AGCGGCCTCCTTACCCAACTTCAG GTACCAATGGGGATCCCAGTGGG GAAGTCGATGTTGGTGCTTCTCA

Størrelse: px
Starte visningen fra side:

Download "AGCGGCCTCCTTACCCAACTTCAG GTACCAATGGGGATCCCAGTGGG GAAGTCGATGTTGGTGCTTCTCA"

Transkript

1 GCAAACTGGACATTAGCTTCTC CTGTGAGAACCTTCCAGCCTTTTC CTGTCTTCATCCTCTTCCAGCCCT C AGCGGCCTCCTTACCCAACTTCAG GTACCAATGGGGATCCCAGTGGG GAAGTCGATGTTGGTGCTTCTCA G TCTCTTTGGCCTTCGCCTTGTGCT GCATCGCTGCTTACGGCCCCGGAC GAGACTCTGTGCGGAGGGGAGC TGTTGACACGCTTCAGTTTGTCTGTTCG Genomisk Medicin GACCGCGGCTTCTACTTCAGCAG GCCTTCAAGCCGTGCCAA Årsberetning 2013 CGTCGCAGCCGTGGCATCGTGGAA GAGTGCTGCTTCCGCAGCTGCGAC CTGGCCCTCCTGGAGACATACC GTGCCACCCCCGCCAAGTCCGAG GAGGGACGTGTCTACCTCTCAGGCA CGTACTTCCGGACGACTTCCCCAG ATACCCCGTGGGCAAGTTCTTC CAATATGACACCTGGAGACAGTCT CGCGGGACGCCTGCGCAGAGGCCTGG CCTGCCCTCCTGCGTGCCCGC G CGGGGTCGCATGCTTGCCAAAGAGCT CAAAGAGTTCAGAGAGGCCAAAA GTCATCGTCCCCTGATCGTGTTACT CACCCAAAGACCCCGCCCACGGGGG C GAGCCTCTTCGGAGATGTCCAG CAACCATCAGTGAATCAAATTAT GTGGTAATTCTGCAATGTAGTAC 1

2 Genomisk Medicin Årsberetning 2013 Rigshospitalet September

3 Genomisk Medicin udspringer af forskningen i genomets sekvens og struktur og henfører til genomiske undersøgelser til diagnostik og behandling. Området baserer sig på teknologier som microarray (eng.) og Next Generation Sequencing (eng.) (NGS), der tillader transskriptom- og sekvensanalyse af genomet. Undersøgelserne betyder at man i fremtiden får mulighed for at etablere en molekylær sygdomstaxonomi, som er forudsætningen for mere præcise og virksomme behandlinger. Både internationalt og nationalt etableres enheder for Genomisk Medicin i relation til patientbehandlingen. Et af de områder, hvor Genomisk Medicin hurtigt har fundet en naturlig plads er onkologien, hvor genomundersøgelser skaber basis for skræddersyet behandling. Genomisk Medicin på Rigshospitalet er organisatorisk sammensat af en forskningsinfrastruktur samt et afsnit for genombaseret diagnostik. Enheden beskæftigede i medarbejdere og producerede ~3400 patientundersøgelser. Årsberetningen sammenfatter enhedens aktiviteter og produktion i Med venlig hilsen Finn Cilius Nielsen Enhed for Genomisk Medicin har til huse i Rigshospitalets mellembygning over hovedindgangen 3

4 Personale Professor overlæge Finn Cilius Nielsen (leder af GM) Ledende biokemiker Thomas v. O. Hansen Afdelingsbioanalytiker Martin Skygge Biokemiker Lars Jønson Bioinformatiker Rehannah Borup Afdelingslæge Lennart Friis-Hansen (ophørt december 2013) Biokemiker Jonas Vikeså Videnskabelig medarbejder/cand. Scient. Lise Barlebo Ahlborn Videnskabelig medarbejder Ane Steffensen Sekretær Leila Majdanac Sektion for molekylær cancerdiagnostik Bioanalytiker Lis Qvist Krüger Bioanalytiker Bettina Marsot Andersen Bioanalytiker Vibeke Trandbohus Bioanalytiker Vibeke Blåbjerg Bioanalytiker Shehrukh Jamil Bioanalytiker Aseeba Ayub Bioanalytiker Dorte Pedersen (ophørt maj 2013) Bioanalytiker Berit Bak Jensen Bioanalytiker Søren Petersen Bioanalytiker Julie Fisker Nielsen Bioanalytiker Majken Simonsen Bioanalytiker Charlotte Lerbech Jensen Sekretær Lene Sørensen Sekretær Louise Dreijer ENHED FOR GENOMISK MEDICIN FORSKNINGSINFRASTRUKTUR Molekylærbiologi MOLEKYLÆR DIAGNOSTIK Hereditær Cancer Microarray Integrative Genomics Endokrinologi NGS Hæmatologi Konfocal Mikroskopi Mikrobiologi GM struktur 4

5 Forskningsinfrastrukturen Bioanalytiker Ewa Futoma Bioanalytiker Stine Østergaard Bioanalytiker Cecilia Håkansson Bioanalytiker Elisabeth Schiefloe Bioanalytiker Susanne Smed Studentermedarbejder Lars Yannik Schøning Studentermedarbejder Damir Sasivarevic Fondslønnede 2013 Post Doc Matthew Marklund (NEYE) Cecilie Nandrup-Bus Kristina Døssing? Studerende Stud. Cand. Scient. Lise Barlebo Ahlborn (fastansat pr. 1/ ) Stud.med. Anders Rehfeld PhD-studerende Ane Yde Steffensen Forskere fra kliniske afdelinger Emilie Nyberg Garnæs, læge (Øre-næse-halskirurgisk og Audiologisk) Søren Bache, læge (Neuroanæstesiologisk Klinik) Igor Ralets (Klinisk Neurofysiologisk Klinik) Majken Sønderholm (CHIP) Maria Rossing, læge (KBA) David H. Jensen, læge (Øre-næse-halskirurgisk og Audiologisk) *Se desuden listen over brugere af NGS og Microarray-sektionerne. Budget Budget Personale Drift Andre indtægter NGS og microarray core- funktion Eksterne donationer Løbende bevillinger Mio. Dkr

6 Patientdiagnostik Genomisk Medicin producerede i analyser fordelt på 96 forskellige genundersøgelser. Den største produktion ligger inden for arvelig bryst og kolorektal cancer, hvor man øgede produktionen med henholdsvis 50% og 100%. Næsten alle undersøgelser foretages nu med NGS teknologi, hvilket har givet en mere rationel drift og mulighed for undersøgelse af flere gener end tidligere. Patientanalyser CMVRES HAMP NYRECAN AIP HFE ORTOGEN AIPD HFE2 P53 APC HFE2D P53D APCD HNPCC PKLR ATP8B1 HNPCCD PMS2 BMPR1A HRPT2 PMS2D BRAF HRPT2D PRSS1 BRCA HYPTHYR PTCH1 BRCA1 HÆMOKRO PTEN BRCA1D IL28B PTEND BRCA2D MCM6 RAD51C BRCAD MELANOD RAD51CD BRYST MELANOM RET BTNL2 MEN1 RETD CARD15 MEN1D SDH CASR MET SDH- D CDH1 MLH1 SDHB CDH1D MLH1D SDHC CDK4 MSH2 SDHD CDKN1B MSH2D SLC40A1 CDKN2A MSH6 SMAD4 CDKN2AD MSH6D STK11 DICER1D MSI STK11D FASE1 MUTYH TFR2 FGF23 MUTYHD THROMB FH- GEN NEUROBB VHL FH- GEND NEUROBL VHLD FLCN NEUROBM WT1 FLCND NEUROBV RNAEWING FÆOKROM NR3C1 RNASYNO GIST NR3C1D RNATRANS Teknologi Next-generation sequencing (NGS) på HighSeq2500 (Illumina) og Miseq (Illumina) DNA Sanger sekventering og MLPA analyse på Applied Biosystems Genetic Analyzer 3730 SNP analyse på Applied Biosystems ViiA7 system SNP array og mrna ekspressions array på Affymetrix microarray platform. Software Data analyseres i programmer som R, CLC workbench (CLC BIO), Ingenuity (Qiagen), Sequence pilot (JSI medical systems), Seqscape (Applied Biosystems), GeneMarker (Softgenetics), Alamut (Interactive Biosoftware), Qlucore (Qlucore), og Partek Genomics suite (Partek). 6

7 Akkreditering og Kvalitetssikring Akkreditering Enheden for Genomisk Medicin er siden 2012 DANAK akkrediteret efter ISO I 2013 var der tilsynsbesøg, hvor DANAK igen godkendte afdelingens standart. Følgende analyser er pt. DANAK akkrediteret: Brystgenpakke (BRCA1/BRCA2/CDH1/PTEN/RAD51C/TP53) Tarmkræft genpakke (MLH1/MSH2/MSH6/PMS2) HFE (hæmokromatose) BRAF GIST (c-kit/pdgfra) KRAS MSI Global CNV analyse (DNA_CytoScan) Kvalitetssikring Afdelingen afholder månedlige kvalitetssikringsmøder, hvor afvigelser, eksterne kontrolprogrammer og laboratoriesammenligninger, samt leverandørvurderinger behandles. Genomisk Medicin har i 2013 deltaget i følgende kontrolprogrammer: EMQN: BRCA, HNPCC, FAP, MEN2, VHL, HFE, EGFR, Microarray_aCGH, DNA Sanger sekventering UKNEQAS: BRAF, GIST (C-Kit/PDGFRA), MSI og NGS_Pilot RFB: KRAS EQUALIS: HFE, MCM6 (laktose intolerans) Derudover har Enheden for Genomsik Medicin deltaget i følgende laboratoriesammenligninger: AIP, TP53 og PTEN Både laboratoriesammenligninger og eksterne kontroludsendelser er forløbet tilfredsstillende i Afvigerapporter, korrigerede og forebyggende handlinger Der har været 14 afvigelser i De fleste sager var forbundet med NGS på Roche platform og MLPA.Alle afvigelser er gennemgået og afsluttet i kvalitetsudvalget. Fem afvigelser omhandlende Roche NGS technologi og prøveombytning blev desuden indberettet som utilsigtede hændelser. Dette har medført at Enheden har ændret DNA oprensnings procedure (DNA oprensningsrobot), og er overgået til Illumina NGS teknologi. 7

8 Brugere af microarray og NGS enhederne Microarray Biologisk Institut, Microbiology (Leise Riber) Bonkolab, RH (Mette Levinsen) BRIC, Engelholm Group (Lars Henning Engelholm) BRIC, Frødin Group (Morten Frødin) BRIC, Helin Group (Kasper Dindler Rasmussen) BRIC, Helin Group (Patrycja Sroczynska) BRIC, Issazadeh-Navikas Group (Yawei Liu) BRIC, Porse Group (Elisabeth Søndergaard) BRIC, Porse Group (Mikkel Bruhn Schuster) BRIC, Porse Group, Finsen Laboratory (Ewa Ohlsson) BRIC, Porse Group, Finsen Laboratory (Johan Jendholm) Dansk Stamcelle center (Jaqueline Ameri) Department of International Health, Immunology and Microbiolog / Panum (Stephanie Geisler Crone) Finsen Center, Radiation Biology, Rigshospitalet (Karina Kristoffersen) Finsen Center, Radiation Biology, Rigshospitalet (Marie Stockhausen) Granulocyte Research lab (Stine Novrup Clemmensen) Helena Elsass Centeret (Henrik Andersen) Hæmatologsik Klinik, Rigshospitalet (Emil Hermansen) Hæmatologiks Klinik, RH (Christen Andersen) Hæmatologisk Klinik, Genomlaboratoriet, RH (Ulrik Ralfkier) Hæmatologisk Klinik, RH (Corinna Cavan Pedersen) Institut for International Sundhed, Immunologi og Mikrobiologi (Jens Peter Holst Lauritsen) Institut for International Sundhed, Immunologi og Mikrobiologi (Niels Ydum) Institut for International Sundhed, Immunologi og Mikrobiologi (Oana Ciofu) Institut for Molekylær Medicin, SDU (Henrik Ditzel) Institut for Neurovidenskab og Farmakologi, Neural Plasticitet Lab (Ander Hay-Schmidt) Institute of Molecular medicine, John Radcliffe hospital, Oxford (Gurman Kaur) ISIM, Eye Research Unit, University of Copenhagen (Tina Jehs) ISIM, PANUM (Marina von Essen/Carsten Geisler) ISIM, PANUM (Martin Kongsbak) ISIM/ University of Copenhagen (Thorbjørn Kresjgaard) ISIM/ University of Copenhagen (Tim Holm Jakobsen) JMC, Børne og Unge klinik., Bonkolab (Kjeld Schmiegelow) Klinisk Mikrobiologisk Afdeling (Helle Krogh Johansen) Laboratory of reproductive biologi, RH (Janni Jeppesen) The Hebrew University-Hadassah Medical School, Yuval-Door Lab (Miri Stolovich-Rain) The Hebrew University-Hadassah Medical School, Yuval-Door Lab (Ronny Helman) Zealand Pharma A/S (Jolanta Skarbaliene) 8

9 Next Generation Sekventering Rigshospitalet, Onkologisk Afd. Fase 1 enheden, (Ulrik Lassen) Rigshospitalet, Onkologisk Afd. Strålebiologisk lab, (Hans Skovgaard og Thomas Urup) Rigshospitalet, Onkologisk Afd. TEAM1 (BRYST) (Bent Ejlertsen) Rigshospitalet, Klinisk Genetisk Klinik, RH (Elsebeth Østergaard og Anne Marie Gerdes) Rigshospitalet, Klinisk Genetisk Klinik, Kennedy Centret (Zayneb Türner og Lusine Nazaryan) Rigshospitalet, Blodbanken (Klaus Rieneck) Rigshospitalet, Granulocyt lab. (Stine Novrup Clemmensen, Corinna C. Pedersen og Jack Cowland) Rigshospitalet, Hæmatologisk Klinik (Eva Leinøe og Lars Kjeldsen, samt Christen Lykkegaard Andersen og Kirsten Grønbæk) Rigshospitalet, Institut for Infammationsforskning (Christian Enevold) Rigshospitalet, Kardiologisk Afd. (Morten Salling Olsen) Rigshospitalet, Klinisk Mikrobiologisk Afd. (Nikolai Kirkby) Rigshospitalet, Infektionshygiejnisk Enhed (Tove Havnhøj Frandsen og Leif Percival Andersen) Rigshospitalet, HovedOrtoCentret, Øre-Næse_Hals og Audiologisk (David H. Nielsen og Christian v. Buchwald) Københavns Universitet, Faculty og Health Science, Department of International Helath, Immunology and Microbiology (Niels Ødum) Roskilde Universitets Center, Department for Science, Systems and Models (Mehmet Coskun og Jesper Troelsen) Herlev Hospital, Gastroenhedens Laboratorium (Mohammad Salem og Ole Haagen) University of Oxford, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital (Calliope Dendrou og Lars Fugger) Enheden havde forventet en nedgang i microarray undersøgelser på grund af overgang til NGS teknologi som i nogle tilfælde kan erstatte arrayundersøgelser. På trods af dette har Microarray Centeret analyseret 665 prøver, sammensat af 603 RNA ekspressions undersøgelser, og 62 copy number analyser med SNP arrays. Heraf indgår 132 arrays i diagnostiks udredning af cancerpatienter. De resterende prøver fordeler sig på ca. 40 forskningsprojekter, hvoraf vi bidrager med bioinformatisk analyse i en stor del af projekterne. 9

10 Publikationer 1. Albrechtsen R, Kveiborg M, Stautz D, Vikesa J, Noer JB, et al ADAM12 redistributes and activates MMP-14, resulting in gelatin degradation, reduced apoptosis and increased tumor growth. In Journal of cell science, pp Bentzen JG, Forman JL, Larsen EC, Pinborg A, Johannsen TH, et al Maternal menopause as a predictor of anti-mullerian hormone level and antral follicle count in daughters during reproductive age. Hum Reprod 28: Berg LB, Milman NT, Friis-Hansen L, Jensen PD, Frund T [Juvenile haemochromatosis caused by a homozygous Gly320Val mutation in the haemojuvelin gene]. Ugeskrift for laeger 175: Binderup ML, Bisgaard ML, Harbud V, Moller HU, Gimsing S, et al Von Hippel-Lindau disease (vhl). National clinical guideline for diagnosis and surveillance in Denmark. 3rd edition. Danish medical journal 60:B Bojesen SE, Pooley KA, Johnatty SE, Beesley J, Michailidou K, et al Multiple independent variants at the TERT locus are associated with telomere length and risks of breast and ovarian cancer. Nature genetics 45:371-84, 84e Borgbo T, Povlsen BB, Andersen CY, Borup R, Humaidan P, Grondahl ML Comparison of gene expression profiles in granulosa and cumulus cells after ovulation induction with either human chorionic gonadotropin or a gonadotropin-releasing hormone agonist trigger. Fertility and sterility 100: Couch FJ, Wang X, McGuffog L, Lee A, Olswold C, et al Genome-wide association study in BRCA1 mutation carriers identifies novel loci associated with breast and ovarian cancer risk. PLoS genetics 9:e Dai N, Christiansen J, Nielsen FC, Avruch J mtor complex 2 phosphorylates IMP1 cotranslationally to promote IGF2 production and the proliferation of mouse embryonic fibroblasts. Genes & development 27: Dinsen S, Baslund B, Klose M, Rasmussen AK, Friis-Hansen L, et al Why glucocorticoid withdrawal may sometimes be as dangerous as the treatment itself. European journal of internal medicine 24: Drost M, Lutzen A, van Hees S, Ferreira D, Calleja F, et al Genetic screens to identify pathogenic gene variants in the common cancer predisposition Lynch syndrome. Proceedings of the National Academy of Sciences of the United States of America 110: Gaudet MM, Kuchenbaecker KB, Vijai J, Klein RJ, Kirchhoff T, et al Identification of a BRCA2- specific modifier locus at 6p24 related to breast cancer risk. PLoS genetics 9:e

11 12. Grondahl ML, Borup R, Vikesa J, Ernst E, Andersen CY, Lykke-Hartmann K The dormant and the fully competent oocyte: comparing the transcriptome of human oocytes from primordial follicles and in metaphase II. Molecular human reproduction 19: Kopp KL, Ralfkiaer U, Gjerdrum LM, Helvad R, Pedersen IH, et al STAT5-mediated expression of oncogenic mir-155 in cutaneous T-cell lymphoma. Cell Cycle 12: Larsen MJ, Kruse TA, Tan Q, Laenkholm AV, Bak M, et al Classifications within molecular subtypes enables identification of BRCA1/BRCA2 mutation carriers by RNA tumor profiling. PloS one 8:e Machado AM, Desler C, Boggild S, Strickertsson JA, Friis-Hansen L, et al Helicobacter pylori infection affects mitochondrial function and DNA repair, thus, mediating genetic instability in gastric cells. Mechanisms of ageing and development 134: Norgaard P, Wright D, Ball S, Newell P, Kirkegaard I, et al Autocorrelation and crosscorrelation between hcgbeta and PAPP-A in repeated sampling during first trimester of pregnancy. Clinical chemistry and laboratory medicine : CCLM / FESCC 51: Ohrt-Nissen S, Dossing KB, Rossing M, Lajer C, Vikesa J, et al Characterization of mirna expression in human degenerative lumbar disks. Connective tissue research 54: Pedersen TX, Madsen M, Junker N, Christoffersen C, Vikesa J, et al Osteopontin deficiency dampens the pro-atherogenic effect of uraemia. Cardiovascular research 98: Permuth-Wey J, Lawrenson K, Shen HC, Velkova A, Tyrer JP, et al Identification and molecular characterization of a new ovarian cancer susceptibility locus at 17q Nature communications 4: Petersen SM, Dandanell M, Rasmussen LJ, Gerdes AM, Krogh LN, et al Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients. BMC medical genetics 14: Ratzer R, Sondergaard HB, Christensen JR, Bornsen L, Borup R, et al Gene expression analysis of relapsing-remitting, primary progressive and secondary progressive multiple sclerosis. Mult Scler 19: Rehfeld A, Plass M, Krogh A, Friis-Hansen L Alterations in polyadenylation and its implications for endocrine disease. Frontiers in endocrinology 4: Rieneck K, Bak M, Jonson L, Clausen FB, Krog GR, et al Next-generation sequencing: proof of concept for antenatal prediction of the fetal Kell blood group phenotype from cell-free fetal DNA in maternal plasma. Transfusion 53:

12 24. Schuster MB, Frank AK, Bagger FO, Rapin N, Vikesaa J, Porse BT Lack of the p42 form of C/EBPalpha leads to spontaneous immortalization and lineage infidelity of committed myeloid progenitors. Experimental hematology 41: e Southey MC, Park DJ, Nguyen-Dumont T, Campbell I, Thompson E, et al COMPLEXO: identifying the missing heritability of breast cancer via next generation collaboration. Breast cancer research : BCR 15: Strickertsson JA, Desler C, Martin-Bertelsen T, Machado AM, Wadstrom T, et al Enterococcus faecalis infection causes inflammation, intracellular oxphos-independent ROS production, and DNA damage in human gastric cancer cells. PloS one 8:e Versteyhe S, Klaproth B, Borup R, Palsgaard J, Jensen M, et al IGF-I, IGF-II, and Insulin Stimulate Different Gene Expression Responses through Binding to the IGF-I Receptor. Frontiers in endocrinology 4: Walker LC, Whiley PJ, Houdayer C, Hansen TV, Vega A, et al Evaluation of a 5-tier scheme proposed for classification of sequence variants using bioinformatic and splicing assay data: interreviewer variability and promotion of minimum reporting guidelines. Human mutation 34: Listen indeholder kun publikationer hvor GM medarbejdere er hoved- eller medforfattere og har ydet et væsentligt bidrag. For publikationer af brugere hvor GM blot har bidraget med teknisk assistance og apparatur henvises til de enkelte forskeres egne årsopgørelser. Ph.D.-afhandlinger 2013 Jonas Vikeså - Functional characterization of oncofetal RNA binding-imps 2013 Maria Rossing - Molecular classification of follicular thyroid cancer Internationale samarbejder Genomisk Medicin deltager i følgende internationale konsortier: The Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA) Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) COMPLEXO Society of Paediaric Oncology European Neuroblastoma Network (SIOPEN) 12

13 Vejen mod molekylær sygdomstaxonomi Tumorheterogenitet og utilstrækkelig klassifikation medfører ofte, at patienter behandles med uvirksom medicin med bivirkninger. Målrettet terapi er derfor et væsentligt udviklingsområde inden for genomsik medicin og moderne onkologi. En af de store udfordringer ved målrettet medicin er at udvælge de patienter, som måtte have gavn af nye målrettede farmaka. Behandlingsfølsomme tumorvarianter er mere udbredt end antaget, og flere forskellige mutationer i målproteinerne er følsomme for stofferne. Tendensen går derfor mod at udvide tumorundersøgelserne for mutationer til et meget større spektrum af cancere, ligesom hver tumor undersøges for mange flere typer af mutationer ultimativt for alle mutationer. I 2013 indførte Fase 1-Enheden på Rigshospitalet et personligt genomisk screeningsprogram Copenhagen Prospective Personalised Oncology (Coppo) og Genomisk Medicin fokuserer på at understøtte projektet med en omfattende molekylær karakteristik af patienternes tumorer. Projektet vil fortsætte i 2014, og blive suppleret med ny microarraybaseret brystkræftdiagnostik og tumorklassifikationer, ligesom vi vil tilbyde hurtigere og mere omfattende diagnostik af arvelige kræftformer. Tumorbiopsi Blodprøve RNA DNA DNA RNA sek. Microarray mrna NGS Exom Cancerpanel Microarray SNP NGS Exom Translokationer Mutationer CNV Klassifikation Mutationer Kopitals variationer Normale varianter Til integrativ cancer analyse anvendes en tumorbiopsi og en blodprøve fra patienten. Fra tumoren isoleres DNA og RNA og fra blodprøven isoleres DNA som anvendes til at bortfiltrere konstitutive genvarianter i tumoren. Mutations- og kopitalsvariationer aflæses fra DNA sekventering og microarray SNP analyse, mens genekspressionsprofilen og tumorspecifikke translokationer kortlægges fra RNA microarrays og RNA Seq. Samlet kan man angive hvilken tumor der er tale om og hvorvidt tumoren besidder mutationer, som er forbundet med følsomhed for et bestemt kemoterapeutikum. 13

Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse

Danish Consortium for Neuromuscular Diseases. Genomsekventering klinisk anvendelse Danish Consortium for Neuromuscular Diseases Genomsekventering klinisk anvendelse Odense, 2. september, 2013 Jens Michael Hertz, MD, DMSc Professor, consultant Phone: +45 6541 3191 (dir.), or +45 2027

Læs mere

Personlig medicin: Styr på teknologien og de kloge hoveder

Personlig medicin: Styr på teknologien og de kloge hoveder Personlig medicin: Styr på teknologien og de kloge hoveder Onsdag den 26. oktober kl. 13:00 17:30 i Aulaen på Aarhus Universitet Hvordan sikrer vi os de kloge hoveder, vi skal bruge? Anders Børglum Professor

Læs mere

NEXT onkologisk og hæmatologisk pilotcenter Fase 1 Enheden Rigshospitalet

NEXT onkologisk og hæmatologisk pilotcenter Fase 1 Enheden Rigshospitalet NATIONAL EXPERIMENTAL THERAPY PARTNERSHIP NEXT onkologisk og hæmatologisk pilotcenter Fase 1 Enheden Rigshospitalet Ulrik Lassen, professor, overlæge, ph.d. Fase 1 Enheden, onkologisk klinik, Rigshospitalet

Læs mere

Frederik Banch Clausen Cand. Scient. Biologi, ph.d.

Frederik Banch Clausen Cand. Scient. Biologi, ph.d. Frederik Banch Clausen Cand. Scient. Biologi, ph.d. FØTAL RHD TYPNING ERFARINGER FRA DANMARK Frederik Banch Clausen frederik.banch.clausen@regionh.dk Biolog, ph.d. Blodgenetisk Laboratorium Klinisk Immunologisk

Læs mere

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle?

Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Hvad er en biobank? Hvad skal vi forvente af regionernes biobanker? Hvorfor har og får de en rolle? Estrid Høgdall Regionernes Biobank Sekretariat Patologiafdelingen, Herlev Hospital Biobank har en rolle

Læs mere

Godthåbsvej. Bilag 3. Skema over afsendere af høringssvar og omhandlede emner

Godthåbsvej. Bilag 3. Skema over afsendere af høringssvar og omhandlede emner Bilag 3 Godthåbsvej Skema over afsendere af høringssvar og omhandlede emner A B C D E F G H I J K L Formålet Trafik Støj Slitage Parkering (herunder cykel-p) Plads/hjørne (nedlæggelse af vejudvidelse)

Læs mere

Matcher. Stilling. Gruppe H1

Matcher. Stilling. Gruppe H1 Matcher 1 : Køge OK - O-63/NFR/Maribo : 55-64 2 : Køge OK - OK Skærmen Værløse : 66-50 3 : Køge OK - DSR/Fredensborg/Vinderød : 66-47 4 : O-63/NFR/Maribo - OK Skærmen Værløse : 60-47 5 : O-63/NFR/Maribo

Læs mere

Forskningsstrategi Institut for Molekylær Medicin

Forskningsstrategi Institut for Molekylær Medicin Forskningsstrategi Institut for Molekylær Medicin Ledelsesforum for Medicinsk Sundhedsforskning Institutleder Uffe Holmskov 13. januar 2012 Institute for Molecular Medicine Institut for Medicinsk Biologi

Læs mere

Danish Comprehensive Cancer Center. et fælles nationalt projekt med internationalt perspektiv

Danish Comprehensive Cancer Center. et fælles nationalt projekt med internationalt perspektiv Danish Comprehensive Cancer Center et fælles nationalt projekt med internationalt perspektiv Hvorfor et DCCC? Udvikling på kræftområdet: 30% flere kræfttilfælde i 2025 Vil øge efterspørgslen på sundhedsydelser

Læs mere

NR - NAVN - BY - TID - ALD.-PRTAL-PLGRP.

NR - NAVN - BY - TID - ALD.-PRTAL-PLGRP. ENDELIG RESULTATLISTE FOR : HANSTHOLM LØBET 2001 RESULTATER - : 4.2 KM KVINDER 2887 DITTE LEU HANSTHOLM 18.20 33 63.64 1 2889 CECILIE MARDAL SNEDSTED 19.31 17 59.78 2 2878 DORTE SØRENSEN HANSTHOLM 19.48

Læs mere

Ringe Sø Marathon Halvmarathon0313 2013-03-16. www.42laps.com 2013-03-16

Ringe Sø Marathon Halvmarathon0313 2013-03-16. www.42laps.com 2013-03-16 1 Jonathan Dahl / Nislevgård / 00:19:05 Nislevgård00:19:48 00:20:30 00:20:07 00:20:13 00:00:33 01:40:18 (00:47) 2 Peder Balle 00:20:16 00:21:37 00:21:35 00:21:08 00:21:09 00:01:42 01:47:30 (00:50) 3 Martin

Læs mere

DGI Nordsjælland Skydning Milnersvej 44-46 3400 Hillerød 79 40 47 00

DGI Nordsjælland Skydning Milnersvej 44-46 3400 Hillerød 79 40 47 00 DGI Nordsjælland Skydning Milnersvej 44-46 3400 Hillerød 79 40 47 00 nordsjaelland@dgi.dk www.dds-nordsjaelland.dk DGI idræt & fællesskab 04-01-2015 RESULTATLISTE HOLDTURNERINGEN FREDERIKSBORG AMT Efterår

Læs mere

Fredag den 17. august 2012

Fredag den 17. august 2012 Fredag den 17. august 2012 10.00-10.05 Velkomst - Peter Plaschke 10.05-11.20 1. session Nyt fra forskningen Chairpersons Hans Jürgen Hoffmann og Lars K. Poulsen 10.05-10.20 Intralymfatisk immunterapi Marianne

Læs mere

MANDAG 21/3 TIRSDAG 22/3 ONSDAG 23/3 TORSDAG 24/3 FREDAG 25/3

MANDAG 21/3 TIRSDAG 22/3 ONSDAG 23/3 TORSDAG 24/3 FREDAG 25/3 7. semester Forår 2011 - Modul K2 - Sygdomme i respirationsvejene - Uge 12 6 GRUPPER HS 21.03.2011-- 8.15-9.00 MANDAG 21/3 TIRSDAG 22/3 ONSDAG 23/3 TORSDAG 24/3 FREDAG 25/3 WP 25.aud WP15 st. aud Sygdomme

Læs mere

Navn Billettype Vælg 7 kl. årgang

Navn Billettype Vælg 7 kl. årgang Kasper Grotrian Andersen Elev 7. Kl. årgang 06/07 Sandie Haubro Gedsted Hansen Elev 7. kl. årgang 06/07 Christina Mathilde Hougaard Elev 7. kl. årgang 06/07 Tobias Krogh Sæderup Elev 7. kl. årgang 06/07

Læs mere

Dansk Politimesterskab 2010 - herrer.

Dansk Politimesterskab 2010 - herrer. Dansk Politimesterskab 2010 - herrer. Nr. Start Navn Tjenestested / Hold Tid 1 2771 Torben Klose Fyn 02:43:01 2 1886 Karsten Bruhn Kristiansen Nordsjælland 02:47:05 3 10167 Palle Redder Østjylland 02:48:36

Læs mere

Bedre diagnostik flere tilfældighedsfund Dilemmaer ved genom-undersøgelser i diagnostik

Bedre diagnostik flere tilfældighedsfund Dilemmaer ved genom-undersøgelser i diagnostik Bedre diagnostik flere tilfældighedsfund Dilemmaer ved genom-undersøgelser i diagnostik Anne-Marie Gerdes Klinisk Genetisk Afdeling Rigshospitalet Hvad kan man bruge gendiagnostik til? Reducere sygdomshyppighed

Læs mere

Rekorder for damer 12 år og yngre Kortbane Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato:

Rekorder for damer 12 år og yngre Kortbane Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato: Navn: Tid: Dato: Rekorder for damer 12 år og yngre 50 Fri Navn: Frederikke Hedegaard Tid: 0.30.34 Dato: 19.11.05 100 Fri Navn: Julie Søgaard Tid: 1.06.65 Dato: 30.11.13 200 Fri Navn: Julie Søgaard Tid: 2.27.23 Dato: 01.12.13

Læs mere

TIRSDAG D. 13. SEPTEMBER

TIRSDAG D. 13. SEPTEMBER Program for NML Kongres og DEKS Brugermøde 2011 NB: Programmet er foreløbigt og opdateres løbende. Der kan stadig ske ændringer i indhold og lokaleplacering. TIRSDAG D. 13. SEPTEMBER Tjek-in og snacks

Læs mere

MODERNE METAGENOMANALYSER MIKROBIEL NEDBRYDNING AF MILJØFREMMEDE STOFFER I JORD OG GRUNDVAND

MODERNE METAGENOMANALYSER MIKROBIEL NEDBRYDNING AF MILJØFREMMEDE STOFFER I JORD OG GRUNDVAND AARHUS UNIVERSITY DEPARTMENT OF ENVIRONMENTAL SCIENCE ENVIRONMENTAL MICROBIAL GENOMICS GROUP MODERNE METAGENOMANALYSER MIKROBIEL NEDBRYDNING AF MILJØFREMMEDE STOFFER I JORD OG GRUNDVAND Aarhus Universitet,

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

Hovedrengøring Område Navn Telefon Formænd Deadline Rengøringsmateriel Ruth Visby X Indkøb. Ruth Visby X. Område

Hovedrengøring Område Navn Telefon Formænd Deadline Rengøringsmateriel Ruth Visby X Indkøb. Ruth Visby X. Område Område Navn Telefon Formænd Deadline Rengøringsmateriel Ruth Visby 97971156 X Indkøb. Ruth Visby 97971156 X Område 1 12-07-2015 Dorte & Michael Christiansen 41 29 59 44 X Bettina & Lars Grønkjær 23 64

Læs mere

Esben N. Flindt, platformskoordinator Danske Regioner Personlig Medicin 10. december 2014. Danske Regioner - Personlig Medicin 10/12-2014

Esben N. Flindt, platformskoordinator Danske Regioner Personlig Medicin 10. december 2014. Danske Regioner - Personlig Medicin 10/12-2014 Esben N. Flindt, platformskoordinator Danske Regioner Personlig Medicin 10. december 2014 Danske Regioner - Personlig Medicin 10/12-2014 GenomeDenmark Platformen En national platform for stor-skala sekventering

Læs mere

Resultater Vinterlang 2016 2016-01-31

Resultater Vinterlang 2016 2016-01-31 MeOS 2016-02-01 10:15:20, KORT, (1/6) Resultater Vinterlang 2016 2016-01-31 KORT (34 / 34) Tid Efter 1. Rasmus Lau Petersen Allerød OK 36:20 2:21 (2:21) 2:30 (4:51) 2:51 (7:42) 2:01 (9:43) 1:33 (11:16)

Læs mere

Døstrup IF Svinget 11 9500 Hobro www.dostrupif.dk Klublotto vinderne

Døstrup IF Svinget 11 9500 Hobro www.dostrupif.dk Klublotto vinderne Klublotto vinderne 2009 25 Rigmor Madsen 58 Lisbeth Sørensen 66 Lars Pedersen (LP) 24 Klaus Rasmussen 14 Michael Nielsen 51 Familien Pedersen 9 Jørgen Hedemand 55 Henrik Nielsen 60 Døstrup kortklub 49

Læs mere

ALS FORSKNING: GENER OG PIPELINE MEDICIN. Páll Karlsson. Ph.d. Med. Danish Pain Research Center Dept. of Neurology Aarhus University Hospital

ALS FORSKNING: GENER OG PIPELINE MEDICIN. Páll Karlsson. Ph.d. Med. Danish Pain Research Center Dept. of Neurology Aarhus University Hospital : GENER OG PIPELINE MEDICIN Ph.d. Med. Danish Pain Research Center Dept. of Neurology Aarhus University Hospital OSLO, 24 OKTOBER 2015 1 AARHUS M.Sc. i neuro-biologi (2009) fra Aarhus Ph.d. i medicin (2013)

Læs mere

Lille mand stor biobank big data

Lille mand stor biobank big data Personlig medicin: styr på teknologien og de kloge hoveder Lille mand stor biobank big data Anne-Marie Gerdes Klinikchef, professor Klinisk Genetisk Klinik, RH Medlem af Etisk Råd Disclosure: Advisory

Læs mere

Godkender modtagelse af donation. Kontoansvarlig hospitalsperson. Centerdirektør. Centerdirektør Johannes Jakobsen. Johannes Jakobsen.

Godkender modtagelse af donation. Kontoansvarlig hospitalsperson. Centerdirektør. Centerdirektør Johannes Jakobsen. Johannes Jakobsen. Aktivitet, projektnavn Fellow/Scolarship program hospital/ Projektansvarlig hospitalsperson Kontoansvarlig hospitalsperson Godkender modtagelse af donation Type af aktivitet/projekt/ udstyr/enhed Tidshorisont

Læs mere

Resultatliste Politimesterskaber i Maraton 2012. Mesterskabsklasse (klasse 1)

Resultatliste Politimesterskaber i Maraton 2012. Mesterskabsklasse (klasse 1) Resultatliste Politimesterskaber i Maraton 2012. Mesterskabsklasse (klasse 1) 1 6566 Tony Wang Markussen guld Københavns Vestegn 02:48:39 2 6590 Torben Klose sølv Fyn 02:57:10 3 2227 Martin Gravesen bronze

Læs mere

Dansk Skytte Union 50m Hjemmebaneturnering 2014 - Senior

Dansk Skytte Union 50m Hjemmebaneturnering 2014 - Senior 60 liggende 5. omgang total 1. division 1 Ballerup 1 1872,6 10 9378,1 50 2 Kolding 1 1865,0 7 9277,0 31 3 DSB/ASF 1 1865,2 7 7431,0 29 4 Viborg 1 1852,7 4 9247,6 22 5 Bredstrup-Pjedsted 1 1843,9 0 9195,7

Læs mere

afholdt d. 5. maj 2014

afholdt d. 5. maj 2014 At initierer forandring en ledelsesopgave Generelle infektionshygiejniske retningslinjer - Hvordan bliver vi bedre til det? Temamøde CEI 5 maj 2014 Bettina Lundgren, centerdirektør, dr. med. Diagnostisk

Læs mere

Status for udvikling af molekylær medicin ved Molekylær Medicinsk Afdeling, Aarhus Universitetshospital.

Status for udvikling af molekylær medicin ved Molekylær Medicinsk Afdeling, Aarhus Universitetshospital. Regionshuset Viborg Sundhedsplanlægning Skottenborg 26 DK-8800 Viborg Tel. +45 87 28 5000 www.regionmidtjylland.dk Status for udvikling af molekylær medicin ved Molekylær Medicinsk Afdeling, Aarhus Universitetshospital.

Læs mere

Faglig netværksgruppe Natur/teknik

Faglig netværksgruppe Natur/teknik N/T Skole Faglærere Mailadresse - samlet mail liste sidst i dokumentet Tovholder MBS Bente Mathiesen Tovholder bente@gefibermail.dk Bakkeskolen Bjedstrup Skole Ejer Bavnehøj Skolen Gl.Rye Skole Gyvelhøjskolen

Læs mere

Resultater. for Hanstholm løbet 2005

Resultater. for Hanstholm løbet 2005 Resultater for Hanstholm løbet 2005 RESULTATER - : KVINDER 4.2 KM 327 EMMA LEU HANSTHOLM 20.40 11 0.00 3 424 LINETTE K LARSEN HANSTHOLM 24.36 9 0.00 8 336 KRISTINA MADSEN THISTED 29.39 12 0.00 24 426 KATHARINA

Læs mere

Gældende fra: April 2014 (Hold SB512) Version: Endelig Side 1 af 5

Gældende fra: April 2014 (Hold SB512) Version: Endelig Side 1 af 5 Molekylærbiologiske analyser og teknikker har viden om teorien og principperne bag udvalgte molekylærbiologiske analyser og teknikker Analyser og analyseprincipper på biomolekylært, celle- og vævs- samt

Læs mere

Døstrup IF Svinget Hobro Klublotto vinderne

Døstrup IF Svinget Hobro  Klublotto vinderne Klublotto vinderne 2009 25 Rigmor Madsen 58 Lisbeth Sørensen 66 Lars Pedersen (LP) 24 Klaus Rasmussen 14 Michael Nielsen 51 Familien Pedersen 9 Jørgen Hedemand 55 Henrik Nielsen 60 Døstrup kortklub 49

Læs mere

Au2Partsløbet afdeling af SM Søndag den 17. april 2016 R E S U L T A T P R. P R Ø V E Prøve 01 Tinghøjvej 1 Plac. Plac. Diff. Diff. Nr.

Au2Partsløbet afdeling af SM Søndag den 17. april 2016 R E S U L T A T P R. P R Ø V E Prøve 01 Tinghøjvej 1 Plac. Plac. Diff. Diff. Nr. Au2Partsløbet 2016 2. afdeling af SM Søndag den 17. april 2016 R E S U L T A T P R. P R Ø V E Prøve 01 Tinghøjvej 1 16 Allan Hansen Peter Petersen KR3 1 1 03:49 39,3 31 Steen Petersen Allan Petersen KR6

Læs mere

Opgivet og tilbage til livet Personalised Medicine ved onkologiske fase 1 forsøg

Opgivet og tilbage til livet Personalised Medicine ved onkologiske fase 1 forsøg Opgivet og tilbage til livet Personalised Medicine ved onkologiske fase 1 forsøg Ulrik Lassen, Phase 1 Unit, Department of Oncology, Rigshospitalet Faser i lægemiddelforsøg Prækliniske forsøg: proof of

Læs mere

Kom videre med matematik på computer og smartboard - indskolingen

Kom videre med matematik på computer og smartboard - indskolingen Kom videre med matematik på computer og smartboard - indskolingen Hold: 12201A Mandag 3. september 2012 15:00 til 17:30 Mandag 1. oktober 2012 15:00 til 17:30 Mandag 5. november 2012 15:00 til 17:30 Mandag

Læs mere

Resultater for DM Duathlon 2012

Resultater for DM Duathlon 2012 DM Duathlon 2012 Age Group Results May 06, 2012 Results By Race Management Systems, Inc. Female 18 to 39 1 369 Karina Louise Sørensen Ninjas 39:51.75 1:14.73 1:09:39.99 0:55.29 19:50.78 2:11:32.54 2 417

Læs mere

Jane Stella Winther og Nick Andrés Winther Kristensen Fjordparken 220 8700 Horsens. ret: 23 10-2014. Godsbanegade 1, 1. tv.

Jane Stella Winther og Nick Andrés Winther Kristensen Fjordparken 220 8700 Horsens. ret: 23 10-2014. Godsbanegade 1, 1. tv. ret: 23 10-2014 Navn og adresse Pårørende Godsbanegade 1, 1. tv. Jens Nielsen - Tlf.: 29768036 Mail : jens-nielsen01@jubii.dk Tove Nielsen - Tlf.: 75621368 / 24251224 Godsbanegade 1, 1 th. Flemming Hjortlund

Læs mere

Resultater AMOK Vinterlang 2015-01-25

Resultater AMOK Vinterlang 2015-01-25 MeOS 2015-01-26 10:50:10, Lang, (1/5) Resultater AMOK Vinterlang 2015-01-25 Lang (30 / 30) Tid Efter 1. Michael Sørensen OK Øst Birkerød 1:53:30 3:48 (3:48) 2:11 (5:59) 2:58 (8:57) 1:24 (10:21) 3:16 (13:37)

Læs mere

Mikkel Johansen 01:59:30 15 km

Mikkel Johansen 01:59:30 15 km Mikkel Johansen 01:59:30 15 km Marianne Sørensen 01:30:00 15 km Kirsten Nielsen 01:27:00 12 km Lene Klit Simonsen 01:26:00 12 km Claus Johansen 01:03:46 12 km Ejner Christensen 12 km Niels Jonstrup 12

Læs mere

UM 50M Junior og Ungdom. Vestereng Skydebaner

UM 50M Junior og Ungdom. Vestereng Skydebaner UM 5M 29 Junior og Ungdom Vestereng Skydebaner www.skytteunion.dk 1 6 liggende Herrejunior 1 Nicolai Espersen Ballerup 99 98 97 98 94 97 583 29x 583 Finale 12,1 685,1 2 Alexander Helleskov Trehøje 98 98

Læs mere

Ny chip sætter navn på kræften

Ny chip sætter navn på kræften Page 1 of 6 Ny chip sætter navn på kræften 19. juni 2009 kl. 11:12 Danske forskere på vej med en chip, der ud fra en vævsprøve fra en svulst hurtigt kan se hvad slags kræft, patienten har. Det skærer udredningstiden

Læs mere

von Hippel-Lindau (vhl)

von Hippel-Lindau (vhl) Den danske vhl koordinationsgruppe Side 1 von Hippel-Lindau (vhl) VANDREJOURNAL for Navn: CPR Adr. Postnr. By Tlf. Mobil E-mail Påbegyndt dato: Side 2 Den danske vhl koordinationsgruppe Denne vandrejournal

Læs mere

Børn til og med 11 år, 6 km

Børn til og med 11 år, 6 km Børn til og med 11 år, 6 km 00:37:04 Tilde Plass 306 1 00:55:42 Mille Plass 307 2 00:55:43 Cecilie Rasmussen 338 3 01:02:16 Rasmus Rosendahl Kaa 163 4 01:02:18 Ida Rosendahl Kaa 155 5 01:02:20 Christine

Læs mere

Diplom. Michael Dideriksen. har gennemført 1/2 marathon distancen ved Vornæs Rundt. Søndag d. 26. juli 2015. i tiden: 1:28:04.

Diplom. Michael Dideriksen. har gennemført 1/2 marathon distancen ved Vornæs Rundt. Søndag d. 26. juli 2015. i tiden: 1:28:04. Michael Dideriksen har gennemført 1/2 marathon distancen ved 1:28:04 Klaus Haller har gennemført 1/2 marathon distancen ved 1:32:46 Jan Nygaard Jensen har gennemført 1/2 marathon distancen ved 1:33:33

Læs mere

NEXT NYHEDSBREV #5 2016

NEXT NYHEDSBREV #5 2016 Page 1 of 5 View this email in your browser NEXT NYHEDSBREV #5 2016 Velkommen til det 5. nyhedsbrev fra NEXT National Experimental Therapy Partnership. ESMO 2016 I KØBENHAVN Kronprinsesse Mary, ESMO's

Læs mere

Klinisk relevante markører rer og laboratoriemetoder. Lars Henrik Jensen, overlæge ph.d. Onkologisk afdeling Sygehus Lillebælt

Klinisk relevante markører rer og laboratoriemetoder. Lars Henrik Jensen, overlæge ph.d. Onkologisk afdeling Sygehus Lillebælt Klinisk relevante markører rer og laboratoriemetoder Lars Henrik Jensen, overlæge ph.d. Onkologisk afdeling Sygehus Lillebælt Markører og metoder - eksempler fra 3 store sygdomme Mamma HER2 Vævsanalyser

Læs mere

Highscore 1 serie - Damer

Highscore 1 serie - Damer Highscore 1 serie - Damer Nr.: Navn: Navn: Kegler: 1 11 1 1 1 1 1 1 1 1 0 1 0 Rita Gabel-Jensen Danske Bank Vu Anh Nguyen System Frugt Kirsten Akselsen MT Højgaard A/S 11 Inge Andersen TDC IF 0 Lena B.

Læs mere

Aarhus Brandvæsen, Januar 2015. Ledelsen. Staben. Beredskabschef Lars Hviid. Afdelingsleder Per Dyrvig Forebyggende Afdeling

Aarhus Brandvæsen, Januar 2015. Ledelsen. Staben. Beredskabschef Lars Hviid. Afdelingsleder Per Dyrvig Forebyggende Afdeling Ledelsen Beredskabschef Lars Hviid Sekretariatsleder Karina Gregersen Sekretariatet Per Dyrvig Forebyggende Afdeling Lene Ø. Hansen Salg & Service Anders Rathcke Operativ Afdeling Staben Stabsmedarbejder

Læs mere

Personlig medicin i genetisk rådgivning og udredning

Personlig medicin i genetisk rådgivning og udredning Personlig medicin i genetisk rådgivning og udredning Elsebet Østergaard Overlæge, Klinisk Genetisk Klinik, Rigshospitalet Formand, Dansk Selskab for Medicinsk Genetik Genetisk rådgivning og udredning før

Læs mere

S a h l F riskole Kløservejen 3, Sahl 8850 Bjerringbro. Udvalg Sahl Friskole og Vores Børnehave 2014/2015. Udvalg fælles for skole og børnehave

S a h l F riskole Kløservejen 3, Sahl 8850 Bjerringbro. Udvalg Sahl Friskole og Vores Børnehave 2014/2015. Udvalg fælles for skole og børnehave Kløservejen 3, Sahl 8850 Bjerringbro Udvalg Sahl Friskole og Vores Børnehave 2014/2015 Udvalg fælles for skole og børnehave Rengøringsudvalg Inge Møller Anita Post El-udvalg Jens Boll Leif Poulsen Martin

Læs mere

RESULTATLISTE DDSN 15m Pistolturnering Individuelle resultater

RESULTATLISTE DDSN 15m Pistolturnering Individuelle resultater RESULTATLISTE DDSN 15m Pistolturnering 2013-14 Individuelle resultater Standardpistol BK Runde 1 Runde 2 Runde 3 Runde 4 SUM 1 103691 Mikkel H. Wendell 251 0 0 0 251 Standardpistol Junior Runde 1 Runde

Læs mere

Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2010

Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2010 Fertilitetsklinikken Regionshospitalet Skive. Organisation, produktion og resultater 2010 Formål Formålet med denne rapport er, at give borgere, relevante myndigheder, instanser og kolleger et indblik

Læs mere

revideret udgave pr. 06-08-2015 Side 1 af 5

revideret udgave pr. 06-08-2015 Side 1 af 5 Lørdag d. 8. august 2015 min. 1 O Overordnet kl. 10.30-14.00 1 Ø Økonomi O Susanne Dalmose 1 5 2 F Fastbar Ø Tove Bach Pedersen 1 3 1 T Tappe T Karin Jespersen T1 1 4 1 R Rullebar F Lone Steen F1 R3 B2

Læs mere

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Exiqons cloud-løsning hjælper forskere med at analysere og forstå genomics og big data Hvad er genomics? Genomics er

Læs mere

Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse

Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse Side 1 af 5 Procedure/vejledning Vejledning til læger og sundhedspersonale om kromosom mikroarray analyse Udarbejdet af Lægerne, Kennedy Centret 1 Hvad er kromosom mikroarray analyse? Kromosom mikroarray

Læs mere

Arvelig brystkræft hvilke gener kender vi og hvad er den kliniske betydning

Arvelig brystkræft hvilke gener kender vi og hvad er den kliniske betydning Arvelig brystkræft hvilke gener kender vi og hvad er den kliniske betydning Anne-Marie Gerdes DBCG s Genetiske udvalg Arvelig mammacancer Tidlig debut Flere afficerede familiemedlemmer Bilateral mammacancer

Læs mere

RESULTATLISTE Rødding Skydning 2016

RESULTATLISTE Rødding Skydning 2016 13-03-2016 17:41:59 - DDS SP v.3.15.11.1 RESULTATLISTE Rødding Skydning 2016 Gevær, 15m. - Mesterskab Børn 1 1 116598 Nicolai Mathiesen 11-072 Helle Skytteforening 200/12 198/08 398/20 2 99520 Stine Jacobsen

Læs mere

RESULTATLISTE Sommerstævne 2014 Viborg

RESULTATLISTE Sommerstævne 2014 Viborg 07-06-2014 19:59:26 - DDS SP v.3.14.4.1 RESULTATLISTE Sommerstævne 2014 Viborg Gevær, 50m. - Mesterskab BK1 1 96986 Dagmar Storm Kristensen 06-033 Skals Skytteforening 200/12 200/14 400/26 2 113123 Emilie

Læs mere

Alfa-1-antitrysin mangel hos børn. Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH

Alfa-1-antitrysin mangel hos børn. Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH Alfa-1-antitrysin mangel hos børn Elisabeth Stenbøg, Afd.læge, PhD Børneafd. A, AUH Hvad er det? Alfa-1-antitrypsin Proteinstof Produceres i leveren Fungerer i lungerne Regulerer neutrofil elastase balancen

Læs mere

Juniortræner Maria Jensen (U-17) Juniortræner Nanna Levisen (U-17)

Juniortræner Maria Jensen (U-17) Juniortræner Nanna Levisen (U-17) TELEFONLISTE Hold Navn Telefon Mail Formanden Thomas Bendtsen 228580 thomas_bendtsen@outlook.com Kasserer Flemming Berg 53635575 VI39-fodbold-kasserer@live.dk Elite Tommy Larsen 222134 tla@auroragroup.dk

Læs mere

Tile[1,1] of Mosaic[6,2] Page 1 of 12

Tile[1,1] of Mosaic[6,2] Page 1 of 12 Tile[1,1] of Mosaic[6,2] Page 1 of 12???? - 1778 Mourits???? - 1840 Hans Muoritsen Børge Mouritsen???? - 1816 1780-1860 Peder "" Første ægteskab Mourits Marie Andet ægteskab???? - 1837 Anders Andersen????

Læs mere

Resultatliste - Randers åben 09 / 12-11-2011

Resultatliste - Randers åben 09 / 12-11-2011 Page 1 of 7 12-11-2011 16:32:06 - DDS SP v.3.11.11.3 RESULTATLISTE Randers åben 09 / 12-11-2011 Gevær, 15m. - Mesterskab BK1 1 25303Kirstine Bissø Svoboda 05-940 Samsø Skytteforening 200/11 200/11 400/22G

Læs mere

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing For 60 år siden blev DNA opdaget. I øjeblikket afprøver vi NGS, og til sommer kører vi BRCA-gener med den nye metode I år er det 60 år siden, at DNA s struktur blev erkendt,

Læs mere

RESULTATLISTE DDS midt 15 meter pistol stævne 2 runde 2011-2012

RESULTATLISTE DDS midt 15 meter pistol stævne 2 runde 2011-2012 Side 1 af 8 01-12-2011 07:44:33 - DDS SP v.3.11.11.8 RESULTATLISTE DDS midt 15 meter pistol stævne 2 runde 2011-2012 Holdkonkurrence: 15 meter call 22 1 Aulum Skytteforening 31309 Keld Jeppesen Klasse:

Læs mere

Det bliver lettere at se forskel på syge og raske gener i Danmark

Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at diagnosticere genetisk betingede sygdomme i Danmark, efter at forskere har nået første milepæl i kortlægningen af

Læs mere

3. Ægteparturnering den 29. august SUM Placering. 1. Ægteparturnering den 19. april. 2. Ægteparturnering den 7. juni. Navn Judith & Harry Jensen

3. Ægteparturnering den 29. august SUM Placering. 1. Ægteparturnering den 19. april. 2. Ægteparturnering den 7. juni. Navn Judith & Harry Jensen 1. ægteparturnering - resultater Længste drive hul 4 - Christina Christiansen Tættest flaget på hul 2 - Ole Christoffersen Tættest flaget på hul 7 - Ole Frølich-Hansen Tættest flaget på hul 12 - Se tættest

Læs mere

VAGTPLAN DTH JULECUP 2014

VAGTPLAN DTH JULECUP 2014 VAGTPLAN DTH JULECUP 2014 SLIKKIOSK ( HOLBERG HALLEN) SLIKKIOSKER OG PØLSEKIOSKER JETTE SCHUBERT 8-13 Stinne Søemosegaard Helle Sigersen 13-18 Tove Madsen Tikkie Hansen 18-23 Carina Jørgensen Anja Brodthagen

Læs mere

Kandidatliste. AU valg Akademisk Råd ved Faculty of Health VIP. Organ: Valggruppe:

Kandidatliste. AU valg Akademisk Råd ved Faculty of Health VIP. Organ: Valggruppe: Valg til akademisk råd valg 0 Akademisk Råd ved Faculty of Health Repræsentationsområde: Department of Clinical Medicine Liste: Liste 05åå-xxxx Jørgen Frøkiær Dato 5 nov 0, kl. 4: Side af Valg til akademisk

Læs mere

Danskemesterskaber m luftriffel

Danskemesterskaber m luftriffel Danskemesterskaber 00 0m luftriffel Resultatliste Dansk Skytte Union 0. og 0. marts 00 Skytternes Hus Århus 0 stående Dame 0 Anette K. Jensen DSB/ASF 00 00, Stine M. Andersen ÅRK 00 00 00, Rikke K. Jensen

Læs mere

Niels Ebbe Sørensen. Benny Arne Sørensen. Niels-Christian Tramm. Boet efter Inge Marie Sørensen. Kjeld Olesen. Karlo Lauridsen

Niels Ebbe Sørensen. Benny Arne Sørensen. Niels-Christian Tramm. Boet efter Inge Marie Sørensen. Kjeld Olesen. Karlo Lauridsen Ejendomsliste. Bilag 2 2 Niels Ebbe Sørensen 1e 1d 1f 1g 1c 1i 1b 1a Niels Ebbe Sørensen Benny Arne Sørensen Niels-Christian Tramm Boet efter Inge Marie Sørensen Kjeld Olesen Tjæreby Vejle, Tårnborg 2e

Læs mere

AM Auto Løbet 2015. Søndag den 17. maj 2015 R E S U L T A T P R. P R Ø V E. Randers Auto Sport

AM Auto Løbet 2015. Søndag den 17. maj 2015 R E S U L T A T P R. P R Ø V E. Randers Auto Sport 01 SS1 DLG Skørring 1 Brian Rasmussen Gert B. Pedersen KR7 1 1 01:07 4 Jonas Bjerregaard Gad Bjarke Gad KR7 2 2 01:08 00:01 00:01 9 Henrik Vestergaard Søren Lind Andersen KR7 3 3 01:09 00:02 00:01 8 Jess

Læs mere

Aarhus Brandvæsen, August Ledelsen. Staben. Beredskabschef Lars Hviid. Afdelingsleder Per Dyrvig Forebyggende Afdeling

Aarhus Brandvæsen, August Ledelsen. Staben. Beredskabschef Lars Hviid. Afdelingsleder Per Dyrvig Forebyggende Afdeling Ledelsen Beredskabschef Lars Hviid Sekretariatsleder Karina Gregersen Sekretariatet Per Dyrvig Forebyggende Afdeling Lene Ø. Hansen Salg & Service Anders Rathcke Operativ Afdeling Staben Stabsmedarbejder

Læs mere

RESULTATLISTE Vejle stævne 15m 2014

RESULTATLISTE Vejle stævne 15m 2014 RESULTATLISTE Vejle stævne 15m 2014 DDS SP v.3.14.4.1 Gevær, 15m. - Mesterskab BK1 1 101491 Gustav Røjkjær 10-006 Klejs-Juelsminde Skytteforening 200/11 200/14 400/25 2 20564 Silas Højfeldt Kildehøj 10-456

Læs mere

Kl. 10.30-11.15 Anders Flarup - Kl. 17.00-19.15 Hans Jørgen Jensen - Kl. 08.00-09.30 Anders Flarup -

Kl. 10.30-11.15 Anders Flarup - Kl. 17.00-19.15 Hans Jørgen Jensen - Kl. 08.00-09.30 Anders Flarup - Arena Nord 1 Fredag Vagt 1 Vagt 2 Bemærkninger Kl. 11.00-14.00 Mette Lambertsen Trine Andersen Kl. 14.45-18.15 Hans Jørgen Jensen - Kl. 18.15-21.15 Mette Lambertsen Trine Andersen Lørdag Vagt 1 Vagt 2

Læs mere

RESULTATLISTE Randers åben 15 m 2012

RESULTATLISTE Randers åben 15 m 2012 RESULTATLISTE Randers åben 15 m 2012 Gevær, 15m. - Mesterskab BK1 1 101279 Benjamin Lahn Pedersen 05-101 Randers Skyttekreds 199/05 200/11 399/16 G 2 95349 Kristian Gyldenløv 05-944 Århus Riffelskytte

Læs mere

2008 Hulspil. Peter Launer Bæk. Slagspil. Frederik Nielsen. Senior. 2007 Hulspil. Mikkel Grimsgaard

2008 Hulspil. Peter Launer Bæk. Slagspil. Frederik Nielsen. Senior. 2007 Hulspil. Mikkel Grimsgaard 2008 Peter Launer Bæk Peter Launer Bæk Frederik Nielsen Jimmy Simonsen 2007 Mikkel Grimsgaard Jonas B. Bruun Mikkel Grimsgaard Jan Danica Veteraner Nils Jørgen Heiden 2006 Jais Frimodt Brian H. Christensen

Læs mere

Niels Høigaard Rasmussen - CURRICULUM VITAE

Niels Høigaard Rasmussen - CURRICULUM VITAE Niels Høigaard Rasmussen - CURRICULUM VITAE Uddannelse og ansættelser Uddannelse Januar 1990 November 2001 Medicinsk embedseksamen, Københavns Universitet. Specialist i anæstesiologi. Aktuel ansættelse

Læs mere

Anlægsbærerundersøgelse ved autosomal recessive sygdomme

Anlægsbærerundersøgelse ved autosomal recessive sygdomme Holdningspapir Dansk Selskab for Medicinsk Genetik Anlægsbærerundersøgelse ved autosomal recessive sygdomme Holdningspapiret er udarbejdet i 2015 af en arbejdsgruppe nedsat af Dansk Selskab for medicinsk

Læs mere

Dansk Skytte Union 50m Hjemmebaneturnering 2014 - Senior

Dansk Skytte Union 50m Hjemmebaneturnering 2014 - Senior 60 liggende 1. omgang total 1. division 1 Ballerup 1 1878,1 10 1878,1 10 2 Kolding 1 1852,4 8 1852,4 8 3 Bredstrup-Pjedsted 1 1846,0 6 1846,0 6 4 Hvidovre SF 1 1839,9 4 1839,9 4 5 Viborg 1 1835,7 2 1835,7

Læs mere

Oversigt over Landsforsøgene 2014

Oversigt over Landsforsøgene 2014 Oversigt over Landsforsøgene 2014 vfl.dk Oversigt over Landsforsøgene 2014 Forsøg og undersøgelser i Dansk Landbrugsrådgivning Samlet og udarbejdet af LANDBRUG & FØDEVARER, PLANTEPRODUKTION ved chefkonsulent

Læs mere

U-17 STÆVNE Mesterrække og A-række

U-17 STÆVNE Mesterrække og A-række U-17 STÆVNE Mesterrække og A-række 4.-5. september 2010 Herresingle U17 M Pulje 1 Afb 1 Frederik Jeppesen Ikast 2 Simon Ginnerup Andersen * 3 Mathias Nielsen Sportsefterskolen SINE 1-2 W.O. (2) 1-3 W.O.

Læs mere

1. Undersøgelsesmetoder, der hører under begrebet omfattende kortlægning

1. Undersøgelsesmetoder, der hører under begrebet omfattende kortlægning Version 5 RETNINGSLINJER for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af individets arvemasse Holbergsgade 6 DK-1057 København K Tel +45 7226

Læs mere

Deltagere i 3 km. løb

Deltagere i 3 km. løb Deltagere i km. løb 0 Jakob Thorgaard Balling 0 Spøttrup : :0:0 0::0 Wiliam Dalgaard Roslev 0 Roslev : :: 0:: 0 Sabrina Pedersen 0 Spøttrup : ::0 0::0 Inge Pedersen Rødding 0 Spøttrup : ::0 0::0 Sine Pedersen

Læs mere

DANSKE MÆNDS SÆDKVALITET - SER DET GODT ELLER SKIDT UD?

DANSKE MÆNDS SÆDKVALITET - SER DET GODT ELLER SKIDT UD? DANSKE MÆNDS SÆDKVALITET - SER DET GODT ELLER SKIDT UD? Niels Jørgensen, Ulla Joensen, Tina K. Jensen, Martin Jensen, Inge Olesen, Elisabeth Carlsen, Jørgen Holm Petersen, Niels E. Skakkebæk Afdeling for

Læs mere

PPV skemaer (udskriftsvenlig)

PPV skemaer (udskriftsvenlig) Introduktion til PPV-skema i almen praksis Et PPV(positiv prædiktiv værdi)-skema for en specifik kræftsygdom omhandler sandsynligheden for, at patienten har sygdommen, når patienten præsenterer symptomet

Læs mere

DDS Østjylland Vinterturnering 15 m 2008/2009 Standardpistol

DDS Østjylland Vinterturnering 15 m 2008/2009 Standardpistol DDS Østjylland Vinterturnering 15 m 2008/2009 Standardpistol Kl 1 1.rd. 2.rd. 3.rd. 4.rd. 5 rd. De 3 bedste Total 1 24801 Lars Gregersen 901 0 286 278 0 0 286 278 0 564 Kl. 2 1.rd. 2.rd. 3.rd. 4.rd. 5

Læs mere

NR - NAVN - BY - TID - ALD.-PRTAL-PLGRP. NR - NAVN - BY - TID - ALD.-PRTAL-PLGRP.

NR - NAVN - BY - TID - ALD.-PRTAL-PLGRP. NR - NAVN - BY - TID - ALD.-PRTAL-PLGRP. ENDELIG RESULTATLISTE FOR : HANSTHOLM LØBET 2002 RESULTATER - : 4.2 KM KVINDER 1901 NADIA KRONBORG THISTED 19.24 14 0.00 1 1954 CECILIA ALRØ MARDAL SNEDSTED 19.50 18 58.82 1 1963 DORTE SØRENSEN HANSTHOLM

Læs mere

SkytteNummer Navn KredsForeningNavn KlasseProgNavn KlasseNavn SnitDetteÅr AntalDetteÅr 14-55352 Verner Nielsen Ornebjerg Skytteforening Luftgevær,

SkytteNummer Navn KredsForeningNavn KlasseProgNavn KlasseNavn SnitDetteÅr AntalDetteÅr 14-55352 Verner Nielsen Ornebjerg Skytteforening Luftgevær, SkytteNummer Navn KredsForeningNavn KlasseProgNavn KlasseNavn SnitDetteÅr AntalDetteÅr 14-55352 Verner Nielsen Ornebjerg Skytteforening Luftgevær, 15m 1 190,20 5 14-54048 Thomas Jensen Frejlev-Vantore

Læs mere

Kære Kirsten, Poul-Erik og Tina. Vi vil gerne sige mange tak for opmærksomheden ved vores bryllup lørdag d. 16. august 2008.

Kære Kirsten, Poul-Erik og Tina. Vi vil gerne sige mange tak for opmærksomheden ved vores bryllup lørdag d. 16. august 2008. Kære Kirsten, Poul-Erik og Tina Kære Lene, Jan og Mads Kære Helle, Per og Aya Kære Kim Kære Edith og Aage Kære Gitte, Benny, Lasse og Alex Kære Lene, Henrik, Thomas og Louise Kære Sonja, Lars, Mette

Læs mere

Resultater Fynske Mesterskaber 2015

Resultater Fynske Mesterskaber 2015 Resultater Fynske Mesterskaber 2015 Løb 99 Åben Mænd 6000m 1. Afdeling 2015 02 28 11:30 Plac. # Navn m m m m m 1 2 Middelfart Roklub I Søren Madsen(1) 0:00.0 (0:00.0 T0) 0:00.0 (0:00.0 T0) 0:00.0 (0:00.0

Læs mere

Bemandingsplan for Hylke sommerfest 11.-19.juni 2010

Bemandingsplan for Hylke sommerfest 11.-19.juni 2010 Bemandingsplan for Hylke sommerfest 11.-19.juni 2010 Kære Hylkeborger Her er bemandingsplanen for Hylke sommerfest. Kig venligst planen igennem og se om dit navn optræder. Hvis du er forhindret i at hjælpe,

Læs mere

Fordeling af timer i Emdruphallen 2005/06

Fordeling af timer i Emdruphallen 2005/06 Fordeling af timer i Emdruphallen 2005/06 Medl.nr Navn Tlf. Mail Tildel tid Rasmus Bie Olsen Mandage kl. 7-8 7690 Christian Ohm 6073 Peter Thyregod 4587 4528 pthy@novozymes.com Mandage kl. 8-9 6630 Bo

Læs mere

Stilling score point Aalborg Ok : Aarhus 1900 Orientering : Mariager Fjord Ok : Viborg Ok :

Stilling score point Aalborg Ok : Aarhus 1900 Orientering : Mariager Fjord Ok : Viborg Ok : Matcher ------- 1 : Mariager Fjord Ok - Aarhus 1900 Orientering : 76-114 2 : Mariager Fjord Ok - Aalborg Ok : 67-118 3 : Mariager Fjord Ok - Viborg Ok : 82-62 4 : Aarhus 1900 Orientering - Aalborg Ok :

Læs mere

RESULTATLISTE Holstebro stævne 2014

RESULTATLISTE Holstebro stævne 2014 16-03-2014 14:43:29 - DDS SP v.3.14.2.3 RESULTATLISTE Holstebro stævne 2014 Gevær, 15m. - Mesterskab BK1 1 98883 Lars Andersen 03-010 Videbæk Skytteforening 200/09 199/09 399/18 2 108893 Mads Christensen

Læs mere

Texel Får 81607-00080 11.03.93 39908-00529 127 119 109 107 120 104 94 113 106 50 K Flemming Ulrich 98838020 85393-00810 17.03.98 85393-00543 126 115 104 110 127 103 104 112 101 40 Mogens Ladefoged 75299192

Læs mere

Danmarkslunden Oversigtsplan maj 2012

Danmarkslunden Oversigtsplan maj 2012 N Danmarkslunden Oversigtsplan maj 2012 Se efterfølgende sider vedrørende personerne bag de forskellige træplantninger i område A-E. 136 135 134 99 130 133 E D 95 96 97 98 94 93 92 91 90 140 139 88 87

Læs mere