Naturvidenskab og teknologi som makkerpar

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Naturvidenskab og teknologi som makkerpar"

Transkript

1 THOMAS RASMUSSEN Naturvidenskab og teknologi som makkerpar Et styrket samarbejde mellem gymnasier, virksomheder og universiteter er en væsentlig faktor, når man skal vise, hvad basisviden kan bruges til i praksis. Thomas Rasmussen, der er civilingeniørstuderende på BioCentrum-DTU, fortæller om Biotech Academy, der skal give gymnasieeleverne en bedre forståelse af indholdet i deres læreplaner. Først senere fandt jeg, ligesom resten af den nysgerrige del af den danske befolkning, ud af, at det vel nok mest omtalte produkt inden for nyere dansk forskning, brintpillen, var kommet til verden på baggrund af netop utrolig simpel basisviden fra den uorganiske kemi. Thomas Rasmussen stud.polyt, BioCentrum-DTU For ganske få år siden sad jeg tit i gymnasiet og tænkte: Hvorfor skal jeg dog bruge energi på at lære det her? Interesserede stoffet mig ikke, kunne jeg ikke engagere mig i undervisningen. Måske kynisk, men ikke desto mindre en holdning, som mange andre unge også har. For mit vedkommende gav det sig udslag i, at jeg blev utrolig dårlig til uorganisk kemi, da det på intet tidspunkt blev anskueliggjort, hvordan denne basisviden kunne anvendes til noget produktivt. Der er ingen tvivl om, at mediedækningen af den lille brintpille har bidraget kraftigt til, at antallet af nye studerende på Kemisk Institut på DTU, hvor folkene bag brintpillen holder til, er fordoblet. Det er et meget godt eksempel på, hvorfor det er utrolig vigtigt, at man hos unge mennesker sørger for, at den teoretiske undervisning bliver knyttet sammen med klare eksempler på stoffets praktiske anvendelse. «Det er helt bestemt en fejl at tro, at al viden skal (og kan!) populariseres» KEDELIGSTE BRINTPILLE ELLER? Jeg er ikke i tvivl om, at hvis jeg havde haft konkrete eksempler fra hverdagen, som jeg kunne hænge den uorganiske kemi op på, havde jeg kastet mig over det område, lang tid før jeg begyndte på DTU. Men sådan gik det ikke. MÅLET FREM FOR MIDLERNE Jeg er overbevist om, at viser vi de unge, hvad de kan bruge den teoretiske viden til, vil de i langt højere grad engagere sig i undervisningen. Hvis du ved, at det, du arbejder med, kan hjælpe dig til at nå dit mål om at være med til at redde verden, så vil du også kæmpe for at tilegne dig den 49

2 Vores undervisningsmateriale vil være 100 procent webbaseret. Undervisningsforløbet skal munde ud i deciderede rap- - af året. Vi vil bruge meget energi på at de bøger, der bruges i undervisningen, og virksomhedernes teknologi. Det er vigtigt, at elever og lærere går ind til projektet med den nødvendige basisviden. Først når de har læst de kapitler, som handler om proteiner, kan de begynde at arbejde med medicinal proteinfremstilling. Vi henviser i vores teoriafsnit til de sider/kapitler, der skal være gennemgået i de renødvendige basisviden. Også selv om det måske ikke altid er det mest nervepirrende, der står i grundbøgerne. Det er helt bestemt en fejl at tro, at al viden skal (og kan!) populariseres, da man så risikerer at fjerne det meget vigtige overblik. Min kritik går ikke på, at bøgerne er skrevet kedeligt. Det, jeg mener, er, at der mangler et link mellem bøgerne, det teoretiske stof og den virkelige verden uden for skolens vinduer. Det link skal ikke ind som et ekstra kapitel bagerst i bøgerne. Det skal inkluderes i selve undervisningen med de opgaver og eksempler, som den studerende får. LINK TIL ANVENDT TEKNOLOGI Du kan ikke forstå, hvordan Novo Nordisk laver insulin, hvis du ikke kender de 20 aminosyrer. Men fra at kende til proteiner er der et enormt spring til at vide, hvordan insulin dannes i gær. Det er min erfaring fra både mig selv og mit arbejde med unge danske studerende fra gymnasierne, at der er utrolig mange, som gerne vil arbejde med en anvendelsesorienteret brug af deres basisviden i undervisningen. Desværre er virksomhederne ikke gearede til at have alle danske gymnasieelever ude på virksomhederne og lave forsøg. De kan komme og høre om teknologien og virksomheden og få en rundvisning, men den essentielle del mangler. De unge kommer ikke til at arbejde aktivt med overgangen fra deres viden fra bøgerne til virksomhedernes nye og spændende teknologi. De kan efter afsluttet eksamen let stå med en oplevelse af, at der er et helt uoverskueligt tomrum fra den teoretiske viden i bøgerne til den viden, de skal have for at kunne arbejde i industrien og være med i innovationsprocessen. Jeg mener uden tvivl, at det vil være muligt på én gang at præsentere en højteknologi og tilpasse teknologien et niveau, som kan danne grundlag for undren og inspiration hos de unge. Jeg er sikker på, at eleverne sagtens kan arbejde med virksomhedernes teknologi på en måde, som både udfordrer dem i deres basisviden og samtidig giver dem en indsprøjtning af inspiration og engagement. Det vil i sidste ende betyde, at de ikke kun vælger en længere uddannelse, men også, at de kommer hurtigere igennem uddannelsesforløbet. Det er på baggrund af den overbevisning, at jeg er med i et nystartet projekt, som skal give både elever og lærere et kendskab til virksomhedernes højteknologi. INDUSTRIEN OG DE UNGE Sammen med tre andre udvalgte studerende fra BioCentrum-DTU (BiC) har jeg taget initiativ til et projekt, Biotech Academy, hvor vi samarbejder med de bedste danske biotekvirksomheder. Projektets primære fokus er at bruge de danske biotekvirksomheders højteknologi til den for biologi-, kemi- og fysikundervisningens pensum på en anderledes, inspirerende, innovativ og aktuel måde. Biologifagets styrke er netop, at faget er udpræget tværfagligt. Det gør, at vi kan inddrage mange aspekter af naturvidenskaben, som samlet set er bioteknologi. 50

3 spektive bøger, inden læreren kan forvente, at eleverne kan lave projektet. Fordelen ved det webbaserede materiale tioner samt interaktive 3d-strukturer af biologiske molekyler som et forklarende element til projekterne. Det vil både gøre at visualisere nogle af de mere abstrakte dele af biologien. STUDERENDE SOM FORMIDLERE Institutleder på DTU Ole Filtenborg har ansvaret for at udvælge de studerende fra til at være en del af Biotech Academy. Det er vigtigt, at de udvalgte studerende er på det højeste faglige niveau, for det er dem, der skal udarbejde undervisningsmaterialet til gymnasieeleverne. ret i Biotech Academy, har to studeret vedstanford University, én i Chicago, én har vundet prisen for det bedste bachelorprojekt på DTU i 2005, og én skal med som formidlingspilot på Galathea 3-ekspeditonen. Alle har stor erfaring med undervisning i naturvidenskab samt praktisk erfaring med at igangsætte større og mindre projekter. PILOTPROJEKTET Før vores undervisningsmateriale bliver tilgængeligt for samtlige gymnasier i Danmark, er materialet blevet testet grundigt af nogle testgymnasier. Vores projekter har en udviklingstid på cirka et år. Projekterne bliver blandt andet afprøvet i samarbejde med de Danske Science Gymnasier. De 25 gymnasier repræsenterer nogle af de mest engagerede og kritiske gymnasier i Danmark inden for naturvidenskaben. De er vant til at arbejde med nye undervisningsmaterialer og vil derfor kunne komme med den bedste kritik af vores projekter. gængelige til sommer, kommer til at handle om Bioethanol (DONG-Energy), Polyklonale antistoffer (Symphogen), Mikroorganismer og ølproduktion (Carlsberg) og Antimikrobielle peptider og bioinformatik (Novozymes). Det første projekt, der snart er klar til at blive testet, er vores projekt sammen med Novozymes. Projektet tager fat på de områder i biologiundervisningen, som vi selv husker som noget af det vanskeligste at forstå, da vi havde biologi A i gymnasiet: Proteinstrukturer. Det er et område, som på én gang er både utrolig simpelt og ubehagelig abstrakt. I vores undervisningsmateriale vil vi tage udgangspunkt i små peptider, som er nemme at overskue. De unge vil møde tre forskellige proteiner med tre forskellige strukturer, der på hver deres måde dræber bakterier. Vi introducerer bioinformatikken i biologiundervisningen for første gang, men vi gør det ved hjælp af et Biotekvirksomheder Teknologi undervisning Folkeskole/Gym/HTX Netværk (Elitestuderende/ virksomhederne). Bedre projekter/udlandsophold. Øge de studerendes fokus på de jobs, der venter i industrien BiC Elitestuderende Undervisningsmateriale og oplysning/formidling om bio - teknologi og ingeniøruddan - nelsens fordele og mulighe - der 51

4 Teknologi: Antimikrobielle peptider fra Novozymes A/S og bioinformatik Områder: Proteinstruktur, biologiske membraner samt brugen af it I projektet introducerer vi de unge for bioinformatik og antimikrobielle peptider (AMP). AMP er en gruppe små proteiner, der effektivt slår bakterier ihjel. De findes i mennesker og i alle andre organismer, hvor man har ledt efter dem, idet de er en fundamental del af forsvaret mod bakterie- og svampeangreb. AMP er virker blandt andet ved, at de opløser bakterier og svampes membraner. På grund af forskelle i sammensætningen af fedtstoffer i biologiske membraner rammer AMP ikke mennesker. Novozymes har i 2005 fundet et nyt AMP, der lover godt som et nyt alternativ til de former for konventionel antibiotika, som bakterierne i stigende grad bliver resistente over for. Ukendt DNA sekvens ttigaaatacaactatatttggaaagatgttcaaaggattatttatctgttcactaattgctgtgatctgtgcaaatgcact Muligt gen A Muligt gen B Muligt gen C Muligt gen A Protein-sekvens af AMP AMP AMP Program der genkender mulige gener Program der sammenligner med alle gener Muligt gen C Program der kan bestemme om dette protein udskilles af cellen Program der kan bestemme 3D struktur af proteinet. Ud fra denne struktur kan man sige meget om hvordan proteinet vil virke. Forskellige strukturer dræber bakterier på forskellige måder De unge skal i rapportdelen bruge computerprogrammer, udviklet på Center for Biologisk Sekvensanalyse (CBS) på DTU, til at identificere et AMP i en DNA-sekvens og derefter bestemme den tredimensionale struktur af det antimikrobielle peptid. For AMP s vedkommende fortæller strukturen utrolig meget om, hvordan det virker på bakterierne. Pointen i projektet er at vise, at man med computere kan få brugbare informationer ud af DNA-sekvenser, der ellers ingen mening giver. højaktuelt emne, da man ofte i medierne hører om resistente bakterier. Disse små antimikrobielle peptider kan nemlig vise sig at være løsningen på det meget alvorlige resistensproblem. Dermed har vi sat et vanskeligt område i biologien i direkte forbindelse med noget, der diskuteres i samfundet. INSPIRATION TIL OPGAVER Et vigtigt aspekt i vores ideer er, at vi i forlængelse af de forskellige projekter kommer med både konkrete ideer og inspiration til tredjeårsopgaven. Vi håber, at de studerende, når de inddrager teknologien i deres opgaver, kan skrive endnu bedre opgaver gennem en vision om at skabe et egentligt produkt. Det vil ofte føre til bedre projekter, da man ofte ser de unge leve sig mere ind i de projekter, hvor der er en egentlig innovationsproces. Innovationsprocessen er grundlaget for nogle af de bedste opgaver, der hvert år bliver indsendt til de landsdækkende konkurrencer under Unge Forskere. Engagement, innovation og fordybelse er nøgleordene til de projekter, som hvert år bli- laboratoriet på Novozymes, hvor der arbejdes med AMP. 52

5 Bakterie der bliver sprængt i luften af en af de peptider Novozymes arbejder med. ver udvalgt til at repræsentere Danmark i konkurrencer for unge forskere fra hele verden. Det er mit håb, at vi ved at indføre projektbaseret højteknologisk undervisning i gymnasierne kan få et langt større antal unge mennesker til at vælge en længere og mere teknologiorienteret uddannelse. Vores nye form for undervisningsmateriale giver en klar mulighed for at differentiere undervisningen. Det giver mulighed for, at talenter selvstændigt kan arbejde videre på universiteterne eller sammen med en virksomhed med én af de teknologier, de er blevet inspireret af, via den nye undervisningsform, som vi tilbyder. Der vil altid være tid og lyst til at hjælpe den engagerede studerende, som kontakter en virksomhed eller et universitet og spørger om lov til at skrive et projekt sammen med universitetet eller virksomheden, fordi den studerende har sat sig ind i teknologien og gerne vil arbejde videre med den. Man har simpelthen skabt den ideelle win-win-situation for såvel den studerende som virksomhederne og universiteterne. Jeg håber, at jeg i ovenstående har præsenteret vores projekt på en sådan måde, at det bliver modtaget positivt, men gerne med konstruktiv kritik, når vi lancerer det til foråret, så lærere kan inddrage det i undervisningen i det efterfølgende skoleår. Samtidig håber jeg, at denne artikel kan sætte gang i nogle tanker om universiteterne og virksomhedernes ansvar for uddannelse af den danske ungdom. Det er netop os, der sidder med den mest inspirerende viden, og vi har derfor et ansvar for at oplyse de unge om, hvilke fantastiske muligheder der ligger og venter på dem efter en god eksamen på de videregående uddannelser. På den måde kan de opfylde deres drømme om at redde verden fra sygdomme, forurening og fødevaremangel. NOTE Eksempel på et projekt lavet sammen med en virksomhed: 53

Biokemi Udforsk livets kerne med en uddannelse i biokemi på Københavns Universitet

Biokemi Udforsk livets kerne med en uddannelse i biokemi på Københavns Universitet det natur- og biovidenskabelige fakultet københavns universitet Biokemi Udforsk livets kerne med en uddannelse i biokemi på Københavns Universitet Biokemi 1 kemi bioteknologi bioinformatik laboratoriearbejde

Læs mere

Geovidenskab. university of copenhagen DEPARTMENT OF SCIENCE EDUCATION. En undersøgelse af de første studenter

Geovidenskab. university of copenhagen DEPARTMENT OF SCIENCE EDUCATION. En undersøgelse af de første studenter university of copenhagen DEPARTMENT OF SCIENCE EDUCATION Geovidenskab En undersøgelse af de første studenter Rie Hjørnegaard Malm & Lene Møller Madsen IND s skriftserie nr. 41, 2015 Udgivet af Institut

Læs mere

De femårige gymnasieforløb

De femårige gymnasieforløb GENTOFTE KOMMUNE De femårige gymnasieforløb i Gentofte Kommune Forord I Gentofte Kommune er vi ambitiøse og det er derfor med stor glæde, at vi sender dette tilbud ud til alle 7. klasses elever. Vi kan

Læs mere

Medarbejderen. Til din Life Science virksomhed:

Medarbejderen. Til din Life Science virksomhed: Til din Life Science virksomhed: Medarbejderen med de kompetencer Kort og godt om din næste, potentielle medarbejder, der gennem hele sin uddannelse har haft skarp fokus på det bioteknologiske arbejdsmarked:

Læs mere

Udvikling af forskertalenter

Udvikling af forskertalenter En præsentation af talentmiljøet på DTU Systembiologi Ole Filtenborg Institutdirektør DTU Systembiologi DTU Systembiologi Forskning DTU Systembiologi tiltrækker højt kvalificerede og motiverede forskere,

Læs mere

Københavns åbne Gymnasium Elevudsagn fra spørgeskemaundersøgelsen i 2q

Københavns åbne Gymnasium Elevudsagn fra spørgeskemaundersøgelsen i 2q Københavns åbne Gymnasium Elevudsagn fra spørgeskemaundersøgelsen i 2q 1.7 Overraskelser ved gymnasiet eller hf! Er der noget ved gymnasiet eller hf som undrer dig eller har undret dig? 20 Det har overrasket

Læs mere

Bilag 6.1 SYDDANSK UNIVERSITET / ONLINE STRATEGI. Vision: Scenarier

Bilag 6.1 SYDDANSK UNIVERSITET / ONLINE STRATEGI. Vision: Scenarier Bilag 6.1 SYDDANSK UNIVERSITET / ONLINE STRATEGI Vision: Scenarier Et internationalt universitet med fokus på de studerende Vejviseren til dit rette valg Destination for læring & oplysning Livet & menneskene

Læs mere

Sukkertoppen og Vibenhus

Sukkertoppen og Vibenhus Sukkertoppen og Vibenhus 2014 Htx kort og kontant Htx er en af de tre muligheder, du har for at tage en studentereksamen. De to andre hedder hhx og stx. Htx giver adgang til alle videregående uddannelser

Læs mere

Den Naturvidenskabelige Bacheloruddannelse på RUC

Den Naturvidenskabelige Bacheloruddannelse på RUC Den Naturvidenskabelige Bacheloruddannelse på RUC 1 Den Naturvidenskabelige Bacheloru Vil du bygge bro mellem to naturvidenskabelige fag? Eller har du lyst til at kombinere med et fag uden for naturvidenskab?

Læs mere

Teknologihistorie. Historien bag FIA-metoden

Teknologihistorie. Historien bag FIA-metoden Historien bag FIA-metoden Baggrund: Drivkræfter i den videnskabelige proces Opfindermyten holder den? Det er stadig en udbredt opfattelse, at opfindere som typer er geniale og nogle gange sære og ensomme

Læs mere

Højskolepædagogik set fra en gymnasielærers synsvinkel

Højskolepædagogik set fra en gymnasielærers synsvinkel Højskolepædagogik set fra en gymnasielærers synsvinkel Kommentarer af gymnasielærer, Kasper Lezuik Hansen til det Udviklingspapir, der er udarbejdet som resultat af Højskolepædagogisk udviklingsprojekt

Læs mere

Undervisningen på trin 1 skal lede frem mod at eleverne har tilegnet sig kundskaber og færdigheder der sætter dem i stand til at :

Undervisningen på trin 1 skal lede frem mod at eleverne har tilegnet sig kundskaber og færdigheder der sætter dem i stand til at : Biologi I biologi arbejder eleverne med naturen i al dens mangfoldighed. Dyr, planter, svampe, mennesker og samspillet herimellem udgør fagets arbejdsområder. Praktiske og undersøgende aktiviteter, hvor

Læs mere

BIOLOGI OG SUNDHED BIOLOGI A MATEMATIK B KEMI B

BIOLOGI OG SUNDHED BIOLOGI A MATEMATIK B KEMI B BIOLOGI OG SUNDHED BIOLOGI A MATEMATIK B KEMI B STX - MENNESKET I DEN GLOBALE VERDEN SAMMENHÆNGEN MELLEM MENNESKE OG NATUR Studieretningen sætter fokus på menneskets biologi og sundhed. I biologi og kemi

Læs mere

Prøver Evaluering Undervisning. Fysik/kemi. Maj-juni 2008

Prøver Evaluering Undervisning. Fysik/kemi. Maj-juni 2008 Prøver Evaluering Undervisning Fysik/kemi Maj-juni 2008 Ved fagkonsulent Anette Gjervig 1 Indledning Denne evaluering er udarbejdet på grundlag af censorberetninger fra syv censorer, der har medvirket

Læs mere

Forord. Hvorfor et nyt materiale om tobak? Viden og forebyggelse. Hvem er vi, og hvad vil vi?

Forord. Hvorfor et nyt materiale om tobak? Viden og forebyggelse. Hvem er vi, og hvad vil vi? Forord Hvorfor et nyt materiale om tobak? Fra flere sider i undervisningsverdenen lyder det, at der er mangel på tidssvarende materialer om rygning og tobak. Alt for ofte må en lærer selv sammensætte sin

Læs mere

Evaluering af Hvidovre Kommunes talenthold 2013-2014. Forfatterlab; Science; Innovation og Design; Engelsk; Matematik

Evaluering af Hvidovre Kommunes talenthold 2013-2014. Forfatterlab; Science; Innovation og Design; Engelsk; Matematik Evaluering af Hvidovre Kommunes talenthold 2013-2014 Forfatterlab; Science; Innovation og Design; Engelsk; Matematik Juli, 2014 Indledning Hvidovre Kommunes etablering af talenthold indgår som en del af

Læs mere

Synlig Læring i Gentofte Kommune

Synlig Læring i Gentofte Kommune Synlig Læring i Gentofte Kommune - også et 4-kommune projekt Hvor skal vi hen? Hvor er vi lige nu? Hvad er vores næste skridt? 1 Synlig Læring i følge John Hattie Synlig undervisning og læring forekommer,

Læs mere

Læreruddannelsen Aarhus med de mange muligheder. VIA University College

Læreruddannelsen Aarhus med de mange muligheder. VIA University College Læreruddannelsen Aarhus med de mange muligheder VIA University College Campus Aarhus C Ceresbyen 24 8000 Aarhus C Tlf.: 87 55 30 00 VIA.DK VIA University College Læreruddannelsen Aarhus Optagelse med andet

Læs mere

Når en 125 år gammel madpakke begynder at fortælle... En workshop i Almen Didaktik uden for klasseværelsets fire vægge

Når en 125 år gammel madpakke begynder at fortælle... En workshop i Almen Didaktik uden for klasseværelsets fire vægge Når en 125 år gammel madpakke begynder at fortælle... En workshop i Almen Didaktik uden for klasseværelsets fire vægge Af Linda Nørgaard Andersen, Skoletjenesten Arbejdermuseet Uanset hvilket linjefag

Læs mere

FLIPPED CLASSROOM MULIGHEDER OG BARRIERER

FLIPPED CLASSROOM MULIGHEDER OG BARRIERER FLIPPED CLASSROOM MULIGHEDER OG BARRIERER Er video vejen frem til at få de studerendes opmærksomhed? Udgivet af Erhvervsakademi Aarhus, forsknings- og innovationsafdelingen DERFOR VIRKER VIDEO 6 hovedpointer

Læs mere

Kemi C - hf-enkeltfag, april 2011

Kemi C - hf-enkeltfag, april 2011 Kemi C - hf-enkeltfag, april 2011 1. Identitet og formål 1.1. Identitet Kemi handler om stoffers egenskaber og betingelserne for, at de reagerer. Alt levende og vores materielle verden er baseret på, at

Læs mere

Mentorgruppe har positiv effekt. Socialrådgiverdage 2013 Pia Brenøe og Tina Bjørn Olsen. Njal Malik Nielsen og Finn Knigth

Mentorgruppe har positiv effekt. Socialrådgiverdage 2013 Pia Brenøe og Tina Bjørn Olsen. Njal Malik Nielsen og Finn Knigth Mentorgruppe har positiv effekt Socialrådgiverdage 2013 Pia Brenøe og Tina Bjørn Olsen. Njal Malik Nielsen og Finn Knigth CAFA kort fortalt Alle opgaver med udsatte børn og unge i fokus Samarbejdspartner:

Læs mere

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Isa Kirk Biotech Academy Institut for Systembiologi, Danmarks Tekniske Universitet 2. november 2010 1 Indhold 1 Introduktion

Læs mere

Din rolle som forælder

Din rolle som forælder For mig er dét at kombinere rollen som mentalcoach og forældrerollen rigtigt svært, netop på grund af de mange følelser som vi vækker, når vi opererer i det mentale univers. Samtidig føler jeg egentlig

Læs mere

Personlige og sociale kompetencer: Eleverne skal være bevidste om og kunne håndtere egne læreprocesser med relevans for faget.

Personlige og sociale kompetencer: Eleverne skal være bevidste om og kunne håndtere egne læreprocesser med relevans for faget. Biologi B 1. Fagets rolle Biologi er læren om det levende og om samspillet mellem det levende og det omgivende miljø. Biologi er et naturvidenskabeligt fag med vægt på eksperimentelle arbejdsmetoder såvel

Læs mere

BØRN OG UNGES TRIVSEL

BØRN OG UNGES TRIVSEL Årsmøde i Skolesundhed.dk 07 03 2016 BØRN OG UNGES TRIVSEL EN UDFORDRING FOR BØRN, UNGE OG VOKSNE DPU, AARHUS BØRN OG UNGE OM STORE UDFORDRINGER I DERES LIV At nå alt det jeg gerne vil i min fritid! Ida

Læs mere

Et stjerneskud det gode NF-forløb. Løvens Kvarter 17 2620 Albertslund 45114350 Kontaktperson: Lars Fisker 43992660 eller 61712660 lf@kghf.

Et stjerneskud det gode NF-forløb. Løvens Kvarter 17 2620 Albertslund 45114350 Kontaktperson: Lars Fisker 43992660 eller 61712660 lf@kghf. Projektnummer 129580 Et stjerneskud det gode NF-forløb Kontaktinformation Projektets overordnede formål og konklusion Redegørelse for konkrete tiltag i projektet Kongsholm Gymnasium og HF Løvens Kvarter

Læs mere

DREJEBOG VEJEN TIL DIT NYE JOB

DREJEBOG VEJEN TIL DIT NYE JOB DREJEBOG VEJEN TIL DIT NYE JOB INDHOLD Start din jobsøgning med at klarlæg dit/dine jobmål 3 Læg en plan 3 Her gik det særligt godt 3 Kom godt i gang med din ansøgning og CV 4 Dine faglige kompetencer

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2014/2015, eksamen maj/juni 2015 Institution Kolding HF & VUC Uddannelse Fag og niveau Lærer(e)

Læs mere

TAL, SKRIV, LEG OG LÆS

TAL, SKRIV, LEG OG LÆS TAL, SKRIV, LEG OG LÆS Temadag om børns tidlige sprog- og skriftsproglige udvikling Målgrupper: Temadagen henvender sig primært til pædagoger i børnehaver og indskoling, børnehaveklasselærere og lærere

Læs mere

Vision for læring og dannelse - for de 0-18-årige i Svendborg Kommune. Svendborg Kommunes Sammenhængende Børne- og Ungepolitik frem mod 2017

Vision for læring og dannelse - for de 0-18-årige i Svendborg Kommune. Svendborg Kommunes Sammenhængende Børne- og Ungepolitik frem mod 2017 der er gældende for folkeskolen i Svendborg Kommune Vision for læring og dannelse - for de 0-18-årige i Svendborg Kommune Svendborg Kommunes Sammenhængende Børne- og Ungepolitik frem mod 2017 Vision, formål

Læs mere

Biologiske Signaler i Graviditeten

Biologiske Signaler i Graviditeten Biologiske Signaler i Graviditeten Vi vil spørge, om du vil deltage i et videnskabeligt studie, der udføres af Afdeling for Epidemiologisk Forskning, Statens Serum Institut. Før du beslutter, om du vil

Læs mere

Bilag 3: Elevinterview 2 Informant: Elev 2 (E2) Interviewer: Louise (LO) Interviewer 2: Line (LI) Tid: 10:45

Bilag 3: Elevinterview 2 Informant: Elev 2 (E2) Interviewer: Louise (LO) Interviewer 2: Line (LI) Tid: 10:45 Bilag 3: Elevinterview 2 Informant: Elev 2 (E2) Interviewer: Louise (LO) Interviewer 2: Line (LI) Tid: 10:45 LO: Det er egentlig bare en udbygning af de spørgsmål, der var på spørgeskemaet. Det er bare

Læs mere

Har undervisning og studieaktiviteter i de enkelte LG-moduler støttet dig i at opnå et udbytte svarende til kompetencemålene?

Har undervisning og studieaktiviteter i de enkelte LG-moduler støttet dig i at opnå et udbytte svarende til kompetencemålene? 1 Læreruddannelsen UCL. Undervisningsevaluering. Fagevaluering LG, hovedområde: almen dannelse: KLM Fagevaluering 2014 114 studerende har besvaret spørgeskemaet. Alle fra årgang 2013. Uddannelsessted:

Læs mere

Udfordring AfkØling. Lærervejledning. Indhold. I lærervejledningen finder du følgende kapitler:

Udfordring AfkØling. Lærervejledning. Indhold. I lærervejledningen finder du følgende kapitler: Udfordring AfkØling Lærervejledning Indhold Udfordring Afkøling er et IBSE inspireret undervisningsforløb i fysik/kemi, som kan afvikles i samarbejde med Danfoss Universe. Projektet er rettet mod grundskolens

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Skoleåret 2015/2016, eksamen dec/jan 2015 Institution VUC Vest Uddannelse Fag og niveau Lærer(e) Hold Hfe

Læs mere

Kemi-lærerdag. 5 April 2013

Kemi-lærerdag. 5 April 2013 Kemi-lærerdag 5 April 2013 Program 9:45 Registrering 10:00 Velkomst. Frank Jensen, Institut for Kemi 10:15 Skyer i jordens atmosfære Merete Bilde, Professor, Institut for Kemi 11:00 Kaffe 11:30 På sporet

Læs mere

Det Tekniske Gymnasium

Det Tekniske Gymnasium Bliv godt rustet til både erhvervslivet og en videregående uddannelse på det innovative gymnasium: Det Tekniske Det Tekniske Det Tekniske er opbygget på samme måde som det almene gymnasium og handelsgymnasiet.

Læs mere

Evalueringsrapport. Sygeplejerskeuddannelsen. Fag evaluering - kommunikation Hold SOB13 Januar 2015. Med kvalitative svar.

Evalueringsrapport. Sygeplejerskeuddannelsen. Fag evaluering - kommunikation Hold SOB13 Januar 2015. Med kvalitative svar. Evalueringsrapport Sygeplejerskeuddannelsen Fag evaluering - kommunikation Hold SOB13 Januar 2015 Med kvalitative svar. Spørgsmål til mål og indhold for faget. I hvilket omfang mener du, at du har opnået

Læs mere

NATURVIDENSKAB HANDLER OM EVIG UNGDOM, CYKLER DER RUSTER OG ALVERDENS ANDRE SPÆNDENDE SPØRGSMÅL DU ER ALTID VELKOMMEN TIL AT KONTAKTE OS:

NATURVIDENSKAB HANDLER OM EVIG UNGDOM, CYKLER DER RUSTER OG ALVERDENS ANDRE SPÆNDENDE SPØRGSMÅL DU ER ALTID VELKOMMEN TIL AT KONTAKTE OS: DU ER ALTID VELKOMMEN TIL AT KONTAKTE OS: NATURVIDENSKAB HANDLER OM EVIG UNGDOM, CYKLER DER RUSTER OG ALVERDENS ANDRE SPÆNDENDE SPØRGSMÅL! Uddannelsesleder Marianne B. Johansen Tlf. 8923 4017 mbj@silkets.dk

Læs mere

Hurtigt overblik Strækker sig fra biokemi og cellelære til sundhed og økologi.

Hurtigt overblik Strækker sig fra biokemi og cellelære til sundhed og økologi. Bioteknologi BioAktivator 1. udgave, 2014 ISBN 13 9788761635846 Forfatter(e) Troels Wolf, Henrik Falkenberg, Peder K. Gasbjerg, Henning Troelsen, Annette Balle Sørensen, Chris Østergaard, Bodil Junker

Læs mere

Stofskiftets afhængighed af temperatur og aktivitet hos ektoterme dyr.

Stofskiftets afhængighed af temperatur og aktivitet hos ektoterme dyr. Evaluering af elever af besøg på Århus Universitet. Stofskiftets afhængighed af temperatur og aktivitet hos ektoterme dyr. Hvordan var besøget struktureret? o Hvad fungerede godt? 1. At vi blev ordentligt

Læs mere

Ekstra Nyhedsbrev fra MidtLab Januar 2014

Ekstra Nyhedsbrev fra MidtLab Januar 2014 Ekstra Nyhedsbrev fra Januar 2014 Diplomforløb i innovation, værktøjskasse og blive-klogere-sammen arrangementer Velkommen til denne ekstraudgave af s nyhedsbrev! Grunden til at vi beder om din opmærksomhed

Læs mere

Indhold. Dagtilbudspolitik 2011-2014 3

Indhold. Dagtilbudspolitik 2011-2014 3 Dagtilbudspolitik 2011-2014 Indhold Indledning.................................... 4 Dagtilbudspolitikken i Holstebro Kommune........... 6 Det anerkendende dagtilbud...................... 7 Visioner for

Læs mere

Thomas Binderup, Jette Vestergaard Jul og Bo Meldgaard

Thomas Binderup, Jette Vestergaard Jul og Bo Meldgaard Indhold i reformen Thomas Binderup, Jette Vestergaard Jul og Bo Meldgaard Folkeskolereformen som afsæt for fokus på læreprocesser I skoleåret 2014-2015 påbegyndtes arbejdet med at implementere den folkeskolereform,

Læs mere

Hvad er kreativitet? Kan man lære at være kreativ? To eksempler på kreative former for mesterlære

Hvad er kreativitet? Kan man lære at være kreativ? To eksempler på kreative former for mesterlære Indholdsfortegnelse Kapitel 1: Kapitel 2: Kapitel 3: Kapitel 4: Kapitel 5: Kapitel 6: Hvad er kreativitet? Kan man lære at være kreativ? To eksempler på kreative former for mesterlære Tættere på betingelser

Læs mere

Fremtidens menneske det perfekte menneske? (da-bio)

Fremtidens menneske det perfekte menneske? (da-bio) Fremtidens menneske det perfekte menneske? (da-bio) Jeg har valgt at beskæftige mig med fremtidens menneske. For at belyse dette emne bedst muligt har jeg valgt fagene biologi og dansk. Ud fra dette emne,

Læs mere

I Assens Kommune lykkes alle børn

I Assens Kommune lykkes alle børn I Assens Kommune lykkes alle børn Dagtilbud & Skole - Vision 0-18 år frem til 2018 I Assens Kommune har vi en vision for Dagtilbud & Skole. Den hedder I Assens Kommune lykkes alle børn og gælder for børn

Læs mere

Tilsynserklæring for skoleåret 2015/2016 vedr. Davidskolen

Tilsynserklæring for skoleåret 2015/2016 vedr. Davidskolen Bestyrelsen/Forældrekredsen Davidskolen Østergade 13 3720 Aakirkeby Att: Skoleleder Lene Due Madsen Skolekode: 400034 Rønne d. 28.2.2016 Tilsynserklæring for skoleåret 2015/2016 vedr. Davidskolen Tilsynet

Læs mere

- Om at tale sig til rette

- Om at tale sig til rette - Om at tale sig til rette Af psykologerne Thomas Van Geuken & Farzin Farahmand - Psycces Tre ord, der sammen synes at udgøre en smuk harmoni: Medarbejder, Udvikling og Samtale. Det burde da ikke kunne

Læs mere

Målet er at skabe fokus, tænke over hvad vi gør, og hvorfor vi gør det!

Målet er at skabe fokus, tænke over hvad vi gør, og hvorfor vi gør det! Målet er at skabe fokus, tænke over hvad vi gør, og hvorfor vi gør det! Filmen er tænkt som et debatoplæg og et forsøg på at skabe fokus på om det vi gør faktisk virker! Filmen viser 5 forskellige undervisningssituationer

Læs mere

Hovedpinepiller har aldrig været testet ordentligt på dyr 8. november 2010 kl. 11:24

Hovedpinepiller har aldrig været testet ordentligt på dyr 8. november 2010 kl. 11:24 Hovedpinepiller har aldrig været testet ordentligt på dyr 8. november 2010 kl. 11:24 Smertestillende håndkøbsmedicin er blevet brugt af millioner af mennesker. Først nu er hovedpinepillerne blevet testet

Læs mere

DB Evaluering oktober 2011

DB Evaluering oktober 2011 DB Evaluering oktober 2011 Matematik Vi har indarbejdet en hel del CL metoder i år: gruppearbejde, "milepæle" og adfærdsmæssige strategier. Eleverne er motiverede for at arbejde som et team. Hele DB forstår

Læs mere

Side 1 af 7. Skolepolitik. Børn og Skole

Side 1 af 7. Skolepolitik. Børn og Skole Side 1 af 7 Skolepolitik Børn og Skole Godkendt i kommunalbestyrelsen 28. juni 2012 Side 2 af 7 Den bornholmske folkeskole er attraktiv, fordi skolerne lægger vægt på: 1. Fællesskab, relationer og samarbejde.

Læs mere

MapMyClimate består af en stærk og kompetent gruppe partnere, der på flere niveauer kan tilbyde strategiske partnere og sponsorer værdi og viden.

MapMyClimate består af en stærk og kompetent gruppe partnere, der på flere niveauer kan tilbyde strategiske partnere og sponsorer værdi og viden. SYNLIGGØR DIT KLIMA De globale klimaforandringer er nogle af vor tids største udfordringer. Indsatsen for at bekæmpe klimaændringer og finde nye miljøvenlige energiløsninger berører alle dele af samfundet

Læs mere

En af lærerne siger: Det handler meget om at have adgang til forskellige oplysninger, og det har computere og interaktive tavler bragt med sig

En af lærerne siger: Det handler meget om at have adgang til forskellige oplysninger, og det har computere og interaktive tavler bragt med sig Kap 5: Læringsaktivitet: Udvikling af professionsfaglighed Case-spil til læreruddannelsen Case 1: Skal internettet ind og bogen ud? Lærerne på Centralskolen har teammøde. De taler med hinanden om, hvordan

Læs mere

Kompetencemål for Biologi

Kompetencemål for Biologi Kompetencemål for Biologi Biologi omhandler levende organismer og deres omgivende miljø, naturfaglige arbejdsmåder, tankegange og viden om miljø, evolution, sundhed, den praktiske anvendelse af biologi,

Læs mere

Formandens beretning Bjæverskov håndbold generalforsamling den 9. marts. 2015

Formandens beretning Bjæverskov håndbold generalforsamling den 9. marts. 2015 Formandens beretning Bjæverskov håndbold generalforsamling den 9. marts. 2015 Så står jeg her igen ved min 7. beretning som formand. Jeg tager nu hul på mit sidste år som formand da det må være på tide

Læs mere

You ve Got. The POWER. Bliv energi-ingeniør

You ve Got. The POWER. Bliv energi-ingeniør You ve Got The POWER Bliv energi-ingeniør Hele verden er ved at revolutionere den måde, vi producerer og bruger energi på. Min ambition er, at Danmark er med forrest i feltet, når det gælder kampen mod

Læs mere

Hvor meget bedre omdømme kan man få for 60 millioner kr.?

Hvor meget bedre omdømme kan man få for 60 millioner kr.? status Hvor meget bedre omdømme kan man få for 60 millioner kr.? Kan man reklamere sig til et bedre omdømme? Det korte svar er nej. Det lidt længere svar er ja hvis det hele ikke bare er reklame. Vores

Læs mere

Faglig årsplan 2010-2011 Skolerne i Oure Sport & Performance

Faglig årsplan 2010-2011 Skolerne i Oure Sport & Performance Fag: Biologi Hold: 20 Lærer: Harriet Tipsmark Undervisningsmål 9/10 klasse Læringsmål Faglige aktiviteter 33-34 35-36 37-40 41-49 Introforløb Tur til stranden Ryste sammen tur på klassen. Samle dyr og

Læs mere

Hovedpinepiller har aldrig været testet ordentligt på dyr

Hovedpinepiller har aldrig været testet ordentligt på dyr Hovedpinepiller har aldrig været testet ordentligt på dyr Af: Sybille Hildebrandt, Journalist 8. november 2010 kl. 12:24 Smertestillende håndkøbsmedicin er blevet brugt af millioner af mennesker. Først

Læs mere

STRATEGIGRUNDLAG 2015-2017

STRATEGIGRUNDLAG 2015-2017 2015-2017 STRATEGIGRUNDLAG 2015-2017 Side 4 EAL Strategi INTRODUKTION Erhvervsakademiet Lillebælt har i 2014 gennemført en proces, hvor bestyrelse, ledelse og medarbejdere i fællesskab har udfoldet strategigrundlaget

Læs mere

Projektbeskrivelse Informations Teknologi

Projektbeskrivelse Informations Teknologi Projektbeskrivelse Informations Teknologi Upload og indeksering af elev og -projektopgaver i skolemiljøet Indledning: Som nystartet på et gymnasium kan omvæltningen fra elev til påbegyndende studerende

Læs mere

Brugertest af folkeskolen.dk

Brugertest af folkeskolen.dk Folkeskolen.dk Brugertest af folkeskolen.dk Undersøgelsen er udført af Peytz Analyse via en exit-pop på folkeskolen.dk. Undersøgelsen blev foretaget fra d. 2. juni 14. juni 2010. I alt har 818 gennemført

Læs mere

TalentCamp Sønderjylland 2015 Kolding Realskole

TalentCamp Sønderjylland 2015 Kolding Realskole TalentCamp Sønderjylland 2015 Kolding Realskole 09. - 12. januar 2015 TALENTCAMP SØNDERJYLLAND 2015 TalentCampDK afholder TalentCamp for talentelever i 8. og 9. klasse på Kolding Realskole den 09. 12.

Læs mere

Christianshavns Gymnasium. Evaluering af grundforløbet i skoleåret 2014-2015

Christianshavns Gymnasium. Evaluering af grundforløbet i skoleåret 2014-2015 Christianshavns Gymnasium Evaluering af grundforløbet i skoleåret 2014-2015 Hensigt Hensigten med evalueringen er at få et helhedsbillede af 1.g-elevernes opfattelse af og tilfredshed med grundforløbet

Læs mere

www.eva.dk Motivation i praksis Oplæg på Produktionsskolernes årsmøde 28. april 2016 Ved Områdechef Camilla Hutters

www.eva.dk Motivation i praksis Oplæg på Produktionsskolernes årsmøde 28. april 2016 Ved Områdechef Camilla Hutters www.eva.dk Motivation i praksis Oplæg på Produktionsskolernes årsmøde 28. april 2016 Ved Områdechef Camilla Hutters Hvad er EVA? EVA s formål er at udforske og udvikle kvaliteten inden for ungdomsuddannelserne

Læs mere

Friluftsliv i børnehøjde. Personale og forældre. Gård-snak Børn i naturlig balance. Engagement, tillid og samarbejde

Friluftsliv i børnehøjde. Personale og forældre. Gård-snak Børn i naturlig balance. Engagement, tillid og samarbejde Engagement, tillid og samarbejde Vi viser vejen! Et godt børneliv kræver synlige og troværdige voksne, der kan og vil vise vej. Vi er professionelle! Vi er et engageret personale, som tør stå ved vores

Læs mere

Trafikken på broen mellem folkeskolen og ungdomsuddannelserne skal gå begge veje

Trafikken på broen mellem folkeskolen og ungdomsuddannelserne skal gå begge veje Læsevejleder og læsekonsulent: Trafikken på broen mellem folkeskolen og ungdomsuddannelserne skal gå begge veje Hvis målsætningen om, at 95 procent af en ungdomsårgang skal fuldføre en uddannelse, skal

Læs mere

S o l r ø d G y m n a s i u m

S o l r ø d G y m n a s i u m S o l r ø d G y m n a s i u m HF Velkommen til HF på Solrød Gymnasium På HF-uddannelsen får du en almen, gymnasial uddannelse, som vi på Solrød Gymnasium har valgt at tone. Det gør vi igennem fagpakker,

Læs mere

PANGEA MATEMATIK DYSTEN

PANGEA MATEMATIK DYSTEN PANGEA MATEMATIK DYSTEN - matematik forbinder INDHOLDSFORTEGNELSE 4 FORORD 13 2. RUNDE 7 FILOSOFI 15 FINALE 9 VISION 16 EKSEMPLER PÅ OPGAVER 10 TILMELDING 19 DEADLINES 12 1. RUNDE FORORD Geometriske figurer,

Læs mere

Prøver evaluering undervisning

Prøver evaluering undervisning Prøver evaluering undervisning Fysik/kemi Maj juni 2011 Ved fagkonsulent Anette Gjervig Kvalitets- og Tilsynsstyrelsen Ministeriet for Børn og Undervisning 1 Indhold Indledning... 3 De formelle krav til

Læs mere

Grøn økonomi, grøn omstilling og grøn vækst Kært barn, mange navne

Grøn økonomi, grøn omstilling og grøn vækst Kært barn, mange navne Grøn økonomi, grøn omstilling og grøn vækst Kært barn, mange navne Henrik Zobbe, Institutleder Institut for Fødevare- og Ressourceøkonomi Det Natur- og Biovidenskabelige Fakultet Københavns Universitet

Læs mere

1. Formål, fag og læringsmål

1. Formål, fag og læringsmål Den fagspecifikke del af STUDIEORDNINGEN for BACHELORUDDANNELSEN i BIOKEMI ved det Naturvidenskabelige fakultet Københavns Universitet (version 31/8 2009) 1. Formål, fag og læringsmål Bacheloruddannelsen

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj 2008 Institution Uddannelse Fag og niveau Lærer(e) Hold Silkeborg Tekniske Skole Htx Biologi B - valgfag

Læs mere

AT-EKSAMENSOPGAVEN 2016. januar 2016 / MG & RO

AT-EKSAMENSOPGAVEN 2016. januar 2016 / MG & RO AT-EKSAMENSOPGAVEN 2016 januar 2016 / MG & RO TIDSPLAN Valg af sag og fag Vejledning og skrivedage Aflevering Uge 4 Uge 5 Uge 6 Uge 7 Uge 8 Uge 9 Uge 10 Uge 11 Uge 12 Uge 13 Tirsdag 26/1: Introduktion

Læs mere

Fagene i Haver til Maver

Fagene i Haver til Maver Til skoleledere og lærere i Aarhus kommune Fagene i Haver til Maver Et tilbud for skoleklasser 1.-6. kl. i Aarhus kommune Dette bilag henvender sig til skoler, der gerne vil vide mere om hvilke fag, der

Læs mere

Almen kemi Miljøkemi Medicinalkemi Grøn og bæredygtig kemi Gymnasierettet kemi

Almen kemi Miljøkemi Medicinalkemi Grøn og bæredygtig kemi Gymnasierettet kemi københavns universitet science - det natur- og biovidenskabelige fakultet Almen kemi Miljøkemi Medicinalkemi Grøn og bæredygtig kemi Gymnasierettet kemi Læs kemi på Københavns Universitet Kemi 1 2 SCIENCE

Læs mere

Ny frontfigur Kom godt fra start som arbejdsleder

Ny frontfigur Kom godt fra start som arbejdsleder Ny frontfigur Kom godt fra start som arbejdsleder De næste 15 minutter: En kort guided tur i at være arbejdsgiver Der er nye administrative ting, du skal håndtere som kontrakter, ansættelsesret, løn..

Læs mere

Idræt i folkeskolen et spring fremad

Idræt i folkeskolen et spring fremad Idræt i folkeskolen et spring fremad Ideer til idrætslærere DANMARKS EVALUERINGSINSTITUT Idræt er folkeskolens vigtigste bevægelsesfag, og idrætslærerne sætter fysisk aktivitet og glæden ved at lege og

Læs mere

Biologi-bioteknologi. Kombiner teori og praksis med mange valgmuligheder. det natur- og biovidenskabelige fakultet københavns universitet

Biologi-bioteknologi. Kombiner teori og praksis med mange valgmuligheder. det natur- og biovidenskabelige fakultet københavns universitet det natur- og biovidenskabelige fakultet københavns universitet Biologi-bioteknologi Kombiner teori og praksis med mange valgmuligheder Biologi-bioteknologi 1 2 LÆS BIOLOGI-BIOTEKNOLOGI PÅ KØBENHAVNS UNIVERSITET

Læs mere

UNDERVISNING I PROBLEMLØSNING

UNDERVISNING I PROBLEMLØSNING UNDERVISNING I PROBLEMLØSNING Fra Pernille Pinds hjemmeside: www.pindogbjerre.dk Kapitel 1 af min bog "Gode grublere og sikre strategier" Bogen kan købes i min online-butik, i boghandlere og kan lånes

Læs mere

NYHEDSBREV SEPTEMBER 2008. Nyt tilbud til studerende ved Det Samfundsvidenskabelige Fakultet. Studiejob. Side

NYHEDSBREV SEPTEMBER 2008. Nyt tilbud til studerende ved Det Samfundsvidenskabelige Fakultet. Studiejob. Side Studiejob Hvordan finder jeg et relevant studiejob? Det spørgsmål er der mange studerende, der stiller sig selv. Nogle har måske et par gode bud men ved du også, at kan hjælpe? Fokus I 2008 har vi sat

Læs mere

Bioteknologi. Niveau: 9. klasse. Varighed: 7 lektioner

Bioteknologi. Niveau: 9. klasse. Varighed: 7 lektioner Bioteknologi Niveau: 9. klasse Varighed: 7 lektioner Præsentation: At undervise i bioteknologi handler først og fremmest om at åbne øjne. I forløbet kommer vi omkring forskellige teknikker, som fx gensplejsning

Læs mere

Velkommen til Aalborg Universitet 2013

Velkommen til Aalborg Universitet 2013 Velkommen til Aalborg Universitet 2013 God morgen alle sammen. Og rigtig hjertelig velkommen til Aalborg Universitet, og vores smukke campus her i Sydhavnen. Det er en stor dag i dag både for os og for

Læs mere

Bilag 15 Oversigt over erhvervsakademiuddannelser, professionsbacheloruddannelser samt bachelor- og kandidatuddannelser relateret til landbrug,

Bilag 15 Oversigt over erhvervsakademiuddannelser, professionsbacheloruddannelser samt bachelor- og kandidatuddannelser relateret til landbrug, Bilag 15 Oversigt over erhvervsakademiuddannelser, professionsbacheloruddannelser samt bachelor- og kandidatuddannelser relateret til landbrug, fødevarehåndtering samt natur og miljø 1 FIVU s bidrag til

Læs mere

Bilag 11 - Transskribering, Kvinde 28 år RESPONDENTEN OM DE SOCIALE MEDIER

Bilag 11 - Transskribering, Kvinde 28 år RESPONDENTEN OM DE SOCIALE MEDIER Bilag 11 - Transskribering, Kvinde 28 år RESPONDENTEN OM DE SOCIALE MEDIER 1. Hvilke sociale medier har du anvendt den seneste måneds tid? Facebook Instagram Snapchat Bruger en lille smule YouTube, hvis

Læs mere

bytte Jeg får en praktikplads Du får en kvalificeret medarbejder i et år, nye øjne og frisk viden i laboratoriet og

bytte Jeg får en praktikplads Du får en kvalificeret medarbejder i et år, nye øjne og frisk viden i laboratoriet og Skal vi bytte Jeg får en praktikplads Du får en kvalificeret medarbejder i et år, nye øjne og frisk viden i laboratoriet og mulighed for at realisere nye projekter 1 Derfor får du denne appel... Der er

Læs mere

Guldbog Kemi C Copyright 2016 af Mira Backes og Christian Bøgelund.

Guldbog Kemi C Copyright 2016 af Mira Backes og Christian Bøgelund. Guldbog Kemi C Copyright 2016 af Mira Backes og Christian Bøgelund. Alle rettigheder forbeholdes. Mekanisk, fotografisk eller elektronisk gengivelse af denne bog eller dele heraf er uden forfatternes skriftlige

Læs mere

Sammen om velfærd. Vi har brug for dig

Sammen om velfærd. Vi har brug for dig Sammen om velfærd Vi har brug for dig Vi lever i en ny virkelighed, hvor det kommunale husholdningsbudget er presset. Det kræver, at vi sammen skaber en ny velfærd. Det kalder vi Ny virkelighed Ny velfærd.

Læs mere

LÆREMIDDELTJEK - HVOR TJEKKET ER DET? VINGSTED 041110. Dorthe Carlsen (dca@ucsyd.dk) UCSyddanmark og Læremiddel.dk

LÆREMIDDELTJEK - HVOR TJEKKET ER DET? VINGSTED 041110. Dorthe Carlsen (dca@ucsyd.dk) UCSyddanmark og Læremiddel.dk LÆREMIDDELTJEK - HVOR TJEKKET ER DET? VINGSTED 041110 Dorthe Carlsen (dca@ucsyd.dk) UCSyddanmark og Læremiddel.dk SKOLEBIBLIOTEKETS DAG 2010 - LÆREMIDLERNE OG SKOLENS LÆRINGSCENTER [ ét enkelt af spørgsmålene.]:

Læs mere

Workshop C: Forskningslignende opgaver i biologiske og kemiske fag

Workshop C: Forskningslignende opgaver i biologiske og kemiske fag Workshop C: Forskningslignende opgaver i biologiske og kemiske fag Forskningsbaseret undervisning Karla Frydenvang, lektor, PhD Institut for Medicinalkemi Farmaceutisk Fakultet, Københavns Universitet

Læs mere

gode grunde til at vælge en steinerskole

gode grunde til at vælge en steinerskole 10 gode grunde til at vælge en steinerskole LYSTEN TIL AT LÆRE BEVARES På Steinerskolerne ruster vi eleverne til at have lyst til at lære hele livet igennem, for hvis eleverne er åbne og i stand til at

Læs mere

Undervisningsbeskrivelse for STX 2m Kemi B

Undervisningsbeskrivelse for STX 2m Kemi B Undervisningsbeskrivelse for STX 2m Kemi B Termin Afslutning i juni skoleår 13/14 Institution Marie Kruses Skole Uddannelse Fag og niveau Lærer(e) Hold STX Kemi A valgfag Hasse Bonde Rasmussen 3gKE Denne

Læs mere

Årsplan Skoleåret 2013/14 Biologi

Årsplan Skoleåret 2013/14 Biologi Årsplan Skoleåret 203/4 Biologi Nedenfor følger i rækkefølge undervisningsplaner for skoleåret 3/4. Skolens del og slutmål følger folkeskolens fællesmål slut 2009. Årsplan FAG: Biologi KLASSE: 7 ÅR: 3/4

Læs mere

Hvad skal vi med fransk

Hvad skal vi med fransk Hvad skal vi med fransk i folkeskolen? Af Nina Hauge Jensen, lektor 52 Med denne lidt provokerende overskrift antyder jeg, at der er nogle grundforståelser vedrørende folkeskolens andet fremmedsprog, som

Læs mere

Skolen er alt for dårlig til at motivere de unge

Skolen er alt for dårlig til at motivere de unge DEBAT 16. AUG. 2015 KL. 14.32, Politiken Skolen er alt for dårlig til at motivere de unge Vi har helt misforstået, hvad der skal til for at lære de unge noget, siger lektor Mette Pless på baggrund af en

Læs mere

Et kompetencekatalog med øvelser. Et kompetencekatalog med øvelser

Et kompetencekatalog med øvelser. Et kompetencekatalog med øvelser Et kompetencekatalog med øvelser Et kompetencekatalog med øvelser Knæk studiekoden! Et kompetencekatalog med øvelser Af Hanne Heimbürger 1. e-udgave, 2009 ISBN 978-87-625-0310-6 2008 Gyldendalske Boghandel,

Læs mere

Evalueringsstrategi for Næstved Gymnasium og hf

Evalueringsstrategi for Næstved Gymnasium og hf Evalueringsstrategi for Næstved Gymnasium og hf Om evalueringsstrategien Evalueringsstrategien udmøntes i en evalueringsplan som omfatter en evaluering af studieplanen, herunder planlægning og gennemførelse

Læs mere