AGCGGCCTCCTTACCCAACTTCAG GTACCAATGGGGATCCCAGTGGG GAAGTCGATGTTGGTGCTTCTCA

Størrelse: px
Starte visningen fra side:

Download "AGCGGCCTCCTTACCCAACTTCAG GTACCAATGGGGATCCCAGTGGG GAAGTCGATGTTGGTGCTTCTCA"

Transkript

1 GCAAACTGGACATTAGCTTCTC CTGTGAGAACCTTCCAGCCTTTTC CTGTCTTCATCCTCTTCCAGCCCT C AGCGGCCTCCTTACCCAACTTCAG GTACCAATGGGGATCCCAGTGGG GAAGTCGATGTTGGTGCTTCTCA G TCTCTTTGGCCTTCGCCTTGTGCT GCATCGCTGCTTACGGCCCCGGAC GAGACTCTGTGCGGAGGGGAGC TGTTGACACGCTTCAGTTTGTCTGTTCG Genomisk Medicin GACCGCGGCTTCTACTTCAGCAG GCCTTCAAGCCGTGCCAA Årsberetning 2013 CGTCGCAGCCGTGGCATCGTGGAA GAGTGCTGCTTCCGCAGCTGCGAC CTGGCCCTCCTGGAGACATACC GTGCCACCCCCGCCAAGTCCGAG GAGGGACGTGTCTACCTCTCAGGCA CGTACTTCCGGACGACTTCCCCAG ATACCCCGTGGGCAAGTTCTTC CAATATGACACCTGGAGACAGTCT CGCGGGACGCCTGCGCAGAGGCCTGG CCTGCCCTCCTGCGTGCCCGC G CGGGGTCGCATGCTTGCCAAAGAGCT CAAAGAGTTCAGAGAGGCCAAAA GTCATCGTCCCCTGATCGTGTTACT CACCCAAAGACCCCGCCCACGGGGG C GAGCCTCTTCGGAGATGTCCAG CAACCATCAGTGAATCAAATTAT GTGGTAATTCTGCAATGTAGTAC 1

2 Genomisk Medicin Årsberetning 2013 Rigshospitalet September

3 Genomisk Medicin udspringer af forskningen i genomets sekvens og struktur og henfører til genomiske undersøgelser til diagnostik og behandling. Området baserer sig på teknologier som microarray (eng.) og Next Generation Sequencing (eng.) (NGS), der tillader transskriptom- og sekvensanalyse af genomet. Undersøgelserne betyder at man i fremtiden får mulighed for at etablere en molekylær sygdomstaxonomi, som er forudsætningen for mere præcise og virksomme behandlinger. Både internationalt og nationalt etableres enheder for Genomisk Medicin i relation til patientbehandlingen. Et af de områder, hvor Genomisk Medicin hurtigt har fundet en naturlig plads er onkologien, hvor genomundersøgelser skaber basis for skræddersyet behandling. Genomisk Medicin på Rigshospitalet er organisatorisk sammensat af en forskningsinfrastruktur samt et afsnit for genombaseret diagnostik. Enheden beskæftigede i medarbejdere og producerede ~3400 patientundersøgelser. Årsberetningen sammenfatter enhedens aktiviteter og produktion i Med venlig hilsen Finn Cilius Nielsen Enhed for Genomisk Medicin har til huse i Rigshospitalets mellembygning over hovedindgangen 3

4 Personale Professor overlæge Finn Cilius Nielsen (leder af GM) Ledende biokemiker Thomas v. O. Hansen Afdelingsbioanalytiker Martin Skygge Biokemiker Lars Jønson Bioinformatiker Rehannah Borup Afdelingslæge Lennart Friis-Hansen (ophørt december 2013) Biokemiker Jonas Vikeså Videnskabelig medarbejder/cand. Scient. Lise Barlebo Ahlborn Videnskabelig medarbejder Ane Steffensen Sekretær Leila Majdanac Sektion for molekylær cancerdiagnostik Bioanalytiker Lis Qvist Krüger Bioanalytiker Bettina Marsot Andersen Bioanalytiker Vibeke Trandbohus Bioanalytiker Vibeke Blåbjerg Bioanalytiker Shehrukh Jamil Bioanalytiker Aseeba Ayub Bioanalytiker Dorte Pedersen (ophørt maj 2013) Bioanalytiker Berit Bak Jensen Bioanalytiker Søren Petersen Bioanalytiker Julie Fisker Nielsen Bioanalytiker Majken Simonsen Bioanalytiker Charlotte Lerbech Jensen Sekretær Lene Sørensen Sekretær Louise Dreijer ENHED FOR GENOMISK MEDICIN FORSKNINGSINFRASTRUKTUR Molekylærbiologi MOLEKYLÆR DIAGNOSTIK Hereditær Cancer Microarray Integrative Genomics Endokrinologi NGS Hæmatologi Konfocal Mikroskopi Mikrobiologi GM struktur 4

5 Forskningsinfrastrukturen Bioanalytiker Ewa Futoma Bioanalytiker Stine Østergaard Bioanalytiker Cecilia Håkansson Bioanalytiker Elisabeth Schiefloe Bioanalytiker Susanne Smed Studentermedarbejder Lars Yannik Schøning Studentermedarbejder Damir Sasivarevic Fondslønnede 2013 Post Doc Matthew Marklund (NEYE) Cecilie Nandrup-Bus Kristina Døssing? Studerende Stud. Cand. Scient. Lise Barlebo Ahlborn (fastansat pr. 1/ ) Stud.med. Anders Rehfeld PhD-studerende Ane Yde Steffensen Forskere fra kliniske afdelinger Emilie Nyberg Garnæs, læge (Øre-næse-halskirurgisk og Audiologisk) Søren Bache, læge (Neuroanæstesiologisk Klinik) Igor Ralets (Klinisk Neurofysiologisk Klinik) Majken Sønderholm (CHIP) Maria Rossing, læge (KBA) David H. Jensen, læge (Øre-næse-halskirurgisk og Audiologisk) *Se desuden listen over brugere af NGS og Microarray-sektionerne. Budget Budget Personale Drift Andre indtægter NGS og microarray core- funktion Eksterne donationer Løbende bevillinger Mio. Dkr

6 Patientdiagnostik Genomisk Medicin producerede i analyser fordelt på 96 forskellige genundersøgelser. Den største produktion ligger inden for arvelig bryst og kolorektal cancer, hvor man øgede produktionen med henholdsvis 50% og 100%. Næsten alle undersøgelser foretages nu med NGS teknologi, hvilket har givet en mere rationel drift og mulighed for undersøgelse af flere gener end tidligere. Patientanalyser CMVRES HAMP NYRECAN AIP HFE ORTOGEN AIPD HFE2 P53 APC HFE2D P53D APCD HNPCC PKLR ATP8B1 HNPCCD PMS2 BMPR1A HRPT2 PMS2D BRAF HRPT2D PRSS1 BRCA HYPTHYR PTCH1 BRCA1 HÆMOKRO PTEN BRCA1D IL28B PTEND BRCA2D MCM6 RAD51C BRCAD MELANOD RAD51CD BRYST MELANOM RET BTNL2 MEN1 RETD CARD15 MEN1D SDH CASR MET SDH- D CDH1 MLH1 SDHB CDH1D MLH1D SDHC CDK4 MSH2 SDHD CDKN1B MSH2D SLC40A1 CDKN2A MSH6 SMAD4 CDKN2AD MSH6D STK11 DICER1D MSI STK11D FASE1 MUTYH TFR2 FGF23 MUTYHD THROMB FH- GEN NEUROBB VHL FH- GEND NEUROBL VHLD FLCN NEUROBM WT1 FLCND NEUROBV RNAEWING FÆOKROM NR3C1 RNASYNO GIST NR3C1D RNATRANS Teknologi Next-generation sequencing (NGS) på HighSeq2500 (Illumina) og Miseq (Illumina) DNA Sanger sekventering og MLPA analyse på Applied Biosystems Genetic Analyzer 3730 SNP analyse på Applied Biosystems ViiA7 system SNP array og mrna ekspressions array på Affymetrix microarray platform. Software Data analyseres i programmer som R, CLC workbench (CLC BIO), Ingenuity (Qiagen), Sequence pilot (JSI medical systems), Seqscape (Applied Biosystems), GeneMarker (Softgenetics), Alamut (Interactive Biosoftware), Qlucore (Qlucore), og Partek Genomics suite (Partek). 6

7 Akkreditering og Kvalitetssikring Akkreditering Enheden for Genomisk Medicin er siden 2012 DANAK akkrediteret efter ISO I 2013 var der tilsynsbesøg, hvor DANAK igen godkendte afdelingens standart. Følgende analyser er pt. DANAK akkrediteret: Brystgenpakke (BRCA1/BRCA2/CDH1/PTEN/RAD51C/TP53) Tarmkræft genpakke (MLH1/MSH2/MSH6/PMS2) HFE (hæmokromatose) BRAF GIST (c-kit/pdgfra) KRAS MSI Global CNV analyse (DNA_CytoScan) Kvalitetssikring Afdelingen afholder månedlige kvalitetssikringsmøder, hvor afvigelser, eksterne kontrolprogrammer og laboratoriesammenligninger, samt leverandørvurderinger behandles. Genomisk Medicin har i 2013 deltaget i følgende kontrolprogrammer: EMQN: BRCA, HNPCC, FAP, MEN2, VHL, HFE, EGFR, Microarray_aCGH, DNA Sanger sekventering UKNEQAS: BRAF, GIST (C-Kit/PDGFRA), MSI og NGS_Pilot RFB: KRAS EQUALIS: HFE, MCM6 (laktose intolerans) Derudover har Enheden for Genomsik Medicin deltaget i følgende laboratoriesammenligninger: AIP, TP53 og PTEN Både laboratoriesammenligninger og eksterne kontroludsendelser er forløbet tilfredsstillende i Afvigerapporter, korrigerede og forebyggende handlinger Der har været 14 afvigelser i De fleste sager var forbundet med NGS på Roche platform og MLPA.Alle afvigelser er gennemgået og afsluttet i kvalitetsudvalget. Fem afvigelser omhandlende Roche NGS technologi og prøveombytning blev desuden indberettet som utilsigtede hændelser. Dette har medført at Enheden har ændret DNA oprensnings procedure (DNA oprensningsrobot), og er overgået til Illumina NGS teknologi. 7

8 Brugere af microarray og NGS enhederne Microarray Biologisk Institut, Microbiology (Leise Riber) Bonkolab, RH (Mette Levinsen) BRIC, Engelholm Group (Lars Henning Engelholm) BRIC, Frødin Group (Morten Frødin) BRIC, Helin Group (Kasper Dindler Rasmussen) BRIC, Helin Group (Patrycja Sroczynska) BRIC, Issazadeh-Navikas Group (Yawei Liu) BRIC, Porse Group (Elisabeth Søndergaard) BRIC, Porse Group (Mikkel Bruhn Schuster) BRIC, Porse Group, Finsen Laboratory (Ewa Ohlsson) BRIC, Porse Group, Finsen Laboratory (Johan Jendholm) Dansk Stamcelle center (Jaqueline Ameri) Department of International Health, Immunology and Microbiolog / Panum (Stephanie Geisler Crone) Finsen Center, Radiation Biology, Rigshospitalet (Karina Kristoffersen) Finsen Center, Radiation Biology, Rigshospitalet (Marie Stockhausen) Granulocyte Research lab (Stine Novrup Clemmensen) Helena Elsass Centeret (Henrik Andersen) Hæmatologsik Klinik, Rigshospitalet (Emil Hermansen) Hæmatologiks Klinik, RH (Christen Andersen) Hæmatologisk Klinik, Genomlaboratoriet, RH (Ulrik Ralfkier) Hæmatologisk Klinik, RH (Corinna Cavan Pedersen) Institut for International Sundhed, Immunologi og Mikrobiologi (Jens Peter Holst Lauritsen) Institut for International Sundhed, Immunologi og Mikrobiologi (Niels Ydum) Institut for International Sundhed, Immunologi og Mikrobiologi (Oana Ciofu) Institut for Molekylær Medicin, SDU (Henrik Ditzel) Institut for Neurovidenskab og Farmakologi, Neural Plasticitet Lab (Ander Hay-Schmidt) Institute of Molecular medicine, John Radcliffe hospital, Oxford (Gurman Kaur) ISIM, Eye Research Unit, University of Copenhagen (Tina Jehs) ISIM, PANUM (Marina von Essen/Carsten Geisler) ISIM, PANUM (Martin Kongsbak) ISIM/ University of Copenhagen (Thorbjørn Kresjgaard) ISIM/ University of Copenhagen (Tim Holm Jakobsen) JMC, Børne og Unge klinik., Bonkolab (Kjeld Schmiegelow) Klinisk Mikrobiologisk Afdeling (Helle Krogh Johansen) Laboratory of reproductive biologi, RH (Janni Jeppesen) The Hebrew University-Hadassah Medical School, Yuval-Door Lab (Miri Stolovich-Rain) The Hebrew University-Hadassah Medical School, Yuval-Door Lab (Ronny Helman) Zealand Pharma A/S (Jolanta Skarbaliene) 8

9 Next Generation Sekventering Rigshospitalet, Onkologisk Afd. Fase 1 enheden, (Ulrik Lassen) Rigshospitalet, Onkologisk Afd. Strålebiologisk lab, (Hans Skovgaard og Thomas Urup) Rigshospitalet, Onkologisk Afd. TEAM1 (BRYST) (Bent Ejlertsen) Rigshospitalet, Klinisk Genetisk Klinik, RH (Elsebeth Østergaard og Anne Marie Gerdes) Rigshospitalet, Klinisk Genetisk Klinik, Kennedy Centret (Zayneb Türner og Lusine Nazaryan) Rigshospitalet, Blodbanken (Klaus Rieneck) Rigshospitalet, Granulocyt lab. (Stine Novrup Clemmensen, Corinna C. Pedersen og Jack Cowland) Rigshospitalet, Hæmatologisk Klinik (Eva Leinøe og Lars Kjeldsen, samt Christen Lykkegaard Andersen og Kirsten Grønbæk) Rigshospitalet, Institut for Infammationsforskning (Christian Enevold) Rigshospitalet, Kardiologisk Afd. (Morten Salling Olsen) Rigshospitalet, Klinisk Mikrobiologisk Afd. (Nikolai Kirkby) Rigshospitalet, Infektionshygiejnisk Enhed (Tove Havnhøj Frandsen og Leif Percival Andersen) Rigshospitalet, HovedOrtoCentret, Øre-Næse_Hals og Audiologisk (David H. Nielsen og Christian v. Buchwald) Københavns Universitet, Faculty og Health Science, Department of International Helath, Immunology and Microbiology (Niels Ødum) Roskilde Universitets Center, Department for Science, Systems and Models (Mehmet Coskun og Jesper Troelsen) Herlev Hospital, Gastroenhedens Laboratorium (Mohammad Salem og Ole Haagen) University of Oxford, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital (Calliope Dendrou og Lars Fugger) Enheden havde forventet en nedgang i microarray undersøgelser på grund af overgang til NGS teknologi som i nogle tilfælde kan erstatte arrayundersøgelser. På trods af dette har Microarray Centeret analyseret 665 prøver, sammensat af 603 RNA ekspressions undersøgelser, og 62 copy number analyser med SNP arrays. Heraf indgår 132 arrays i diagnostiks udredning af cancerpatienter. De resterende prøver fordeler sig på ca. 40 forskningsprojekter, hvoraf vi bidrager med bioinformatisk analyse i en stor del af projekterne. 9

10 Publikationer 1. Albrechtsen R, Kveiborg M, Stautz D, Vikesa J, Noer JB, et al ADAM12 redistributes and activates MMP-14, resulting in gelatin degradation, reduced apoptosis and increased tumor growth. In Journal of cell science, pp Bentzen JG, Forman JL, Larsen EC, Pinborg A, Johannsen TH, et al Maternal menopause as a predictor of anti-mullerian hormone level and antral follicle count in daughters during reproductive age. Hum Reprod 28: Berg LB, Milman NT, Friis-Hansen L, Jensen PD, Frund T [Juvenile haemochromatosis caused by a homozygous Gly320Val mutation in the haemojuvelin gene]. Ugeskrift for laeger 175: Binderup ML, Bisgaard ML, Harbud V, Moller HU, Gimsing S, et al Von Hippel-Lindau disease (vhl). National clinical guideline for diagnosis and surveillance in Denmark. 3rd edition. Danish medical journal 60:B Bojesen SE, Pooley KA, Johnatty SE, Beesley J, Michailidou K, et al Multiple independent variants at the TERT locus are associated with telomere length and risks of breast and ovarian cancer. Nature genetics 45:371-84, 84e Borgbo T, Povlsen BB, Andersen CY, Borup R, Humaidan P, Grondahl ML Comparison of gene expression profiles in granulosa and cumulus cells after ovulation induction with either human chorionic gonadotropin or a gonadotropin-releasing hormone agonist trigger. Fertility and sterility 100: Couch FJ, Wang X, McGuffog L, Lee A, Olswold C, et al Genome-wide association study in BRCA1 mutation carriers identifies novel loci associated with breast and ovarian cancer risk. PLoS genetics 9:e Dai N, Christiansen J, Nielsen FC, Avruch J mtor complex 2 phosphorylates IMP1 cotranslationally to promote IGF2 production and the proliferation of mouse embryonic fibroblasts. Genes & development 27: Dinsen S, Baslund B, Klose M, Rasmussen AK, Friis-Hansen L, et al Why glucocorticoid withdrawal may sometimes be as dangerous as the treatment itself. European journal of internal medicine 24: Drost M, Lutzen A, van Hees S, Ferreira D, Calleja F, et al Genetic screens to identify pathogenic gene variants in the common cancer predisposition Lynch syndrome. Proceedings of the National Academy of Sciences of the United States of America 110: Gaudet MM, Kuchenbaecker KB, Vijai J, Klein RJ, Kirchhoff T, et al Identification of a BRCA2- specific modifier locus at 6p24 related to breast cancer risk. PLoS genetics 9:e

11 12. Grondahl ML, Borup R, Vikesa J, Ernst E, Andersen CY, Lykke-Hartmann K The dormant and the fully competent oocyte: comparing the transcriptome of human oocytes from primordial follicles and in metaphase II. Molecular human reproduction 19: Kopp KL, Ralfkiaer U, Gjerdrum LM, Helvad R, Pedersen IH, et al STAT5-mediated expression of oncogenic mir-155 in cutaneous T-cell lymphoma. Cell Cycle 12: Larsen MJ, Kruse TA, Tan Q, Laenkholm AV, Bak M, et al Classifications within molecular subtypes enables identification of BRCA1/BRCA2 mutation carriers by RNA tumor profiling. PloS one 8:e Machado AM, Desler C, Boggild S, Strickertsson JA, Friis-Hansen L, et al Helicobacter pylori infection affects mitochondrial function and DNA repair, thus, mediating genetic instability in gastric cells. Mechanisms of ageing and development 134: Norgaard P, Wright D, Ball S, Newell P, Kirkegaard I, et al Autocorrelation and crosscorrelation between hcgbeta and PAPP-A in repeated sampling during first trimester of pregnancy. Clinical chemistry and laboratory medicine : CCLM / FESCC 51: Ohrt-Nissen S, Dossing KB, Rossing M, Lajer C, Vikesa J, et al Characterization of mirna expression in human degenerative lumbar disks. Connective tissue research 54: Pedersen TX, Madsen M, Junker N, Christoffersen C, Vikesa J, et al Osteopontin deficiency dampens the pro-atherogenic effect of uraemia. Cardiovascular research 98: Permuth-Wey J, Lawrenson K, Shen HC, Velkova A, Tyrer JP, et al Identification and molecular characterization of a new ovarian cancer susceptibility locus at 17q Nature communications 4: Petersen SM, Dandanell M, Rasmussen LJ, Gerdes AM, Krogh LN, et al Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients. BMC medical genetics 14: Ratzer R, Sondergaard HB, Christensen JR, Bornsen L, Borup R, et al Gene expression analysis of relapsing-remitting, primary progressive and secondary progressive multiple sclerosis. Mult Scler 19: Rehfeld A, Plass M, Krogh A, Friis-Hansen L Alterations in polyadenylation and its implications for endocrine disease. Frontiers in endocrinology 4: Rieneck K, Bak M, Jonson L, Clausen FB, Krog GR, et al Next-generation sequencing: proof of concept for antenatal prediction of the fetal Kell blood group phenotype from cell-free fetal DNA in maternal plasma. Transfusion 53:

12 24. Schuster MB, Frank AK, Bagger FO, Rapin N, Vikesaa J, Porse BT Lack of the p42 form of C/EBPalpha leads to spontaneous immortalization and lineage infidelity of committed myeloid progenitors. Experimental hematology 41: e Southey MC, Park DJ, Nguyen-Dumont T, Campbell I, Thompson E, et al COMPLEXO: identifying the missing heritability of breast cancer via next generation collaboration. Breast cancer research : BCR 15: Strickertsson JA, Desler C, Martin-Bertelsen T, Machado AM, Wadstrom T, et al Enterococcus faecalis infection causes inflammation, intracellular oxphos-independent ROS production, and DNA damage in human gastric cancer cells. PloS one 8:e Versteyhe S, Klaproth B, Borup R, Palsgaard J, Jensen M, et al IGF-I, IGF-II, and Insulin Stimulate Different Gene Expression Responses through Binding to the IGF-I Receptor. Frontiers in endocrinology 4: Walker LC, Whiley PJ, Houdayer C, Hansen TV, Vega A, et al Evaluation of a 5-tier scheme proposed for classification of sequence variants using bioinformatic and splicing assay data: interreviewer variability and promotion of minimum reporting guidelines. Human mutation 34: Listen indeholder kun publikationer hvor GM medarbejdere er hoved- eller medforfattere og har ydet et væsentligt bidrag. For publikationer af brugere hvor GM blot har bidraget med teknisk assistance og apparatur henvises til de enkelte forskeres egne årsopgørelser. Ph.D.-afhandlinger 2013 Jonas Vikeså - Functional characterization of oncofetal RNA binding-imps 2013 Maria Rossing - Molecular classification of follicular thyroid cancer Internationale samarbejder Genomisk Medicin deltager i følgende internationale konsortier: The Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA) Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) COMPLEXO Society of Paediaric Oncology European Neuroblastoma Network (SIOPEN) 12

13 Vejen mod molekylær sygdomstaxonomi Tumorheterogenitet og utilstrækkelig klassifikation medfører ofte, at patienter behandles med uvirksom medicin med bivirkninger. Målrettet terapi er derfor et væsentligt udviklingsområde inden for genomsik medicin og moderne onkologi. En af de store udfordringer ved målrettet medicin er at udvælge de patienter, som måtte have gavn af nye målrettede farmaka. Behandlingsfølsomme tumorvarianter er mere udbredt end antaget, og flere forskellige mutationer i målproteinerne er følsomme for stofferne. Tendensen går derfor mod at udvide tumorundersøgelserne for mutationer til et meget større spektrum af cancere, ligesom hver tumor undersøges for mange flere typer af mutationer ultimativt for alle mutationer. I 2013 indførte Fase 1-Enheden på Rigshospitalet et personligt genomisk screeningsprogram Copenhagen Prospective Personalised Oncology (Coppo) og Genomisk Medicin fokuserer på at understøtte projektet med en omfattende molekylær karakteristik af patienternes tumorer. Projektet vil fortsætte i 2014, og blive suppleret med ny microarraybaseret brystkræftdiagnostik og tumorklassifikationer, ligesom vi vil tilbyde hurtigere og mere omfattende diagnostik af arvelige kræftformer. Tumorbiopsi Blodprøve RNA DNA DNA RNA sek. Microarray mrna NGS Exom Cancerpanel Microarray SNP NGS Exom Translokationer Mutationer CNV Klassifikation Mutationer Kopitals variationer Normale varianter Til integrativ cancer analyse anvendes en tumorbiopsi og en blodprøve fra patienten. Fra tumoren isoleres DNA og RNA og fra blodprøven isoleres DNA som anvendes til at bortfiltrere konstitutive genvarianter i tumoren. Mutations- og kopitalsvariationer aflæses fra DNA sekventering og microarray SNP analyse, mens genekspressionsprofilen og tumorspecifikke translokationer kortlægges fra RNA microarrays og RNA Seq. Samlet kan man angive hvilken tumor der er tale om og hvorvidt tumoren besidder mutationer, som er forbundet med følsomhed for et bestemt kemoterapeutikum. 13

Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse

Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse Danish Consortium for Neuromuscular Diseases Genomsekventering klinisk anvendelse Odense, 2. september, 2013 Jens Michael Hertz, MD, DMSc Professor, consultant Phone: +45 6541 3191 (dir.), or +45 2027

Læs mere

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle?

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Estrid Høgdall Regionernes Biobank Sekretariat Patologiafdelingen, Herlev Hospital Biobank har en rolle

Læs mere

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Exiqons cloud-løsning hjælper forskere med at analysere og forstå genomics og big data Hvad er genomics? Genomics er

Læs mere

Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2010

Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2010 Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2010 Formål Formålet med denne rapport er, at give borgere, relevante myndigheder, instanser og kolleger et indblik

Læs mere

Det bliver lettere at se forskel på syge og raske gener i Danmark

Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at diagnosticere genetisk betingede sygdomme i Danmark, efter at forskere har nået første milepæl i kortlægningen af

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

Godkender modtagelse af donation. Kontoansvarlig hospitalsperson. Centerdirektør. Centerdirektør Johannes Jakobsen. Johannes Jakobsen.

Godkender modtagelse af donation. Kontoansvarlig hospitalsperson. Centerdirektør. Centerdirektør Johannes Jakobsen. Johannes Jakobsen. Aktivitet, projektnavn Fellow/Scolarship program hospital/ Projektansvarlig hospitalsperson Kontoansvarlig hospitalsperson Godkender modtagelse af donation Type af aktivitet/projekt/ udstyr/enhed Tidshorisont

Læs mere

revideret udgave pr. 06-08-2015 Side 1 af 5

revideret udgave pr. 06-08-2015 Side 1 af 5 Lørdag d. 8. august 2015 min. 1 O Overordnet kl. 10.30-14.00 1 Ø Økonomi O Susanne Dalmose 1 5 2 F Fastbar Ø Tove Bach Pedersen 1 3 1 T Tappe T Karin Jespersen T1 1 4 1 R Rullebar F Lone Steen F1 R3 B2

Læs mere

Resultater for DM Duathlon 2012

Resultater for DM Duathlon 2012 DM Duathlon 2012 Age Group Results May 06, 2012 Results By Race Management Systems, Inc. Female 18 to 39 1 369 Karina Louise Sørensen Ninjas 39:51.75 1:14.73 1:09:39.99 0:55.29 19:50.78 2:11:32.54 2 417

Læs mere

Dansk Skytte Union 50m Hjemmebaneturnering 2014 - Senior

Dansk Skytte Union 50m Hjemmebaneturnering 2014 - Senior 60 liggende 5. omgang total 1. division 1 Ballerup 1 1872,6 10 9378,1 50 2 Kolding 1 1865,0 7 9277,0 31 3 DSB/ASF 1 1865,2 7 7431,0 29 4 Viborg 1 1852,7 4 9247,6 22 5 Bredstrup-Pjedsted 1 1843,9 0 9195,7

Læs mere

Opdateret startliste for Kreds-/By-stævne 30. januar 2011

Opdateret startliste for Kreds-/By-stævne 30. januar 2011 01 09:30 BANE HOLD KREDS 1 ISG 1 Jan T. Bertelsen HC 33 Ole Guldager Jensen HC 42 Henriette Mortensen DC 84 Peter Bæk HE 111 2 3 N Lakering A/S 1 Jimmy Lykke HE 96 Jens K. Poulsen HE 90 3 BE INSTALLATION

Læs mere

-Molekylærbiologiske/ gastrointestinale cancere. Histo temadag, Odense 3. november 2012. Mikkel Eld, Aalborg

-Molekylærbiologiske/ gastrointestinale cancere. Histo temadag, Odense 3. november 2012. Mikkel Eld, Aalborg -Molekylærbiologiske/ immunhistokemiske undersøgelser af gastrointestinale cancere - Screening for kolorektal cancer. Histo temadag, Odense 3. november 2012 Mikkel Eld, Aalborg Molekylærbiologiske og immunhistokemiske

Læs mere

En temperaturmåling på dansk biotek. Martin Bonde Formand for Dansk Biotek

En temperaturmåling på dansk biotek. Martin Bonde Formand for Dansk Biotek En temperaturmåling på dansk biotek Martin Bonde Formand for Dansk Biotek Agenda Introduktion En status Udfordringer mod 2020 Konklusioner Dansk Biotek organisation for danske biotekvirksomheder Startet

Læs mere

Navn Marina Rode von Essen Fødselsdag 03.06.1975 Ansættelse DMSC, Neurologisk klinik, 6311, Rigshospitalet Email marina.rode.von.essen@regionh.

Navn Marina Rode von Essen Fødselsdag 03.06.1975 Ansættelse DMSC, Neurologisk klinik, 6311, Rigshospitalet Email marina.rode.von.essen@regionh. C U R R I C U L U M V I T A E Navn Marina Rode von Essen Fødselsdag 03.06.1975 Ansættelse DMSC, Neurologisk klinik, 6311, Rigshospitalet Email marina.rode.von.essen@regionh.dk U D D A N N E L S E 2002

Læs mere

Aarhus Brandvæsen, Januar 2015. Ledelsen. Staben. Beredskabschef Lars Hviid. Afdelingsleder Per Dyrvig Forebyggende Afdeling

Aarhus Brandvæsen, Januar 2015. Ledelsen. Staben. Beredskabschef Lars Hviid. Afdelingsleder Per Dyrvig Forebyggende Afdeling Ledelsen Beredskabschef Lars Hviid Sekretariatsleder Karina Gregersen Sekretariatet Per Dyrvig Forebyggende Afdeling Lene Ø. Hansen Salg & Service Anders Rathcke Operativ Afdeling Staben Stabsmedarbejder

Læs mere

Behandling af akne i graviditeten Hedegaard, U., Larsen, J. & Damkier, P. 2008 I : Syddanske Læger. 1, s. 20 1 s.

Behandling af akne i graviditeten Hedegaard, U., Larsen, J. & Damkier, P. 2008 I : Syddanske Læger. 1, s. 20 1 s. Ulla Hedegaard Klinisk farmaceut, Ph.d.-studerende Klinisk Farmakologi Afd. for Klinisk Biokemi og Farmakologi Postaddresse: J. B. Winsløws Vej 19, 2. 5000 Odense C Danmark Postaddresse: J. B. Winsløws

Læs mere

Frederikshavn Ishockey klub

Frederikshavn Ishockey klub Navn Jeff Mølholt Lucas G. Davidsen Camilla Rasmussen Nicklas Stenbakken Patrick Guldberg Lucas Hansen Oscar Kølbæk Rosenberg Jørgen Lie Simon Asbjørn Mørk Puk Lyng Thomsen Mathias From Anders Præstegaard

Læs mere

VAGTPLAN DTH JULECUP 2014

VAGTPLAN DTH JULECUP 2014 VAGTPLAN DTH JULECUP 2014 SLIKKIOSK ( HOLBERG HALLEN) SLIKKIOSKER OG PØLSEKIOSKER JETTE SCHUBERT 8-13 Stinne Søemosegaard Helle Sigersen 13-18 Tove Madsen Tikkie Hansen 18-23 Carina Jørgensen Anja Brodthagen

Læs mere

NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON

NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON NY TEKNOLOGI TIL ANALYSE AF VORES GENER ÆNDRER MÅDEN VI FOREBYGGER OG BEHANDLER SYGDOM PÅ NYE MARKEDSMULIGHEDER FOR EXIQON De sidste 5 års store teknologiske gennembrud har gjort, at vi i dag nemt og økonomisk

Læs mere

Hvordan går det danske patienter med testis cancer?

Hvordan går det danske patienter med testis cancer? Hvordan går det danske patienter med testis cancer? Landsdækkende database for patienter med germinalcelle tumorer (GCC) Databasen dækker patienter behandlet i perioden 1984-2007 Mere end 230 variable

Læs mere

Niels Høigaard Rasmussen - CURRICULUM VITAE

Niels Høigaard Rasmussen - CURRICULUM VITAE Niels Høigaard Rasmussen - CURRICULUM VITAE Uddannelse og ansættelser Uddannelse Januar 1990 November 2001 Medicinsk embedseksamen, Københavns Universitet. Specialist i anæstesiologi. Aktuel ansættelse

Læs mere

Kl. 10.30-11.15 Anders Flarup - Kl. 17.00-19.15 Hans Jørgen Jensen - Kl. 08.00-09.30 Anders Flarup -

Kl. 10.30-11.15 Anders Flarup - Kl. 17.00-19.15 Hans Jørgen Jensen - Kl. 08.00-09.30 Anders Flarup - Arena Nord 1 Fredag Vagt 1 Vagt 2 Bemærkninger Kl. 11.00-14.00 Mette Lambertsen Trine Andersen Kl. 14.45-18.15 Hans Jørgen Jensen - Kl. 18.15-21.15 Mette Lambertsen Trine Andersen Lørdag Vagt 1 Vagt 2

Læs mere

10.28-10.37 www.plastikinstruksen.dk 1. reservelæge Pavia Lumholt På vegne af Afdeling for Plastikkirurgi og Brandsårsbehandling

10.28-10.37 www.plastikinstruksen.dk 1. reservelæge Pavia Lumholt På vegne af Afdeling for Plastikkirurgi og Brandsårsbehandling 10.10-12.00 Frie foredrag Chair: Peter A. Siemssen 10.10-10.19 En prospektivt konsekutiv sammenligning af to kendte regimer til behandling af delhudstransplantation på crus Marie von Sperling Reservelæge,

Læs mere

Dansk Pancreas Cancer Gruppe. ØVRE GASTROINTESTINAL CANCER SEMINAR Diagnostik og behandling anno 2010

Dansk Pancreas Cancer Gruppe. ØVRE GASTROINTESTINAL CANCER SEMINAR Diagnostik og behandling anno 2010 ØVRE GASTROINTESTINAL CANCER SEMINAR Diagnostik og behandling anno 2010 DPCG Styregruppe Magnus Bergenfeldt Carsten Palnæs Hansen Michael Bau Mortensen (Formand) Frank Viborg Mortensen Mogens Sall Niels

Læs mere

Alice Ilona Jensen Jobkonsulent Sygedagpengeafd. E-mail: aij@silkeborg.dk Mobil: Tlf: 89 70 47 23

Alice Ilona Jensen Jobkonsulent Sygedagpengeafd. E-mail: aij@silkeborg.dk Mobil: Tlf: 89 70 47 23 Alice Ilona Jensen Jobkonsulent E-mail: aij@silkeborg.dk 89 70 47 23 Anders Pedersen Socialrådgiver/Jobkonsulent E-mail: ape@silkeborg.dk 89 70 47 49 Anette Riis Anette Ulrik Psykolog E-mail: arn@silkeborg.dk

Læs mere

RESULTATLISTE Vejle stævne 15m 2014

RESULTATLISTE Vejle stævne 15m 2014 RESULTATLISTE Vejle stævne 15m 2014 DDS SP v.3.14.4.1 Gevær, 15m. - Mesterskab BK1 1 101491 Gustav Røjkjær 10-006 Klejs-Juelsminde Skytteforening 200/11 200/14 400/25 2 20564 Silas Højfeldt Kildehøj 10-456

Læs mere

Resultatliste - Randers åben 09 / 12-11-2011

Resultatliste - Randers åben 09 / 12-11-2011 Page 1 of 7 12-11-2011 16:32:06 - DDS SP v.3.11.11.3 RESULTATLISTE Randers åben 09 / 12-11-2011 Gevær, 15m. - Mesterskab BK1 1 25303Kirstine Bissø Svoboda 05-940 Samsø Skytteforening 200/11 200/11 400/22G

Læs mere

Diagnostiske centre i Danmark - Behovet set fra almen praksis

Diagnostiske centre i Danmark - Behovet set fra almen praksis Diagnostiske centre i Danmark - Behovet set fra almen praksis Mads Lind Ingeman & Peter Vedsted Mads Lind Ingeman Speciallæge i Almen Medicin, Ph.D.-studerende Center for Cancerdiagnostik i Praksis CaP

Læs mere

og generalforsamling 2014

og generalforsamling 2014 27. NOVEMBER 2014 DSTH efterårsmøde og generalforsamling 2014 Forskningens hus Søndre Skovvej 15 Aalborg Universitetshospital HER LIGGER FORSKNINGENS HUS HUSK Foredragskonkurrence kl. 10.00 - kl. 11.30

Læs mere

Læringsmiljø/undervisningsdiff_, jun 25. Fabrikantworkshops, jun 25 Energioptimering, jun 26. Grillarrangement, jun 24 Frokost torsdag, jun 26

Læringsmiljø/undervisningsdiff_, jun 25. Fabrikantworkshops, jun 25 Energioptimering, jun 26. Grillarrangement, jun 24 Frokost torsdag, jun 26 Aksel Lykke AARHUS TECH Allan Petersen EUC Sjælland Benny Larsen EUC Sjælland Bent-Ole Bohn TEKNIQ Bjarne Pedersen Selandia Brian Berndsen EUC Syd Brian Vestergaard EUC Sjælland Carsten Olsen Borregaard

Læs mere

FORSKNINGS- OG UNDERVISNINGSAKTIVITETER 2012 FERTILITETSKLINIKKEN, REGIONSHOSPITALET SKIVE. a) Forskningsansvarlig.

FORSKNINGS- OG UNDERVISNINGSAKTIVITETER 2012 FERTILITETSKLINIKKEN, REGIONSHOSPITALET SKIVE. a) Forskningsansvarlig. Hospitalsenhed Midt Kvalitet & Forskning Fagbiblioteket Heibergs Allé 2 Postboks 130 DK-8800 Viborg Tel. +45 7844 1350 fagbiblioteket@viborg.rm.dk FORSKNINGS- OG UNDERVISNINGSAKTIVITETER 2012 FERTILITETSKLINIKKEN,

Læs mere

Vagtplan kræmmermarked 2014

Vagtplan kræmmermarked 2014 Vagtplan kræmmermarked 2014 OPRYDNING PÅ PLADSEN SAMT GADER & VEJE OPRYDNING PÅ PLADSEN M.M FREDAG 08.00-11.30 JENS JØRN NYGÅRD OPRYDNING PÅ PLADSEN M.M FREDAG 08.00-11.30 Pauli Kiel Bent A. Jensen OPRYDNING

Læs mere

RESULTATLISTE Holstebro stævne 2014

RESULTATLISTE Holstebro stævne 2014 16-03-2014 14:43:29 - DDS SP v.3.14.2.3 RESULTATLISTE Holstebro stævne 2014 Gevær, 15m. - Mesterskab BK1 1 98883 Lars Andersen 03-010 Videbæk Skytteforening 200/09 199/09 399/18 2 108893 Mads Christensen

Læs mere

Tanker om Ph.d.-arbejdet

Tanker om Ph.d.-arbejdet Tanker om Ph.d.-arbejdet Forskerdag i Palliation 2009 Mette Asbjørn Neergaard Afdelingslæge, ph.d., speciallæge i almen medicin man@alm.au.dk Tanker om Ph.d.-arbejdet Gode råd Mixed methods design i ph.d.-forløb

Læs mere

Danmarks Jægerforbund Resultat hold 31-05-2015

Danmarks Jægerforbund Resultat hold 31-05-2015 Placering Nr Navn Foreningsnr Foreningsby Skydning Junior Hold Træf Skud Træf Skud 1 23 Vamdrup Junior 87 128 94 Kasper Hjorth 4308 Vamdrup og Omegns Jagtforening 35 42 100 Mikkel Dall 4308 28 43 96 Frederik

Læs mere

Kursusnummer 1122 Kursusnavn ERFA Gaffeltruck konferencen 2013. Leif M. Larsen, Gitte Hansen, Torben Morel. Samlet deltagerantal på kurset: 121

Kursusnummer 1122 Kursusnavn ERFA Gaffeltruck konferencen 2013. Leif M. Larsen, Gitte Hansen, Torben Morel. Samlet deltagerantal på kurset: 121 Kursusnummer 1122 Kursusnavn ERFA Gaffeltruck konferencen 2013 Afholdelsessted Hotel Faaborg Fjord Startdato 15/08-13 Slutdato 16/08-13 Mødetid Kursusleder AMUkursus Fuldt booket Leif M. Larsen, Gitte

Læs mere

Referat fra DMG repræsentantskabsmøde 01/03-2011:

Referat fra DMG repræsentantskabsmøde 01/03-2011: Referat fra DMG repræsentantskabsmøde 01/03-2011: 1. Fremvisning af online databasen ved Aleks Jovanovic og DMG FU anbefalinger Aleks viser computer skærmbilleder af online databasen, der er en kopi af

Læs mere

Knee-extension strength or leg-press power after fast-track total knee arthroplasty: Which is better related to performance-based and selfreported

Knee-extension strength or leg-press power after fast-track total knee arthroplasty: Which is better related to performance-based and selfreported Knee-extension strength or leg-press power after fast-track total knee arthroplasty: Which is better related to performance-based and selfreported function? Peter K Aalund 1, Kristian Larsen 2,3, Torben

Læs mere

Rikke Berntsen. Nørresundby. Har gennemført 17 km i tiden 1:50:50

Rikke Berntsen. Nørresundby. Har gennemført 17 km i tiden 1:50:50 Rikke Berntsen Start nr.: 1079 Nørresundby Har gennemført 17 km i tiden 1:50:50 Lars R. Kongsbak Start nr.: 1077 Frederikshavn Har gennemført 12,75 km i tiden 1:06:58 Jane Clausen FKI Start nr.: 1028 Frederikshavn

Læs mere

Publikationer. Født 1983. Uddannelse: 2009 Cand. med. Syddansk Universitet

Publikationer. Født 1983. Uddannelse: 2009 Cand. med. Syddansk Universitet Kirubakaran Balasubramaniam Ph.d.-studerende, læge Forskningsenheden for Almen Praksis J.B. Winsløws Vej 9, indgang B, 1. Sal 5000 Odense C Danmark E-mail: kiruba@health.sdu.dk Direkte telefon: 65503739

Læs mere

Svine-MRSA i RegionHovedstaden MRSA Knowledge Center Department of Clinical Microbiology Hvidovre Hospital University of Copenhagen Denmark

Svine-MRSA i RegionHovedstaden MRSA Knowledge Center Department of Clinical Microbiology Hvidovre Hospital University of Copenhagen Denmark Svine-MRSA i RegionHovedstaden MRSA Knowledge Center Department of Clinical Microbiology Hvidovre Hospital University of Copenhagen Denmark Helle Neustrup, Heidi Meiniche, Ulla Kehlet, Mette Bartels, Henrik

Læs mere

JM Single -Double 2009 31/1, 1/2, 28/2 og 1/3 2008 Bowl N Fun, Kolding

JM Single -Double 2009 31/1, 1/2, 28/2 og 1/3 2008 Bowl N Fun, Kolding JM Single -Double 2009 31/1, 1/2, 28/2 og 1/3 2008 Bowl N Fun, Kolding Dame Par Nr. Navn Klub parnr Total X / Partotal X / 1 Heidi Guldbæk BK Viborg 106 1180 28 26 2502 65 49 Trine Daugbjerg Simonsen BK

Læs mere

Viborg Amtskredsstævne i Bowling 2013. Dame C. Viborg Amtskredsstævne i Bowling 2013. Dame D

Viborg Amtskredsstævne i Bowling 2013. Dame C. Viborg Amtskredsstævne i Bowling 2013. Dame D Dame C 1 Thisted Firmasport Oticon A/S Maybritt Andersen DC 192 194 173 0 0 559 186,33 2 Sofi E-Smokers Betina Mejdal DC 156 147 195 0 0 498 166,00 3 Viborg Firmaidræt COLAS-1 / Kosme2Logen Erna Jensen

Læs mere

Epidemiologiske metoder

Epidemiologiske metoder Bacheloruddannelsen i IT og Sundhed Københavns Universitet Epidemiologiske metoder 2. semester Forårssemesteret 2014 Kursusleder Mads Kamper-Jørgensen, lektor, Afdeling for Social Medicin, Institut for

Læs mere

Ark1. * Død 5/12 1924; H. Stjernqvist indtræder. **Repræsentativ formand: Adolph Jensen (7/11 1933-31/7 1936) Side 3

Ark1. * Død 5/12 1924; H. Stjernqvist indtræder. **Repræsentativ formand: Adolph Jensen (7/11 1933-31/7 1936) Side 3 Dansk Statistisk Forenings bestyrelse gennem årene General- Formand Kasserer Sekretær Bestyrelsesmedlem BestyrelsesmedlemBestyrelsesmedlem Revisor Suppleant 1 Revisor Suppeant 2Suppl 3 forsamling 23/11

Læs mere

Oversigt over bemanding på valgstederne

Oversigt over bemanding på valgstederne Oversigt over bemanding på valgstederne Tønder 1 (V) Jørn Skov, formand 2 (V) Allan Jacobsen 3 (V) Søren T. Hansen 4 (A) Lars Rytter 5 (A) Eike Albrechtsen 6 (F) 7 (I) Elna krogager 8 (S) Marit R N Rüdiger

Læs mere

RESULTATLISTE Langå stævnet 2013

RESULTATLISTE Langå stævnet 2013 18-05-2013 17:04:30 - DDS SP v.3.13.2.1 RESULTATLISTE Langå stævnet 2013 Gevær, 50m. - Mesterskab BK1 1 101279 Benjamin Lahn Pedersen 05-101 Randers Skyttekreds 198/11 199/02 397/13 2 101277 Annemette

Læs mere

Curriculum. Publications

Curriculum. Publications Kirubakaran Balasubramaniam PhD Student Research Unit of General Practice J.B. Winsløws Vej 9, indgang B, 1. Sal 5000 Odense C Denmark E-mail: kiruba@health.sdu.dk Direct phone: 65503739 Curriculum Født

Læs mere

Det Medicinske Selskab i København. > Efterår 2010

Det Medicinske Selskab i København. > Efterår 2010 Det Medicinske Selskab i København > Efterår 2010 > Sæsonplan for efterår 2010 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 5. oktober Kl. 20.00 Alm. prakt. læge Mikkel Vass Tænk dig

Læs mere

Fælles LUU konference Torsdag den 9. oktober 2014 Hindsgavl Slot, Hindsgavl Allé 7, 5500 Middelfart

Fælles LUU konference Torsdag den 9. oktober 2014 Hindsgavl Slot, Hindsgavl Allé 7, 5500 Middelfart Fælles LUU konference Torsdag den 9. oktober 2014 Hindsgavl Slot, Hindsgavl Allé 7, 5500 Middelfart Deltagerliste AMU Fyn AMU Nordjylland AMU Vest Bornholms Erhvervsskole CELF Den jydske Haandværkerskole

Læs mere

ARVELIG TARMKRÆFT OG GENTESTNING v/ Inge Bernstein, MD, Ph.d. - HNPCC-registret, Gastroenheden, Hvidovre Hospital. Hvordan tæmmer man tarmen?

ARVELIG TARMKRÆFT OG GENTESTNING v/ Inge Bernstein, MD, Ph.d. - HNPCC-registret, Gastroenheden, Hvidovre Hospital. Hvordan tæmmer man tarmen? DEN 25. MARTS 2009 - FRA KL. 18.30 21.00 I SUNDHEDSCENTRET FOR KRÆFTRAMTE ARVELIG TARMKRÆFT OG GENTESTNING v/ Inge Bernstein, MD, Ph.d. - HNPCC-registret, Gastroenheden, Hvidovre Hospital Til den yngre

Læs mere

Deltagere i 5 km. løb

Deltagere i 5 km. løb Deltagere i km. løb 0 Jens Bønding 0 Spøttrup Balling : :: 0:0: Peter Ibsen 0 Spøttrup Balling : :: 0:: Robert Jensen 0 Spøttrup Balling : :: 0:: 09 Inge B. Pedersen 00 Skive SAM Skive : ::0 0::0 Michael

Læs mere

Single - resultat Firmaidræt Open 2014 - Aalborg Petanque 5.9.2014

Single - resultat Firmaidræt Open 2014 - Aalborg Petanque 5.9.2014 Single - resultat Firmaidræt Open 2014 - Aalborg Petanque 5.9.2014 # Navn Klub Score Spil Points 1. Britta Skalshøj Hjørring Firma Sport 4 4:1 57:28 2. Jimmi Nielsen Firmaidræt Hillerød 4 4:1 61:35 3.

Læs mere

Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING

Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING 2012 Årsrapport 2011: Second opinion ordningen og eksperimentel kræftbehandling Sundhedsstyrelsen Axel Heides Gade 1 2300 København

Læs mere

Herreklub torsdagsmatch 6. juni 2013, frit valg af teested

Herreklub torsdagsmatch 6. juni 2013, frit valg af teested Herreklub torsdagsmatch 6. juni 2013, frit valg af teested Tee 1 Rasmus Jønson 6 9 41 hvid 2 Kim Nielsen 9,3 13 38 hvid 3 Dan Christensen 12,2 14 37 gul 4 Lars Peter Mølvang 4,9 6 36 gul 5 Kurt Pedersen

Læs mere

Randers Kommune. Kan du høre mig! Ledelseskonference 2. november 2010

Randers Kommune. Kan du høre mig! Ledelseskonference 2. november 2010 Randers Kommune Kan du høre mig! Ledelseskonference 2. november 2010 Fra åbenmundede bureaukrater til primadonnaer. Årets lederkonference har temaet Kommunikation og ledelse. Temaet er valgt, fordi vi

Læs mere

Bakterier Venner eller fjender?

Bakterier Venner eller fjender? Akademiet for Talentfulde Unge 2013: Bakterier Venner eller fjender? Ole Skovgaard olesk@ruc.dk Ole Skovgaard, 2013 Bakterier: Er en ur-gammel livsform! Indeholder langt større variationer end de store

Læs mere

DANSKE MÆNDS SÆDKVALITET - EN OPDATERING

DANSKE MÆNDS SÆDKVALITET - EN OPDATERING DANSKE MÆNDS SÆDKVALITET - EN OPDATERING Niels Jørgensen Afdeling for Vækst og Reproduktion Rigshospitalet Sædkvalitet Lavere end 2-3 generationer siden I Europæiske lande Kun 25% har optimal sædkvalitet

Læs mere

NYHEDSBREV MEDICINSK FORSKNINGSAFSNIT

NYHEDSBREV MEDICINSK FORSKNINGSAFSNIT NYHEDSBREV MEDICINSK FORSKNINGSAFSNIT EFFEKTER AF D-VITAMIN PÅ NYREFUNKTION OG HJERTEKARSYSTEMET Af Læge Ph.D. Thomas Larsen November 2013 Du modtager dette nyhedsbrev, da du i perioden 2010-2012 deltog

Læs mere

Hvad gør vi nu? ENERGI & KLIMAKOMMUNIKATION 2015

Hvad gør vi nu? ENERGI & KLIMAKOMMUNIKATION 2015 Hvad gør vi nu? ENERGI & KLIMAKOMMUNIKATION 2015 Kampagnen ENERGI & KLIMAKOMMUNIKATION 2015 Formål Gøre omstillingen mere folkelig Fokus på aktive omstillere Fra 10 gode råd til konkrete projekter Fra

Læs mere

SOM DEN STORE TRUSSEL MOD LØBEBØLGEN

SOM DEN STORE TRUSSEL MOD LØBEBØLGEN LØBESKADER SOM DEN STORE TRUSSEL MOD LØBEBØLGEN KAN SKADESMÆNGDEN REDUCERES? THE FOOT PRONATION GUY... RASMUS ØSTERGAARD NIELSEN Fysioterapeut, Sundhedsfaglig kandidat, Ph.D. Post Doc på Aarhus Universitet

Læs mere

Sponsorflyvning 2009

Sponsorflyvning 2009 Sponsorflyvning 2009 Duenummer Erstatning Firma Plac Præmie Privat Plac Præmie Duemand Plac Præmie Hastighed 068-09-0008 Ole Nielsen 1 5000 Arne Poulsen 1 5000 1.505,70 196-09-9050 196-09-9060 Nordjysk

Læs mere

Resultat fra Træningsløb i Skærbæk

Resultat fra Træningsløb i Skærbæk Piger 6 år og under (kørte i heat med Expert 6 år og under) Mathilde Holmgaard Køge 1 6 4 5 Piger 8 år og under (kørte i heat med Piger 10 år) Mille Larsen Kalundborg 1 1 1 1 Laura Schack Tønder 2 5 4

Læs mere

Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2013

Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2013 Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2013 Formål Formålet med denne rapport er, at give borgere, relevante myndigheder, instanser og kolleger et indblik

Læs mere

Oversigt over beneficerede advokater

Oversigt over beneficerede advokater A Anberg, Rasmus Bredgade 58, 1. 1260 København K adv.anberg@tdcadsl.dk Tlf.: 33 12 18 43 Fax: 33 14 18 98 Andersen, M. Elkiær Kronprinsessegade 26, 1. sal 1306 København K mea@brammer-advokater.dk Tlf.:

Læs mere

resultater2007.xls 19-12-201317:27:35

resultater2007.xls 19-12-201317:27:35 Grunddata Starttidspunkt gruppe 1 14:00 Starttidspunkt gruppe 2 14:00 Starttidspunkt gruppe 3 14:00 Starttidspunkt gruppe 4 14:00 Starttidspunkt gruppe 5 14:00 Starttidspunkt gruppe 6 14:00 Starttidspunkt

Læs mere

SKUP i Danmark. Esther.jensen@OUH.regionsyddanmark.dk. www.skup.dk. Dansk Folkeferie, Middelfart 5. sept 2008

SKUP i Danmark. Esther.jensen@OUH.regionsyddanmark.dk. www.skup.dk. Dansk Folkeferie, Middelfart 5. sept 2008 1 SKUP i Danmark Esther.jensen@OUH.regionsyddanmark.dk www.skup.dk Dansk Folkeferie, Middelfart 5. sept 2008 2 SKandinavisk Utprøvning af laboratorieudstyr for Primærsektoren 3 Analysekvalitet i almen

Læs mere

Vvs-branchens Faglæreruddannelse

Vvs-branchens Faglæreruddannelse Grillarrangement Starttidspunkt tirsdag 23-06-2015 00:00 Sluttidspunkt tirsdag 23-06-2015 00:00 Aksel Lykke Mathies Baunsgård Ulrik Vestergaard Kim Fusager Peter Henriksen Flemming Thane Kallehave James

Læs mere

CENTER FOR KLINISKE RETNINGSLINJER CLEARINGHOUSE

CENTER FOR KLINISKE RETNINGSLINJER CLEARINGHOUSE Kursus for bedømmere af kliniske retningslinjer ECTS: Kurset er postgraduat og ækvivalerer 5 ECTS point ved bestået eksamen. Der udstedes eksamensbevis. Formål: Kurset giver kompetence til at fungere som

Læs mere

Appendix 2.g contains a copy of the carrier to the European Health Insurance Card.

Appendix 2.g contains a copy of the carrier to the European Health Insurance Card. Guidelines for tenderer Appendix 2.g contains a copy of the carrier to the European Health Insurance Card. The tenderer is not supposed to fill in or complete this appendix. The appendix, in its entirety,

Læs mere

Medicinske komplikationer efter hofte- og knæalloplastik (THA and KA) med fokus på trombosekomplikationer. Alma B. Pedersen

Medicinske komplikationer efter hofte- og knæalloplastik (THA and KA) med fokus på trombosekomplikationer. Alma B. Pedersen Medicinske komplikationer efter hofte- og knæalloplastik (THA and KA) med fokus på trombosekomplikationer Alma B. Pedersen Outline Introduction to epidemiology of THA and KA Epidemiology of medical complications:

Læs mere

Epidemiologiske metoder

Epidemiologiske metoder Bacheloruddannelsen i IT og Sundhed Københavns Universitet Epidemiologiske metoder 2. semester Forårssemesteret 2014 Kursusleder Mads Kamper-Jørgensen, lektor, Afdeling for Social Medicin, Institut for

Læs mere

Det Medicinske Selskab i København. > Efterår 2014

Det Medicinske Selskab i København. > Efterår 2014 Det Medicinske Selskab i København > Efterår 2014 > Sæsonprogram for efterår 2014 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 23. september kl. 20.00: Tirsdag den 7. oktober kl. 20.00:

Læs mere

Endelig er siden 1999 sket en registrering af familier med arvelig bryst-æggestokkræft, pr. 1-1-2011 i alt ca. 6.000 familier.

Endelig er siden 1999 sket en registrering af familier med arvelig bryst-æggestokkræft, pr. 1-1-2011 i alt ca. 6.000 familier. 1 DBCG 1.1 Indledning DBCG (Danish Breast Cancer Cooperative Group) er en tværfaglig landsdækkende organisation, som blev etableret i 1977 på initiativ af Dansk Kirurgisk Selskab. Formålet var på landsplan

Læs mere

Undersøgelse af arvelige faktorer ved autisme

Undersøgelse af arvelige faktorer ved autisme Undersøgelse af arvelige faktorer ved autisme Nyhedsbrev nr. 3, februar 2006 Introduktion Det er med glæde, at vi her kan præsentere vores tredje nyhedsbrev til alle familierne, som deltager i projektet

Læs mere

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview

Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview Adult ADHD Self-Report Scale-V1.1 (ASRS-V1.1) Symptoms Checklist from WHO Composite International Diagnostic Interview World Health Organization 2010 All rights reserved. Based on the Composite International

Læs mere

FSOS Konference 2014. Viden til praksis tur/retur. 18.- 19. marts Trinity, Fredericia. Fagligt Selskab for Ortopædkirurgiske Sygeplejersker (FSOS)

FSOS Konference 2014. Viden til praksis tur/retur. 18.- 19. marts Trinity, Fredericia. Fagligt Selskab for Ortopædkirurgiske Sygeplejersker (FSOS) FSOS Konference 2014 18.- 19. marts Trinity, Fredericia Viden til praksis tur/retur Fagligt Selskab for Ortopædkirurgiske Sygeplejersker (FSOS) PROGRAM TIRSDAG 18. MARTS 08.30 Registrering og udstillerbesøg

Læs mere

Bestyrelse: Formand: Jesper Hjortdal Aarhus Universitetshospital jesper.hjortdal@dadlnet.dk

Bestyrelse: Formand: Jesper Hjortdal Aarhus Universitetshospital jesper.hjortdal@dadlnet.dk Bestyrelse: Formand: Aarhus Universitetshospital jesper.hjortdal@dadlnet.dk Næstformand: Ditte Erngaard Næstved Sygehus der@regionsjaelland.dk Videnskabelig Sekretær: Anders Kruse Aalborg Universitetshospital

Læs mere

Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn

Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn Ovl. Hans Mørch Jensen Prof. L. V. Kessing. Prof. Ø. Lidegaard Prof. P. K. Andersen PhD, MD, L. H. Pedersen Biostatistiker Randi Grøn Disposition: Flere fødselskomplikationer hos kvinder der har anvendt

Læs mere

Triton Aalborgs Åbne Senior A & B-række turnering

Triton Aalborgs Åbne Senior A & B-række turnering Triton Aalborgs Åbne Senior A & B-række turnering Dato: Søndag den 27. januar 2013 Kl. 09.00 Sted: Triton Aalborg,, Stjernevej 5, 9200 Aalborg SV. Kategorier: Der spilles i alle kategorier i A rækken og

Læs mere

Kvalitetssikring af stamceller på Rigshospitalet

Kvalitetssikring af stamceller på Rigshospitalet Kvalitetssikring af stamceller på Rigshospitalet Annette Ekblond, cand.scient ph.d (humanbiolog) Laboratorieleder Kardiologisk Stamcellelaboratorium Kardiologisk Stamcellecenter Hjertecenteret Rigshospitalet

Læs mere

Ordinær Generalforsamling 2. april, 2008

Ordinær Generalforsamling 2. april, 2008 April 2, 2008 1 April 2, 2008 Ordinær Generalforsamling 2. april, 2008 April 2, 2008 2 April 2, 2008 Dagsorden Bestyrelsens beretning om Selskabets virksomhed i det forløbne år Fremlæggelse af den reviderede

Læs mere

Den udvidede profylakse mod rhesus D-immunisering af gravide i Danmark

Den udvidede profylakse mod rhesus D-immunisering af gravide i Danmark Den udvidede profylakse mod rhesus D-immunisering af gravide i Danmark Af Merete Berthu Damkjær, Anette Perslev og Finn Stener Jørgensen Biografi Merete Berthu Damkjær er cand.med. fra Københavns Universitet

Læs mere

Coalitions and policy coordination

Coalitions and policy coordination Coalitions and policy coordination This page intentionally left blank Mikkel Mailand Coalitions and policy coordination Revision and impact of the European Employment Strategy DJØF Publishing Copenhagen

Læs mere

RESULTATLISTE FOR FINALEN - SENIOR

RESULTATLISTE FOR FINALEN - SENIOR RESULTATLISTE FOR FINALEN - SENIOR Skyttens Navn Bane 1. 2. 3. 4. 5. mel / 1 6. 7. 8. mel /2 9. 1. slut e 1. e 2. e 3. e 4 Kim Jensen 12 12,3 Susanne poulsen 96,9 96,9 Stig Bjerregård 95,6 95,6 Peter skov

Læs mere

Klar tale med patienterne

Klar tale med patienterne Klar tale med patienterne Hvad skal der til for at optimere kommunikationen og patienternes udbytte? Årsmøde for Gastroenterologiske sygeplejersker. Kolding den 21. november 2014 Jette Ammentorp Professor,

Læs mere

Sektion for Mikrobiologi & Center for Geomikrobiologi

Sektion for Mikrobiologi & Center for Geomikrobiologi Sektion for Mikrobiologi & Center for Geomikrobiologi Ca. 60 personer, 60% internationale, i bygning 1540 + 1535, 1.sal Hans Røy Rikke Meyer (inano) Niels Peter Revsbech Kai Finster Kjeld Ingvorsen Kasper

Læs mere

Klinisk farmakologisk afdeling

Klinisk farmakologisk afdeling Klinisk farmakologisk afdeling Bispebjerg Hospital 2010/11 Ledende overlæge, ph.d. Hanne R Christensen Organisering 1 afdeling i Region Hovedstaden på to matrikler BBH og RH 1 leder og 1 afsnitsledelse

Læs mere

Senfølger efter kræftbehandling. Mikael Rørth Onkologisk Klinik Rigshospitalet

Senfølger efter kræftbehandling. Mikael Rørth Onkologisk Klinik Rigshospitalet Senfølger efter kræftbehandling Mikael Rørth Onkologisk Klinik Rigshospitalet Mål for kræftbehandling Bedre overlevelse, sygdomsfrihed Mindske symptomer Bedre livskvalitet Mange behandlinger ikke gode

Læs mere

Styring af infektionshygiejne i sundhedssektoren Del 5: Krav til perioperativ infektionsprofylakse

Styring af infektionshygiejne i sundhedssektoren Del 5: Krav til perioperativ infektionsprofylakse Dansk Standard DS 2451-5 1. udgave 2001-08-21 Styring af infektionshygiejne i sundhedssektoren Del 5: Krav til perioperativ infektionsprofylakse Infection control in the health care sector Part 5: Requirements

Læs mere

CENTER FOR KLINISKE RETNINGSLINJER - CLEARINGHOUSE

CENTER FOR KLINISKE RETNINGSLINJER - CLEARINGHOUSE Bilag 7: Resume Titel: Klinisk retningslinje for perioperativ desinfektion af øje og øjenomgivelser til patienter til øjenoperation Forfattergruppe: Birgith Jakobsen, Udviklings- og uddannelsesansvarlig

Læs mere

Fynsk Sprint Cup - 1 etape 26-05-2012, Faaborg By, Fa Allerød OK. H-55 14:57 86801 L Gert Nielsen

Fynsk Sprint Cup - 1 etape 26-05-2012, Faaborg By, Fa Allerød OK. H-55 14:57 86801 L Gert Nielsen Allerød OK H-55 14:57 86801 L Gert Nielsen Ballerup OK H-21 14:16 443885 Lars Bukkehave D-50 14:29 151495 Annette Bonde D-55 14:33 139370 Johanne Lind D-35 14:37 86804 L Mette Rich H-45 14:47 86799 L Jakob

Læs mere

VISION 2020. Vision, mission og strategi for Nordsjællands Hospital 2020

VISION 2020. Vision, mission og strategi for Nordsjællands Hospital 2020 Vision, mission og strategi for Nordsjællands Hospital 2020 Introduktion Med etablering af Nordsjællands Hospital i 2013 har vi samlet den sundhedsfaglige ekspertise i Nordsjælland for at sikre den bedst

Læs mere

NYE FUNKTIONSMAILADRESSER

NYE FUNKTIONSMAILADRESSER NYE FUNKTIONSMAILADRESSER FEBRUAR 2012 Listen opdateres løbende i takt med at flere adresser oprettes. Funktion Hovedområde Funktionsmailadresse arts@au.dk scitech@au.dk health@au.dk bss@au.dk Uniled Rektor

Læs mere

DRENGE Version : 10. April 2014 U6 DRENGE (2009) U7 DRENGE (2008) Træner Jacob Søe Lundgaard Gøgeurtvej 22 25 58 70 25 Lundgaard14@gmail.

DRENGE Version : 10. April 2014 U6 DRENGE (2009) U7 DRENGE (2008) Træner Jacob Søe Lundgaard Gøgeurtvej 22 25 58 70 25 Lundgaard14@gmail. DRENGE Version : 10. April 2014 U6 DRENGE (2009) U7 DRENGE (2008) Træner Jacob Søe Lundgaard Gøgeurtvej 22 25 58 70 25 Lundgaard14@gmail.com U8 DRENGE (2007) Træner Anders Jørgensen Store Tingbakke 109

Læs mere

Stine Lundstøm Kamionka Cand. Merc. International Management. Indvandrermedicinsk Klinik/ Center for global sundhed, Syddansk Universitet

Stine Lundstøm Kamionka Cand. Merc. International Management. Indvandrermedicinsk Klinik/ Center for global sundhed, Syddansk Universitet Hvordan kan man organisere sundhedstjenesten så den bedre kan tilpasses til flygtninges meget sammensatte behov for støtte og vejledning i samarbejde mellem flere specialer. Stine Lundstøm Kamionka Cand.

Læs mere

Slangerup Badmintonklub. 1-2 Kamp 109 Kl. 13:10

Slangerup Badmintonklub. 1-2 Kamp 109 Kl. 13:10 !" #$ %&'"( ) Herredouble Forælder/Barn Pulje 1 1 Wictor Gadsted Steen Gadsted 2 Oliver Rohde Nielsen Annette Rohde Larsen 1-2 Kamp 109 Kl. 13:10 Herresingle U9 + U11 Pulje 1 1 Wictor Gadsted 2 Hans Jacob

Læs mere

Min krop VIDENSARK: Alderens store betydning for fertilitet. > Se video

Min krop VIDENSARK: Alderens store betydning for fertilitet. > Se video VIDENSARK: Min krop At få børn er for mange et helt naturligt skridt på et tidspunkt i deres liv. Nogle mener endda, at det er meningen med livet. Men der er forskellige faktorer, der afgør, om et par

Læs mere

HNPCC. Arvelig tarmkræft. Hvidovre Hospital HNPCC-registret. Afsnit 435 H

HNPCC. Arvelig tarmkræft. Hvidovre Hospital HNPCC-registret. Afsnit 435 H HNPCC Arvelig tarmkræft Hvidovre Hospital HNPCC-registret. Afsnit 435 H HNPCC Arvelig tarmkræft Udarbejdet af Overlæge Inge Bernstein og afdelingslæge Susanne Timshel, HNPCC-registret Landsdækkende register

Læs mere