tilbage. Aktuelt MarkNYT fra Hornsyld Købmandsgaard A/S 2016 uge 35 Så har det for alvor rykket i høsten og min vurdering er, at det kun er det sidst modne vårbyg og vårhvede som står tilbage. Den nysåede raps

Læs mere

Brancheindsats mod Neonectria

Brancheindsats mod Neonectria Brancheindsats mod Neonectria Skovplanteringens årsmøde 2014 Gunnar Friis Proschowsky Overblik Indledning: En brancheindsats, hvorfor står jeg her? Hvad er Neonectria? Lidt Historik Vi ved kun lidt smitteveje,

Læs mere

Ompløjning af afgræsnings- og kløvergræsmarker. Ukrudtsbekæmpelse Efterafgrøder Principper for valg af afgrøde

Ompløjning af afgræsnings- og kløvergræsmarker. Ukrudtsbekæmpelse Efterafgrøder Principper for valg af afgrøde Et dokument fra Dansk Landbrugsrådgivning, Landscentret www.landscentret.dk Find mere faglig information på www.landscentret.dk/landbrugsinfo Udskrevet 2. april 2008 LandbrugsInfo > Planteavl > Afgrøder

Læs mere

God planlægning er 3 ud af 6 tons raps

God planlægning er 3 ud af 6 tons raps God planlægning er 3 ud af 6 tons raps Dorthe Kappel dorthe.kappel@monsanto.com mobil: 30 38 13 19 Monsanto Picture: Anne Williams 2 3 I planlægningen bør overvejes.. Placering i sædskiftet Sortsvalg Kold

Læs mere

Instruks til kontrol af bedrifter med kartoffelbrok - hvorvidt påbud for smittede marker og marker i bufferzone efterleves

Instruks til kontrol af bedrifter med kartoffelbrok - hvorvidt påbud for smittede marker og marker i bufferzone efterleves Instruks til kontrol af bedrifter med kartoffelbrok - hvorvidt påbud for smittede marker og marker i bufferzone efterleves Kolofon Instruks til kontrol af bedrifter med kartoffelbrok Kontrolinstruks til

Læs mere

Bekæmpelse af Neonectria ædelgrankræft på nordmannsgran

Bekæmpelse af Neonectria ædelgrankræft på nordmannsgran Bekæmpelse af Neonectria ædelgrankræft på nordmannsgran Temadag om Neonectria og certificering 19. Januar 2015 Klaus Paaske & Magnus Gammelgaard Aarhus Universitet Flakkebjerg Disposition Baggrund Forsøg

Læs mere

Landbrugsplanter: Udvikling af strategi til forebyggelse og regulering af frøbårne sygdomme i fremavlskorn

Landbrugsplanter: Udvikling af strategi til forebyggelse og regulering af frøbårne sygdomme i fremavlskorn Redegørelse om afviklingen af græsrodsforskningsprojektet Landbrugsplanter: Udvikling af strategi til forebyggelse og regulering af frøbårne sygdomme i fremavlskorn Projektets formål har været at udvikle

Læs mere

HESTEBØNNER I STALD OG MARK

HESTEBØNNER I STALD OG MARK HESTEBØNNER I STALD OG MARK KONGRES FOR SVINEPRODUCENTER 2014 Projektleder Sønke Møller, Ernæring & Reproduktion Svineproducent Asbjørn Kaad, Tandslet Fordomme om hestebønner Høstes i juleferien Er kun

Læs mere

Bestemmelser for fremavl af korn

Bestemmelser for fremavl af korn Bestemmelser for fremavl af korn 5. udgave, juni 2013 FORORD DLG ønsker med denne folder at sætte fokus på de specielle forhold man skal være opmærksom på som fremavler af sædekorn. NaturErhvervstyrelsens

Læs mere

Plantenæringsstoffer -mangel. Østdansk LandbrugsRådgivning En del af Dansk Landbrugsrådgivning

Plantenæringsstoffer -mangel. Østdansk LandbrugsRådgivning En del af Dansk Landbrugsrådgivning Plantenæringsstoffer -mangel Næringsstof tilgængelighed Næringsstof tilgængelighed i jorden, påvirkes for en række næringsstoffer af jordes surhedsgrad. Rigtig reaktionstal sikre optimal optagelse. Mobilisering

Læs mere

Seneste erfaringer med korndyrkning fra praksis og forsøg. v/ Morten Haastrup

Seneste erfaringer med korndyrkning fra praksis og forsøg. v/ Morten Haastrup Seneste erfaringer med korndyrkning fra praksis og forsøg v/ Morten Haastrup Agenda Såtid og udsædsmængde i vinterhvede Sen såning af arterne Kvælstoftildelingsstrategi i vinterhvede Kvælstoftildelingsstrategi

Læs mere

Hvedebladplet - biologi og bekæmpelse

Hvedebladplet - biologi og bekæmpelse Hvedebladplet - biologi og bekæmpelse Indlæg til seminar om Planteværn 28-31 Januar 2002 Charlotte H. Hansen & Karen Frænde Jensen Danmarks JordbrugsForskning, Flakkebjerg Hvedebladplet Kønnede stadium:

Læs mere

Typer af sortbensyge / blødrådbakterier (Erwinia-komplekset) i Danmark

Typer af sortbensyge / blødrådbakterier (Erwinia-komplekset) i Danmark Typer af sortbensyge / blødrådbakterier (Erwinia-komplekset) i Danmark Steen Lykke Nielsen & Tina Tønnersen, AU, DJF Lars Bødker, Videncenter for Landbrug 1 Erwinia-komplekset Tidligere navn Nye navn Erwinia

Læs mere

Bibliografiska uppgifter för Potatisbladmögel allt svårare att bekämpa? Erfarenheter från Danmark

Bibliografiska uppgifter för Potatisbladmögel allt svårare att bekämpa? Erfarenheter från Danmark Bibliografiska uppgifter för Potatisbladmögel allt svårare att bekämpa? Erfarenheter från Danmark Författare Nielsen B. Utgivningsår Tidskrift/serie Meddelande från Södra jordbruksförsöksdistriktet Nr/avsnitt

Læs mere

Rug fra mark til mave. Kongres for svineproducenter 2013, Herning Dorthe K. Rasmussen, Ernæring & Reproduktion Søren Kolind Hvid, Planteproduktion

Rug fra mark til mave. Kongres for svineproducenter 2013, Herning Dorthe K. Rasmussen, Ernæring & Reproduktion Søren Kolind Hvid, Planteproduktion Rug fra mark til mave Kongres for svineproducenter 2013, Herning Dorthe K. Rasmussen, Ernæring & Reproduktion Søren Kolind Hvid, Planteproduktion Rug fra mark til mave Grisen Hvad ved vi om rug til foder?

Læs mere

Strategier for ukrudtsbekæmpelse i økologisk dyrket vinterhvede. Ilse A. Rasmussen Danmarks JordbrugsForskning Afd. for Plantebeskyttelse

Strategier for ukrudtsbekæmpelse i økologisk dyrket vinterhvede. Ilse A. Rasmussen Danmarks JordbrugsForskning Afd. for Plantebeskyttelse Strategier for ukrudtsbekæmpelse i økologisk dyrket vinterhvede Ilse A. Rasmussen Danmarks JordbrugsForskning Afd. for Plantebeskyttelse Strategier for ukrudtsbekæmpelse i økologisk dyrket vinterhvede

Læs mere

Kvælstofforsyningen på økologiske planteavlsbedrifter

Kvælstofforsyningen på økologiske planteavlsbedrifter Kvælstofforsyningen på økologiske planteavlsbedrifter Med udfasning af import af konventionel husdyrgødning bliver det nødvendigt med et større fokus på kvælstoffikserende afgrøder i økologiske planteavlssædskifter.

Læs mere

Bekæmpelse af sygdomme i korn 2015

Bekæmpelse af sygdomme i korn 2015 Bekæmpelse af sygdomme i korn 2015 Havrerødsot Meldug Nye regler for triazoler Septoria Væske mængde Nye KO krav Rettigheder Pct. angrebne planter 50 45 40 35 30 25 20 15 10 5 0 Forekomst af bladlus i

Læs mere