DNA analyse af mulige odderekskrementer

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "DNA analyse af mulige odderekskrementer"

Transkript

1 DNA analyse af mulige odderekskrementer indsamlet på Sjælland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. august 2017 Liselotte Wesley Andersen & Bjarne Søgaard Institut for Bioscience Rekvirent: Miljøstyrelsen Antal sider: 8 Faglig kommentering: Frank Panitz, Institut for Molekylær Biologi og Genetik, AU Kvalitetssikring, centret: Jesper Fredshavn AARHUS AU UNIVERSITET DCE NATIONALT CENTER FOR MILJØ OG ENERGI Tel.:

2 Indhold Baggrund 3 Metode 3 Resultat og diskussion 4 Referencer 5 Bilag 1 6 Bilag 2 7 Bilag 3 8 2

3 Baggrund Odder (Lutra lutra) overvåges i det nationale overvågningsprogram for vandmiljø og natur (NOVANA) hvert 6. år, og den seneste overvågning er gennemført i Odderens levevis gør det ikke muligt at gennemføre en overvågning baseret på direkte observationer af arten. Til overvågning af odder anvendes derfor en international standardiseret kortlægningsmetode, der baserer sig på, at odderen afmærker sit territorium med ekskrementer, som normalt placeres på iøjnefaldende steder langs vandløb og søer. Eftersøgningen af odder-ekskrementer foretages på et i forvejen fastlagt stationsnetværk bestående af godt stationer fordelt over hele lande og er beskrevet i en teknisk anvisning (Søgaard m.fl. 2017). Den tekniske anvisning foreskriver en kvalitetssikringsprocedure for fund af ekskrementer der vurderes at stamme fra odder- der indebærer en dokumentation for artsbestemmelsen ved DNA-analyse hvorefter fundet og stationen betegnes som positiv. Denne kvalitetssikring gælder kun for fund af ekskrementer i overvågningsområder, hvor odder mangler eller er meget fåtallig: Fyn, Sjælland, Lolland, Falster og Møn. I forbindelse med NOVANA-overvågningen af odder på Sjælland blev der indleveret 12 mulige odder-ekskrementer til DNA-analyse for odder. Ekskrementerne blev indsamlet i marts 2017 af Miljøstyrelsen-Sjælland i forbindelse med overvågning af arten. 10 af de analyserede ekskrementer fundet på 8 forskellige lokaliteter kunne med sikkerhed artsbestemmes til odder (se Tabel 1 og Resultater og diskussion ). Tabel 1. Resultatet af de to uafhængige DNA-analysegange af 12 formodede odder ekskrementer indsamlet i forbindelse med NOVANA overvågning af odder på Sjælland. LabId Lokalitet MST-Station MST-nr 1. analysegang 2. analysegang Sj1 Åmose Å v Bromølle 616_65_B 90 odder odder Sj2 Åmose Å v Bromølle 616_65_B 90 odder odder Sj3 Bøstrup Å 615_64_C 105 odder odder Sj4 Bregninge Å v. Vejlebro 617_64_C 67 negativ/dårlig odder Sj5 Bregninge Å v. Vejlebro 617_64_C 67 odder odder Sj6 Bregninge Å v Bregninge 617_64_B 66 odder odder Sj7 Bregninge Å v Bregninge 617_64_B 66 Skovmår ikke analyseret Sj8 Hallenslev Bæk v Hallenslev 615_64_A 103 odder odder Sj9 Åmose Å v Undløse Å 616_66_C 93 Mink ikke analyseret Sj10 øvre Halleby Åv Øre Sø 616_64_E 88 odder odder Sj11 Nedre Halleby Å v Ornum Strand 615_63_B 102 negativ/dårlig odder Sj12 Åmose Å v Skellingsted 616_65_A 89 odder odder Metode Analysen af de indsamlede ekskrementer på Sjælland blev foretaget ved to uafhængige analysegange. Ved begge analysegange blev DNA ekstraheret og efterfølgende opformeret med en PCR og sekventeret. Ekstraktionerne blev foretaget i et DNA-laboratorium, der kun bliver benyttet til prøver, hvor DNA-koncentrationen forventes at være lav. DNA blev ekstraheret med Qiagen DNA Fast stool kit. Opformeringen af mitokondriemarkøren, der bliver benyttet til at identificere arten, er foretaget i et andet, særskilt laboratorium for at undgå kontaminering. Prøverne er artsbestemt ved hjælp af en genetisk markør (Cytochrom B) på mitochondriel DNA, der kan benyttes til at artsbestemme ilder, mink, odder, ræv, skovmår mfl. og som samtidig har en baseparlængde på ca. 180bp (Hansen & Jacobsen, 1999). Den genetiske markør 3

4 blev opformeret ved en PCR-kørsel. Prøverne blev opsat i 0,2 mikroliter mikrorør i serie af 8 sammenhængende rør (også kaldet strips). For hver af de 8 rør blev der i de 6 første rør tilsat DNA, mens de 2 sidste blev benyttet som negative kontroller, dvs. rør med enzym-mix, hvor der ikke er tilsat DNA. De 12 prøver blev opsat i replikater af 2. For at minimere kontamineringsrisikoen yderligere blev hver strip behandlet for sig, dvs. efter tilsætning af enzym og før tilsætning af DNA blev de lukket med låg. Lågene blev taget af ved tilsætning af DNA til den enkelte strips med de 8 rør og derefter lukket før tilsætning af DNA til næste strip. I første analysegang gav 10 x2 replikater et DNA-fragment. Den tomme prøve, der var medtaget fra ekstraktions-proceduren, og alle medkørte negative kontroller (12) var negative. Alle 20 opformerede DNA-fragmenter blev efterfølgende sekventeret ved firmaet MACROGEN, Holland. De fremkomne 20 sekvenser blev analyseret ved at søge efter den samme sekvens i Genbank, der er en international database, som indeholder sekvenser fra både dyre- og plantearter. Et match blev accepteret, når den pågældende sekvens havde > 97% overensstemmelse med den mest sandsynlige art, der blev fundet i databasen. Her blev der fundet en mink og en skovmår blandt de 10 prøver (beskrevet under Resultater og diskussion ). I anden analysegang blev alle 8 positive prøver for odder ekstraheret igen samt de 2 af de 12 prøver, der ikke havde virket i første omgang. Prøverne blev analyseret som beskrevet for den første analysegang, dvs. også med 2 replikater pr prøve, 1 tom prøve fra ekstraktionen og 9 negative kontroller. Igen var de negative prøver samt den tomme prøve ekstraktions-proceduren negative. Resten, de 10x2 replikater fra de gen-ekstraherede prøver gav alle et DNA-fragment, som blev sendt til sekventering hos MACROGEN, Holland. Resultat og diskussion I første analysegang af de 12 prøver havde 8 (Sj1, SJ2, Sj3, Sj5, Sj6, Sj8, Sj10, Sj12) prøver 99% match med odder (bilag 1, 2, 3). Begge replikater gav samme resultat (bilag 3). Der blev observeret to forskellige haplotyper, OD2 og OD3 (bilag 1, 2). I anden analysegang blev de to prøver, der ikke viste odder, sorteret fra. Resultatet af denne analyse viste, at alle 10 prøver var oddere. Der var fuld overensstemmelse mellem de 8 prøver, hvor der blev observeret 99% match med odder og samme haplotype i både analysegang 1 og 2. To prøver, Sj4 og Sj11, der var negative i første analyse gang, kunne bestemmes i anden analysegang. Her blev Sj4 identificeret som odder med 99% match og haplotype OD2 i begge replikater. Prøve Sj11 havde 98% og 97% match til odder for de to replikater. Sj11A kunne bestemmes til OD3 ved sammenligning med de andre opnåede sekvenser. Denne uafhængige dobbeltbestemmelse af alle prøver samt replikater påviser, at de indleverede prøver med meget stor sandsynlighed stammer fra odder. OD2 blev fundet blandt de fynske oddere (Andersen & Søgaard, 2017), mens OD3 ikke er observeret tidligere. Ved sammenligning med sjællandske odderprøver, der blev påvist i 2007 (Andersen et al. 2016) og verificeret af et hollandsk laboratorie, viste analysen, at de sjællandske oddere, der blev indsamlet i 2006, havde haplotype OD2. Derved er OD3 en ny haplotype. To af prøverne havde 99% match med henholdsvis mink (Mustela vison) og skovmår (Martes martes) (bilag 3). OD1 den anden haplotype, der også blev påvist på Fyn, blev ikke observeret blandt de 12 prøver. Det betyder, at der har været eller er mindst 2 forskellige individer på Sjælland. 4

5 Referencer Andersen, L.W. (2016). Resultat af DNA analyse af fire mulige odder-ekskrementer indsamlet på Fyn. (Teknisk notat afleveret til Rambøll Danmark A/S sendt 19/5-2016) Andersen, LW & Søgaard, B., Madsen AB. 2016, 'DNA analyse af odderekskrementer fra Sjælland'. Notat fra DCE - Nationalt center for Miljø- og Energi Andersen, LW & Søgaard, B. 2017, 'DNA analyse af mulige odder-ekskrementer indsamlet på Fyn'. Notat fra DCE - Nationalt center for Miljø- og Energi Hansen, M.M. & L. Jacobsen (1999). Identification of Mustelid species: otter (Lutra lutra). American Mink (Mustela vision) and polecat (Mustela putorius) by analysis of DNA from faecal samples. - J. Zool. L. 247, Søgaard, B., Elmeros, M. & Madsen, A.B. (2017). Overvågning af odder Lutra lutra. Teknisk anvisning til ekstensiv overvågning fra DCE's Fagdatacenter for Biodiversitet og Terrestrisk natur; Nr. A01, Ver.1.3. Aarhus Universitet, DCE - Nationalt Center for Miljø og Energi, s. 5

6 Alignment statistics for match #1 Bilag 1 Haplotype OD2 fundet i prøvenr : Sj4, Sj5, Sj6 ACATCAGACACAACCACAGCCTTCTCATCAGTCGCACACATCTGCCGAGACGTCAAC- TACGGCTGGATTATCCGATACATACACGCAAACGGAGCCTCCATATTCTTCATCTGCCTGT- TCCTACATGTAGGACGCGGCCTGTACTACGGATCTTATATATTCCCCGAAACATGAA Lutra lutra mitochondrial Cytb gene for Cytochrome b protein, haplotype H3 Sequence ID: LT Length: 1140Number of Matches: 1 Related Information Range 1: 166 to 340GenBankGraphicsNext MatchPrevious Match Score Expect Identities Gaps Strand 318 bits(172) 2e /175(99%) 0/175(0%) Plus/Plus Query 1 ACATCAGACACAACCACAGCCTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTAC 60 Sbjct 166 ACATCAGACACAACCACAGCCTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTAC 225 Query 61 GGCTGGATTATCCGATACATACACGCAAACGGAGCCTCCATATTCTTCATCTGCCTGTTC 120 Sbjct 226 GGCTGGATTATCCGATACATACACGCAAACGGAGCCTCCATATTCTTCATCTGCCTGTTC 285 Query 121 CTACATGTAGGACGCGGCCTGTACTACGGATCTTATATATTCCCCGAAACATGAA 175 Sbjct 286 CTACATGTAGGACGCGGCCTGTACTACGGATCTTATATATTCCCTGAAACATGAA 340 6

7 Alignment statistics for match #1 Bilag 2 Haplotype OD3 fundet i prøvenr: Sj1, Sj2, Sj3, Sj8, Sj10, Sj11, Sj12 ACATCAGACACAACCACAGCCTTCTCATCAGTCGCACACATCTGCCGAGACGTCAGC- TACGGCTGGATTATCCGATACATACACGCAAACGGAGCCTCCATATTCTTCATCTGCCTGT- TCCTACATGTAGGACGCGGCCTGTACTACGGATCTTATATATTCCCCGAAACATGAA Lutra lutra mitochondrial Cytb gene for Cytochrome b protein, haplotype H7 Sequence ID: LT Length: 1140Number of Matches: 1 Related Information Range 1: 166 to 340GenBankGraphicsNext MatchPrevious Match Score Expect Identities Gaps Strand 313 bits(169) 1e /175(99%) 0/175(0%) Plus/Plus Query 1 ACATCAGACACAACCACAGCCTTCTCATCAGTCGCACACATCTGCCGAGACGTCAGCTAC 60 Sbjct 166 ACATCAGACACAACCACAGCCTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTAC 225 Query 61 GGCTGGATTATCCGATACATACACGCAAACGGAGCCTCCATATTCTTCATCTGCCTGTTC 120 Sbjct 226 GGCTGGATTATCCGATACATACACGCAAACGGAGCCTCCATATTCTTCATCTGCCTGTTC 285 Query 121 CTACATGTAGGACGCGGCCTGTACTACGGATCTTATATATTCCCCGAAACATGAA 175 Sbjct 286 CTACATGTAGGACGCGGCCTGTACTACGGATCTTATATATTCCCTGAAACATGAA 340 7

8 Bilag 3 Resultat af DNA-analyser af formodede odder-prøver fra Sjælland LabId 1. Analysegang Match 2. Analysegang Match Sj1A OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj1B OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj2A OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj2B OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj3A OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj3B OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj4A Neg OD2 (174/175bp) 99% Sj4B Neg OD2 (174/175bp) 99% Sj5A OD2 (174/175bp) 99% OD2 (174/175bp) 99% Sj5B OD2 (174/175bp) 99% OD2 (174/175bp) 99% Sj6A OD2 (174/175bp) 99% OD2 (174/175bp) 99% Sj6B OD2 (174/175bp) 99% OD2 (174/175bp) 99% Sj7A Skovmår (171/173bp) 99% NA Sj7B Skovmår (171/173bp) 99% NA Sj8A OD3 (170/172bp) 99% OD3 (173/175bp) 99% SJ8B OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj9A Mink (173/175bp) 99% NA Sj9B Mink (173/175bp) 99% NA Sj10A OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj10B OD3 (173/175bp) 99% OD3 (173/175bp) 99% Sj11A Neg OD3(d) (135/138bp) 98% SJ11B Neg OD_kort (111/114bp) 97% Sj12A OD3 (173/175bp) 99% OD3 (173/175bp) 99% SJ12B OD3 (173/175bp) 99% OD3 (142/144p) 99% Neg= Ikke virket NA= ikke analyseret OD_kort= sekvensen for kort til at bestemme haplotype men prøven viste odder OD3(d)= Få basepar er usikre med det der odder og ligner OD3. (173/175bp) = 175basepar I den opnåede sekvens matcher 173 basepar I oddersekvens I Genbank 8

DNA analyse af mulige odder-ekskrementer indsamlet på Fyn

DNA analyse af mulige odder-ekskrementer indsamlet på Fyn DNA analyse af mulige odder-ekskrementer indsamlet på Fyn Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12. juni 2017 Liselotte Wesley Andersen & Bjarne Søgaard Institut for Bioscience Rekvirent:

Læs mere

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får

DNA analyse til artsidentifikation af spytprøver fra to dødfundne får DNA analyse til artsidentifikation af spytprøver fra to dødfundne får Notat fra DCE -Nationalt Center for Miljø og Energi Dato: 22. oktober 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015

Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Resultater af DNA-analyser udført på indsendte spytprøver fra nedlagte husdyr fra 2. og 3. kvartal 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 19.oktober 2015 Liselotte Wesley Andersen

Læs mere

DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam

DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam DNA analyse til artsidentifikation af spytprøver fra kalve, får og lam Notat fra DCE Nationalt Center for Miljø og Energi Dato: 5. september 2013 Liselotte Wesley Andersen Institut for Bioscience Rekvirent:

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. oktober 2014 Liselotte Wesley Andersen Institut

Læs mere

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Liselotte Wesley Andersen Institut for Bioscience

Læs mere

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer

Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Identifikation af DNA-sekvenser fra ulv og hund i spytprøver fra bidsår på husdyr og vildt samt i ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2014 Liselotte Wesley

Læs mere

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer

Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Individ identifikation af ulve fra spytprøver fra bidsår på husdyr og vildt samt fra ekskrementer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12 juni 2014 Liselotte Wesley Andersen Institut

Læs mere

DNA-analyser af odderekskrementer fra Sjælland

DNA-analyser af odderekskrementer fra Sjælland DNA-analyser af odderekskrementer fra Sjælland Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. juli 2016 Liselotte Wesley Andersen, Bjarne Søgaard & Aksel Bo Madsen Institut for Bioscience

Læs mere

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm.

Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Ikke-teknisk redegørelse der besvarer forskellige spørgsmål i relation til DNAanalyser fra nedlagte husdyr mm. Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Liselotte Wesley Andersen

Læs mere

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets

Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Danmarks rapportering af bevaringsstatus for naturtyper og arter til EU jf. Habitatdirektivets Artikel 17 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 28. juni 2013 Hanne Bach & Jesper Fredshavn

Læs mere

Indhold. Titel: Overvågning af odder Lutra lutra

Indhold. Titel: Overvågning af odder Lutra lutra Titel: Overvågning af odder Lutra lutra Dokumenttype: Teknisk anvisning til ekstensiv overvågning Forfattere: Bjarne Søgaard, Morten Elmeros & Aksel Bo Madsen Institut for Bioscience, Aarhus Universitet

Læs mere

Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark

Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark Artsidentifikation og slægtskabsanalyse af to dødfundne guldsjakaler (Canis aureus) i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. april 2017 Liselotte W. Andersen Institut for

Læs mere

Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer

Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer Naturtilstanden på kommunernes 3- områder og habitatområdernes småsøer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. november 2016 Jesper Fredshavn DCE Nationalt Center for Miljø og Energi

Læs mere

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013

Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Fagligt svar på spørgsmål om forekomst af ulve i Danmark i 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. august 2014 Liselotte Wesley Andersen & Aksel Bo Madsen Institut for Bioscience

Læs mere

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen

Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen Bemærkninger til Naturstyrelsens retningslinjer for behandling af data for miljøfarlige forurenende stoffer i Basisanalysen 2013 Retningslinjer af 10. december 2013 Notat fra DCE - Nationalt Center for

Læs mere

Interkalibrering Sedimentprøvetagning i søer

Interkalibrering Sedimentprøvetagning i søer Interkalibrering Sedimentprøvetagning i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato:. december 2012 Liselotte Sander Johansson Martin Søndergaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl

Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl Titel: Overvågning af nordisk lappedykker Podiceps auritus som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA.

Læs mere

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter

Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Vildtudbyttestatistikkens anvendelighed som indikator for tilstedeværelsen af reproducerende bestande af visse invasive arter Notat fra DCE Nationalt Center for Miljø og Energi Dato: 31. oktober 2014 Tommy

Læs mere

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur

Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Beregning af bufferzoner på marker, der grænser op til Kategori 1 og 2 natur Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. september 2015 Bettina Nygaard & Jesper Bladt Institut for Bioscience

Læs mere

Titel: Overvågning af sangsvane Cygnus cygnus som ynglefugl

Titel: Overvågning af sangsvane Cygnus cygnus som ynglefugl Titel: Overvågning af sangsvane Cygnus cygnus som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA. nr.: A107 Version:

Læs mere

Odder og stopriste/spærreanordninger i fiskeredskaber i visse salte vande

Odder og stopriste/spærreanordninger i fiskeredskaber i visse salte vande Odder og stopriste/spærreanordninger i fiskeredskaber i visse salte vande Supplement til notat af 10. november 2011 vedr. anvendelse af stopriste/spærreanordninger i fiskeredskaber for at undgå drukning

Læs mere

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn

Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Indberetning af vildtudbytte for jagtsæsonen 2014/15 første sæson med reglen om vildtudbytte før jagttegn Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. maj 2016 Tommy Asferg Institut for

Læs mere

Redegørelse for beregning af arealer af sønaturtyper Indberettet i forbindelse med habitatdirektivets Artikel 17-afrapportering i 2013

Redegørelse for beregning af arealer af sønaturtyper Indberettet i forbindelse med habitatdirektivets Artikel 17-afrapportering i 2013 Redegørelse for beregning af arealer af sønaturtyper Indberettet i forbindelse med habitatdirektivets Artikel 17-afrapportering i 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. april

Læs mere

Overvågning af bæver i Danmark 2011

Overvågning af bæver i Danmark 2011 Overvågning af bæver i Danmark 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 3. juli 2012 Jørn Pagh Berthelsen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 7 Redaktion:

Læs mere

Ynglende ringduer i september, oktober og november

Ynglende ringduer i september, oktober og november Ynglende ringduer i september, oktober og november Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. juni 2015 Kevin Kuhlmann Clausen & Thomas Kjær Christensen Institut for Bioscience Rekvirent:

Læs mere

Titel: Overvågning af havørn Haliaetus albicilla som ynglefugl

Titel: Overvågning af havørn Haliaetus albicilla som ynglefugl Titel: Overvågning af havørn Haliaetus albicilla som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA. nr.: A113

Læs mere

Rastende trækfugle på Tipperne 2012

Rastende trækfugle på Tipperne 2012 Rastende trækfugle på Tipperne 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. april 2013 Ole Amstrup 1 Mogens Bak 1 Karsten Laursen 2 1 Amphi Consults 2 Institut for Bioscience Rekvirent:

Læs mere

Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande

Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande Notat om basisanalyse: Opgave 2.2 Stofbelastning (N, P) af søer og kystvande Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. oktober 2013 Rev.: 2. december 2013 Jørgen Windolf, Søren E.

Læs mere

Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører

Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører Individuelle ulve (Canis lupus) dokumenteret i Danmark november 2012-juni 2017 vha. DNA-markører Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. juli 2017 Peter Sunde 1 og Kent Olsen 2 1)

Læs mere

Titel: Overvågning af dværgmåge Larus minutus som ynglefugl

Titel: Overvågning af dværgmåge Larus minutus som ynglefugl Titel: Overvågning af dværgmåge Larus minutus som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA henvisninger

Læs mere

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13

Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Kvalitetssikring af indberetninger af vaskebjørn til Vildtudbyttestatistikken for jagtsæsonen 2012/13 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. juni 2014 Tommy Asferg Institut for

Læs mere

Blue Reef. Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 AARHUS AU UNIVERSITET

Blue Reef. Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 AARHUS AU UNIVERSITET Blue Reef Status for den biologiske indvandring på Læsø Trindels nye rev i 2011 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 20. juni 2013 Karsten Dahl Institut for Institut for Bioscience

Læs mere

Titel: Overvågning af hedepletvinge Euphydryas aurinia.

Titel: Overvågning af hedepletvinge Euphydryas aurinia. Titel: Overvågning af hedepletvinge Euphydryas aurinia. Dokumenttype: Teknisk anvisning til ekstensiv overvågning Forfattere: Bjarne Søgaard¹ og Flemming Helsing² ¹ Institut for Bioscience, Aarhus Universitet

Læs mere

Reduktioner i overvågningsprogrammet

Reduktioner i overvågningsprogrammet Reduktioner i overvågningsprogrammet NOVANA Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. april 2015 Poul Nordemann Jensen DCE Nationalt Center for Miljø og Energi Antal sider: 5 Faglig

Læs mere

Optællinger af ynglefugle i det danske Vadehav 2012

Optællinger af ynglefugle i det danske Vadehav 2012 Optællinger af ynglefugle i det danske Vadehav 2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 24. april 2013 Ole Thorup Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden

Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden Præcisering af trendanalyser af den normaliserede totale og diffuse kvælstoftransport i perioden 2005-2012 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. april 2014 30. april 2014 Søren

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2010/11

Vildtudbyttestatistik for jagtsæsonen 2010/11 Vildtudbyttestatistik for jagtsæsonen 2010/11 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. november 2011 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering

Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Workshop om kortlægning af Forekomst af lampretlarver Resultater og evaluering Internt notat fra DCE - Nationalt Center for Miljø og Energi Dato: 18. april 2016 Forfattere: Peter Wiberg-Larsen Institut

Læs mere

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde

Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Screening af sprængninger i forbindelse med ammunitionsrydning i Hullebæk skydeområde ved Raghammer Odde Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. september 2013 Ib Krag Petersen Jakob

Læs mere

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015

Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Omfanget af bifangster af fugle i nedgarn i fritidsfiskeriet i to NATURA2000- områder Statusrapport, april 2015 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. april 2015 Ib Krag Petersen

Læs mere

Notat vedr. interkalibrering af ålegræs

Notat vedr. interkalibrering af ålegræs Notat vedr. interkalibrering af ålegræs Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. januar 2012 Michael Bo Rasmussen Thorsten Balsby Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Titel: Overvågning af vindelsnegle: Sumpvindelsnegl Vertigo moulinsiana, skæv vindelsnegl Vertigo angustior og kildevældsvindelsnegl

Titel: Overvågning af vindelsnegle: Sumpvindelsnegl Vertigo moulinsiana, skæv vindelsnegl Vertigo angustior og kildevældsvindelsnegl NATIONALT CENTER FOR MILJØ OG ENERGI AARHUS UNIVERSITET Titel: Overvågning af vindelsnegle: Sumpvindelsnegl Vertigo moulinsiana, skæv vindelsnegl Vertigo angustior og kildevældsvindelsnegl Vertigo geyeri

Læs mere

Titel: Overvågning af birkemus Sicista betulina

Titel: Overvågning af birkemus Sicista betulina Titel: Overvågning af birkemus Sicista betulina Dokumenttype: Teknisk anvisning til ekstensiv overvågning Forfattere: Bjarne Søgaard¹ og Julie Dahl Møller² ¹ Institut for Bioscience, Aarhus Universitet

Læs mere

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014

Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Rastefugle trækfugle på Tipperne og i Ringkøbing Fjord, 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. januar 2015 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience

Læs mere

0 Indhold. Titel: Overvågning af skestork Platalea leucorodia som ynglefugl. Dokumenttype: Teknisk anvisning. Version: 1

0 Indhold. Titel: Overvågning af skestork Platalea leucorodia som ynglefugl. Dokumenttype: Teknisk anvisning. Version: 1 Titel: Overvågning af skestork Platalea leucorodia som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Stefan Pihl, Thomas Eske Holm, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet TA. nr.: A106

Læs mere

Titel: Overvågning af sortterne som ynglefugl

Titel: Overvågning af sortterne som ynglefugl Titel: Overvågning af sortterne som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Thomas Bregnballe & Thomas Eske Holm Aarhus Universitet TA. nr.: A154 Version: 2 Oprettet: 06.03.2017 Gyldig fra:

Læs mere

Odder Lutra lutra teknisk anvisning til ekstensiv overvågning

Odder Lutra lutra teknisk anvisning til ekstensiv overvågning Fagdatacenter for Biodiversitet og Terrestriske Naturdata, Danmarks Miljøundersøgelser Dokumenttype: Teknisk anvisning Dok. nr: A1 Version: 1.1 Oprettet: 04-02-2003 Titel: Overvågning af odder Gyldig fra:

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Sebastian, Louise og Ana Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Sebastian, Louise og Ana Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Dagens program 9:00 10:00 Introduktion

Læs mere

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug

Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Vurdering af Dansk Akvakulturs forslag til ændret vandindtag på dambrug Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 01. december 2013 Rettet: 21. februar 2014 og 8. marts 2014 Lars M. Svendsen

Læs mere

Rastefugle på Tipperne 2013

Rastefugle på Tipperne 2013 Rastefugle på Tipperne 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. marts 2014 Ole Amstrup, Mogens Bak & Karsten Laursen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

DNA-analyser af ulv Ulve i Danmark

DNA-analyser af ulv Ulve i Danmark DNA-analyser af ulv Ulve i Danmark Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. februar 2016 Liselotte Wesley Andersen Institut for Bioscience Antal sider: 6 Faglig kvalitetssikring: Flemming

Læs mere

Anskydning af vildt. Status for undersøgelser 2014

Anskydning af vildt. Status for undersøgelser 2014 Anskydning af vildt. Status for undersøgelser 2014 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 10. december 2014 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Kriterier for ringduers yngletid og forårstræktid

Kriterier for ringduers yngletid og forårstræktid Kriterier for ringduers yngletid og forårstræktid Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. maj 2015 Kevin Kuhlmann Clausen & Thomas Eske Holm Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Indberetning af vildsvin til Vildtudbyttestatistikken

Indberetning af vildsvin til Vildtudbyttestatistikken Indberetning af vildsvin til Vildtudbyttestatistikken for sæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig

Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Screening af brug af Side Scan Sonar og bortsprængning af miner i Samsøbælt, Langelandsbælt og Begtrup Vig Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 23. oktober 2013 Thomas Eske Holm Ib

Læs mere

Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb

Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb Talmateriale vedr. landbrugets og skovbrugets udledninger til vandløb Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 7. december 2011 Poul Nordemann Jensen DCE Nationalt Center for Miljø og

Læs mere

Danmarks Naturdata. Jesper Fredshavn, Danmarks Miljøundersøgelser, Aarhus Universitet, Kalø

Danmarks Naturdata. Jesper Fredshavn, Danmarks Miljøundersøgelser, Aarhus Universitet, Kalø Danmarks Naturdata Jesper Fredshavn, Danmarks Miljøundersøgelser, Aarhus Universitet, Kalø Danmarks Naturdata Danmarks Naturdata er en del af det fællesoffentlige partnerskab om Miljøportalen mellem Miljøministeriet,

Læs mere

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen

Arealer, urbanisering og naturindhold i kystnærhedszonen, strandbeskyttelseslinjen og klitfredningslinjen Arealer, urbanisering og naturindhold i, strandbeskyttelseslinjen og klitfredningslinjen Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 25. september 2015 Gregor Levin Institut for Miljøvidenskab,

Læs mere

Bortsprængning af miner i nordlige Storebælt

Bortsprængning af miner i nordlige Storebælt Bortsprængning af miner i nordlige Storebælt Notat fra DCE - Nationalt Center for Miljø og Energi Jakob Tougaard, Ib Krag Pedersen & Karsten Dahl Institut for Bioscience Rekvirent: Forsvarets Bygnings-

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer

Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Interkalibrering Feltmålinger og prøvetagning til analyse af vandkemi i søer Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14. oktober 2013 Forfatter Liselotte Sander Johansson Institut for

Læs mere

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande Foto Finn Sivebæk 1 Historien Anvendelse af genetisk viden i forvaltning i DK 1994 Hansen et al. 1993 -? Nielsen et

Læs mere

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹ Titel: Overvågning af engryle som ynglefugl Dokumenttype: Teknisk anvisning TA. nr.: A134 Version: 1 Oprettet: 17.04.2012 Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Læs mere

NOVANA Overvågning af arter & Naturtyper

NOVANA Overvågning af arter & Naturtyper Institut for Bioscience AARHUS UNIVERSITET Naturovervågning hvorfor og hvordan? 2. Marts 2013 NOVANA Overvågning af arter & Naturtyper & Thomas Eske Holm Institut for Bioscience Aarhus Universitet Naturovervågning

Læs mere

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København

Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Sparede eksterne omkostninger for luftforurening ved en geografisk udvidelse af ren-luftzone i København Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11-06-2014 Forfatter: Steen Solvang Jensen

Læs mere

Notat vedr. tidlig såning af vintersæd i Landovervågningen

Notat vedr. tidlig såning af vintersæd i Landovervågningen Notat vedr. tidlig såning af vintersæd i Landovervågningen Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 1. februar 217 Anton Rasmussen Institut for Bioscience Rekvirent: Landbrugs- og Fiskeristyrelsen

Læs mere

MiSeq i den daglige rutine. MRSA og VRE Isolater.

MiSeq i den daglige rutine. MRSA og VRE Isolater. MiSeq i den daglige rutine. MRSA og VRE Isolater. 4. juni 2014 DTU Peder Worning, KMA Hvidovre Hvorfor Genomsekventere i Rutinen? Hvad bruger vi DNA-sekvenser til? Typning og bestemmelse af MRSA PCR baserede

Læs mere

Anskydning af kortnæbbet gås - opdatering 2016

Anskydning af kortnæbbet gås - opdatering 2016 Anskydning af kortnæbbet gås - opdatering 2016 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 9. maj 2016 Jesper Madsen og Lars Haugaard Institut for Bioscience Antal sider: 5 Faglig kommentering:

Læs mere

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side 1 af 14 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

GAPDH PCR modul Manual

GAPDH PCR modul Manual GAPDH PCR modul Manual Katalog nr. 166-5010EDU explorer.bio-rad.com Kopiering kun tilladt til undervisningsbrug Bemærk: Kittet indeholder temperaturfølsomme dele. Åbn derfor straks kassen og læg de pågældende

Læs mere

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D.

Testet i udlandet. Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 11-11-2013. Forfatter: Janus Vang, Ph.D. 11-11-2013 Testet i udlandet Oversigt af udenlandske analyser rekvireret fra Færøerne i 2013 Forfatter: Janus Vang, Ph.D. ANSVARLIG: REGIN W. DALSGAARD, BESTYRELSESFORMAND FOR VINNUFRAMI INTRODUKTION Færøernes

Læs mere

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord

Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Kortfattet redegørelse vedr. udlægning af sten i Flensborg Fjord Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 26. juni 2012 Poul Nordemann Jensen Rekvirent: Naturstyrelsen Antal sider: 5

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan

Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Jagt- og reguleringsindsatsen i forhold til ræv på ejendomme med biotopplan Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 5. juli 2013 Tommy Asferg Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Oprettet: Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹ Titel: Overvågning af brushane som ynglefugl Dokumenttype: Teknisk anvisning TA. nr.: A135 Version: 1 Oprettet: 17.04.2012 Forfattere: Stefan Pihl¹, Johnny Kahlert¹, Thomas Eske Holm¹ og Bjarne Søgaard¹

Læs mere

0 Indhold. Titel: Overvågning af bramgås Branta leucopsis som ynglefugl. Dokumenttype: Teknisk anvisning

0 Indhold. Titel: Overvågning af bramgås Branta leucopsis som ynglefugl. Dokumenttype: Teknisk anvisning Titel: Overvågning af bramgås Branta leucopsis som ynglefugl Dokumenttype: Teknisk anvisning Forfattere: Thomas Eske Holm, Thomas Kjær Christensen, Stefan Pihl, Johnny Kahlert & Bjarne Søgaard Aarhus Universitet

Læs mere

Anskydning af vildt. Status for undersøgelser

Anskydning af vildt. Status for undersøgelser Anskydning af vildt. Status for undersøgelser 2013 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 29. november 2013 Thomas Eske Holm Lars Haugaard Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016

Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 11. august 2016 Rev.: 6. oktober 2016 Tillæg til Notat om omfordeling af arealdelen af husdyrgodkendelser i den nuværende regulering og ved forslag til ny husdyrregulering og effekter på kvælstofudledningen Notat fra DCE - Nationalt Center

Læs mere

DÅVILDT I DANMARK STATUS FOR BE- STAND OG UDBYTTE 2017

DÅVILDT I DANMARK STATUS FOR BE- STAND OG UDBYTTE 2017 DÅVILDT I DANMARK STATUS FOR BE- STAND OG UDBYTTE 2017 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 30. november 2017 Thomas Kjær Christensen og Lars Haugaard Institut for Bioscience Rekvirent:

Læs mere

Statistisk analyse af næringsstoffers stabilitet

Statistisk analyse af næringsstoffers stabilitet Statistisk analyse af næringsstoffers stabilitet Notat fra DCE Nationalt Center for Miljø og Energi Dato: 4. august 216 Jacob Carstensen Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider: 21

Læs mere

Vurdering af to vandindtag, der bruges til udsanding af muslinger

Vurdering af to vandindtag, der bruges til udsanding af muslinger Vurdering af to vandindtag, der bruges til udsanding af muslinger Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 14-06-2016 Hans H Jakobsen Christian Mohn Institut for Bioscience Rekvirent:

Læs mere

Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder

Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder Vurdering af datagrundlag for virkemidlet tidlig såning af vinterhvede som mulig alternativ til efterafgrøder Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 12. maj 2014 Gitte Blicher-Mathiesen

Læs mere

Emne Spørgsmål Svar 2.1. Afgrænsning af vandområder. Hvordan er vandområdernes afgrænsning vist i itværktøjet?

Emne Spørgsmål Svar 2.1. Afgrænsning af vandområder. Hvordan er vandområdernes afgrænsning vist i itværktøjet? Emne Spørgsmål Svar 2.1. Afgrænsning af Hvordan er nes afgrænsning vist i itværktøjet? De, der er medtaget i den tekniske afgrænsning, er, der ud fra Miljøstyrelsens viden opfylder de fastsatte kriterier.

Læs mere

NATIONALT CENTER FOR MILJØ OG ENERGI 1

NATIONALT CENTER FOR MILJØ OG ENERGI 1 1 Titel: Udtagning af sedimentprøve til analyse for miljøfremmede stoffer i søer. Dokumenttype: Teknisk anvisning Forfatter: Liselotte Sander Johansson Fagdatacenter for Ferskvand Institut for Bioscience

Læs mere

Fremsøgning af data i Danmarks Naturdata v. Jesper Fredshavn

Fremsøgning af data i Danmarks Naturdata v. Jesper Fredshavn Fremsøgning af data i Danmarks Naturdata v. Jesper Fredshavn Overblik over søgemulighederne i Danmarks Naturdata På søgefanebladene kan du kombinere søgekriterier for geografisk område, tidsperiode, arter,

Læs mere

Vildtudbyttestatistik for jagtsæsonen 2011/12

Vildtudbyttestatistik for jagtsæsonen 2011/12 Vildtudbyttestatistik for jagtsæsonen 2011/12 Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 15. oktober 2012 Tommy Asferg Aarhus Universitet, Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

FORKOMST OG EFFEKTER AF HORMONFORSTYRRENDE KEMIKALIER I DANSKE VANDLØB

FORKOMST OG EFFEKTER AF HORMONFORSTYRRENDE KEMIKALIER I DANSKE VANDLØB AARHUS UNIVERSITET Den 8. December 2010 FORKOMST OG EFFEKTER AF HORMONFORSTYRRENDE KEMIKALIER I DANSKE VANDLØB Pia Lassen, Seniorforsker Danmarks Miljøundersøgelser, Aarhus Universitet FORMÅL Formålet

Læs mere

0 Indhold NATIONALT CENTER FOR MILJØ OG ENERGI AARHUS UNIVERSITET. Version:

0 Indhold NATIONALT CENTER FOR MILJØ OG ENERGI AARHUS UNIVERSITET. Version: Dokumenttype: Teknisk anvisning Forfattere: Liselotte Sander Johansson, Fagdatacenter for Ferskvand, Peter Wind, Fagdatacenter for Biodiversitet og terrestrisk natur Institut for Bioscience TA henvisninger

Læs mere

Ekstremværdianalyse af vandføringsdata

Ekstremværdianalyse af vandføringsdata Ekstremværdianalyse af vandføringsdata Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 31.januar 014 Forfatter: Søren Erik Larsen og Niels Bering Ovesen Institut for Bioscience Rekvirent: Naturstyrelsen

Læs mere

Dokumenttype: Teknisk anvisning Titel: Kortlægning af levesteder for eremit

Dokumenttype: Teknisk anvisning Titel: Kortlægning af levesteder for eremit Fagdatacenter for Biodiversitet og Terrestriske Naturdata, Danmarks Miljøundersøgelser Forfattere: Bjarne Søgaard, Palle Jørum, Philip Francis Thomsen og Ole Martin Dokumenttype: Teknisk anvisning Titel:

Læs mere

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder

Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Screening af BALTOPS 13 øvelsesaktiviteter i relation til Natura 2000 habitatområder Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 16. april 2013 Thomas Eske Holm Karsten Dahl Jonas Teilmann

Læs mere

Bilag til: TA. Nr.: A17. Oprettet: Forfattere: Lars Christian Adrados, Kåre Fog, Bjarne Søgaard

Bilag til: TA. Nr.: A17. Oprettet: Forfattere: Lars Christian Adrados, Kåre Fog, Bjarne Søgaard ne Dokumenttype: Bilag til TA til ekstensiv overvågning af padder Bilag til: TA. Nr.: A17 Version: 1 Oprettet: 9.6.2011 Forfattere: Lars Christian Adrados, Kåre Fog, Bjarne Søgaard Gyldig fra: 1.5.2011

Læs mere

Indledning. Ekspedition Plastik i Danmark 2016

Indledning. Ekspedition Plastik i Danmark 2016 Ekspedition Plastik i Danmark 2016 Indledning Det er veletableret fakta, at der flyder plastik forurening rundt i verdenshavene. Specielt omtales 5 hotspots i de store oceaner, de såkaldte gyres i Stillehavet,

Læs mere

Ulves naturlige skyhed i områder med høj befolkningstæthed

Ulves naturlige skyhed i områder med høj befolkningstæthed Ulves naturlige skyhed i områder med høj befolkningstæthed Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 22. juni 2015 Peter Sunde Institut for Bioscience Rekvirent: Naturstyrelsen Antal sider:

Læs mere

ARTER. Deltagerliste vedlagt.

ARTER. Deltagerliste vedlagt. Beslutningsreferat af møde om høringssvar vedrørende overvågning af arter og terrestriske naturtyper den 27. februar 2003 afholdt på Botanisk Institut, Københavns Universitet Deltagerliste vedlagt. Hans

Læs mere

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus

Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus Screening af sprængninger i forbindelse med gennemførsel af undervandssprængningskursus ved Flakfortet Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 27. maj 2013 Jonas Teilmann Ib Krag Petersen

Læs mere