Det Medicinske Selskab i København. > Efterår 2014

Størrelse: px
Starte visningen fra side:

Download "Det Medicinske Selskab i København. > Efterår 2014"

Transkript

1 Det Medicinske Selskab i København > Efterår 2014

2 > Sæsonprogram for efterår 2014 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 23. september kl : Tirsdag den 7. oktober kl : Tirsdag den 18. november kl : Professor, overlæge Gitte Moos Knudsen, Neurocentret, Rigshospitalet Billeddannelse af hjernens molekyler og funktion er det klinisk anvendeligt? Professor Gunna Christiansen, Institut for Biomedicin, Aarhus Universitet Consumergenetics omet og Forbrugeren Debatmøde Professor Torsten Lauritzen, Institut for Folkesundhed Almen Medicin, Aarhus Universitet Screening for type 2 diabetes og risiko for hjertekarsygdom Enhedschef, professor, dr. med. Torben Jørgensen, Forskningscenter for Forebyggelse og Sundhed Systematisk eller opportunistisk screening for risiko for hjertekarsygdomme? 2

3 Tirsdag den 23. september 2014 kl Billeddannelse af hjernens molekyler og funktion er det klinisk anvendeligt? Professor, overlæge Gitte Moos Knudsen, Neurocentret, Rigshospitalet Billeddannende teknikker, såsom positronemissionstomografi (PET) kan sammen med nye radiosporstoffer afbilde fundamentale dele af hjernens neurotransmission, metabolisme og proteiner. Magnetisk resonans billeddannelse (MRI) har ligeledes gennem de senere år været under kraftig udvikling, således at man nu bl.a. kan visualisere hjernens netværk, ligesom man fortsætter med at kortlægge hjernens funktioner, når den arbejder. Foredraget vil gennemgå principperne for disse billeddannende metoder og giver en oversigt over, hvor langt man er nået med de forskningsmæssigt. Det vil også berøre de kliniske områder, hvor metoderne allerede i dag kan bidrage diagnostisk eller behandlingsmæssigt, f.eks. indenfor bevægelsesforstyrrelser, lægemiddeludvikling eller neurodegenerative sygdomme. 3

4 Tirsdag den 7. oktober 2014 kl Consumergenetics omet og Forbrugeren Professor Gunna Christiansen, Institut for Biomedicin, Aarhus Universitet For 99$ kan man købe en genom-undersøgelse direkte til forbrugeren fra firmaet 23andMe. Undersøgelsen er baseret på identifikation af variationer i arvemassen, de såkaldte single nucleotide polymorphisms (SNP) der findes ved ca. hver 200 baser i genomet. De fundne variationer er karakteristiske for den enkelte person, og korrelerer man variationerne med sundhedsoplysninger indsamlet fra den undersøgte og fra en stor mængde andre personer, vil man kunne beregne, om den undersøgte har en gennemsnitlig, en forhøjet eller en lavere risiko for at udvikle over 200 forskellige sygdomme og tilstande, en genetisk risikoprofil. SNP testen reproducerbar og data er præcise, men for multifaktorielle, komplekse sygdomme er risikovurderingen usikker. De komplekse etiske dilemmaer, der knytter sig til forbruger-genetik som paternalisme, ret til viden/ikke-viden, information og rådgivning samt konsekvenser for sundhedsvæsnet bliver diskuteret. Kromosom 2 GAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerAlaProPheSerPheLeuSer GAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerAlaProPheSerPheLeuSer Homozygot GAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerAlaProPheSerPheLeuSer GAAATCATCAAGCCTAGGTCATCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerSerProPheSerPheLeuSer Heterozygot SNP GAAATCATCAAGCCTAGGTCATCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerSerProPheSerPheLeuSer GAAATCATCAAGCCTAGGTCATCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerSerProPheSerPheLeuSer Homozygot SNP SNP på kromosom 2 Der zoomes ind på kromosom 2 (øverst), så en SNP illustreres. Hos homozygote ses G (grøn) på begge kopier af kromosom 2. Hos en heterozygot med SNP ses G (grøn) på det ene kromosom 2 og T (rød) på det andet. Hos personer med dobbelt SNP ses T (rød) på begge kromosom 2. 4

5 Tirsdag den 18. november 2014 kl Debatmøde Screening for type 2 diabetes og risiko for hjertekarsygdom Professor Torsten Lauritzen, Institut for Folkesundhed Almen Medicin, Aarhus Universitet I 2012 konkluderede et Cochrane review, at helbredstjek ikke reducerede sygelighed eller dødelighed. De inkluderede studier var alle fra før 1992, og kun få er udført i almen praksis. Almen praksis synes at have bedre betingelser end andre institutioner for at finde patienter med ikke-erkendt sygdom eller risiko for sygdom. På mødet vil resultater fra helbredsundersøgelser i almen praksis blive fremlagt inklusiv nyeste resultater fra ADDITION studiet (Anglo-Dutch-Danish study of intentive treatment in people with screen detected diabetes in primary care). På basis af de hidtidige erfaringer opfordres praktiserende læger til at iværksætte tidlig opsporing af diabetes og risiko for hjerte-kar-sygdom blandt egne patienter, f.eks. via opportunistisk screening, som tager udgangspunkt i en højrisikostrategi. Tirsdag den 18. november 2014 kl Systematisk eller opportunistisk screening for risiko for hjertekarsygdomme? Enhedschef, professor, dr. med. Torben Jørgensen, Forskningscenter for Forebyggelse og Sundhed Så snart et helbredsproblem bliver massivt nok, rejses spørgsmålet, om man skal screene for tidlige tilfælde eller for risiko for det pågældende helbredsfænomen. Screening er et tveægget sværd, idet det kan føre til sygeliggørelse og overbehandling uden samtidig at have effekt på de sygdomme, man ønsker at forebygge. Derfor har 5

6 6 WHO opstillet nogle meget skarpe krav, inden en systematisk screening indføres. Et af kravene omhandler, at der skal være en effekt på incidensen og dødeligheden af den pågældende sygdom. Screening for risiko for hjertekarsygdom har været gennemført siden 60 erne. Tidligere undersøgelser har konkluderet, at en screening ikke har effekt på udviklingen af hjertekarsygdom, men disse undersøgelser har været kritiseret for metodesvagheder. Inter99 er den seneste af disse undersøgelser, og det netop publicerede resultat viser som tidligere undersøgelser ingen effekt. Inter99 studiet viste, at en mulig grund til den manglende effekt var, at man ikke fik fat i de personer med størst behov for intervention. En anden forklaring kunne være, at det er svært at holde fast i en livsstil, som er anderledes end det, strukturen i samfundet byder befolkningen. Havde strukturen i samfundet vist vejen for rimelig sund levevis, ville de generelle sundhedsråd formentlig være tilstrækkelige folk er ikke dumme. På trods af den massive evidens for at et generelt helbredstjek ikke virker, er der fortsat læger som støtter tanken. Måske fordi det virker intuitivt rigtigt på trods af al evidens.

7 > bestyrelsen Præsident, klinikchef, overlæge Ida Hageman Psykiatrisk Center København Vicepræsident, centerleder, professor, overlæge, dr.med. Gunhild Waldemar Nationalt Center for Demens, Rigshospitalet Vicedirektør Torben Mogensen Hvidore Hospital Enhedschef, overlæge Anne Mette Dons Tilsyn & Patientsikkerhed Sundhedsstyrelsen Enhedschef, professor, dr.med. Torben Jørgensen Forskningscenter for Forebyggelse og Sundhed Læge, ph.d. Jakob Burcharth Kirurgisk Gastroenterologisk afdeling D, Herlev Hospital Speciallæge Ida-Marie Stender Hudklinikken på Jægersborg Allé Speciallæge Christian Freitag Holte Lægehus Professor, overlæge, dr. med Niels Kroman Brystkirurgisk Klinik, Rigshospitalet Klinikchef, overlæge Karen Vitting Andersen Pædiatrisk Klinik, Rigshospitalet Professor, overlæge, dr. med. Jens Peter Bonde Arbejds- og Miljømedicinsk afdeling, Bispebjerg Hospital Alment praktiserende læge Merete Sass Sørensen København Læge, ph.d. Signe Westring Worm Epidemiklinikken, Rigshospitalet Professor, overlæge, dr. med. Anja Pinborg Gynækologisk/ obstetrisk afdeling, Hvidovre Hospital 7

8 Læs mere om Det Medicinske Selskab i København på Ændringer i programmet kan forekomme og vil blive meddelt via selskabets hjemmeside og fælles til medlemmerne. Sekretær Bitten Dahlstrøm træffes på telefon Vi glæder os til at se jer til en ny og spændende sæson i selskabet. Med venlig hilsen Ida Hageman præsident Gunhild Waldemar vicepræsident 8

Det Medicinske Selskab i København. > Efterår 2015

Det Medicinske Selskab i København. > Efterår 2015 Det Medicinske Selskab i København > Efterår 2015 > Sæsonprogram for efterår 2015 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 22. september kl. 20.00: Tirsdag den 6. oktober kl. 20.00:

Læs mere

Det Medicinske Selskab i København. > Forår 2015

Det Medicinske Selskab i København. > Forår 2015 Det Medicinske Selskab i København > Forår 2015 > Sæsonprogram for forår 2015 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 3. februar kl. 20.00: Tirsdag den 3. marts kl. 20.00: Tirsdag

Læs mere

Det Medicinske Selskab i København. > Efterår 2010

Det Medicinske Selskab i København. > Efterår 2010 Det Medicinske Selskab i København > Efterår 2010 > Sæsonplan for efterår 2010 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 5. oktober Kl. 20.00 Alm. prakt. læge Mikkel Vass Tænk dig

Læs mere

PROGRAM Konference om kronisk sygdom med fokus på lighed i sundhed. Den 18. marts 2015 Kl. 9.00-16.00 DGI-Byen, København

PROGRAM Konference om kronisk sygdom med fokus på lighed i sundhed. Den 18. marts 2015 Kl. 9.00-16.00 DGI-Byen, København PROGRAM Konference om kronisk sygdom med fokus på lighed i sundhed Den 18. marts 2015 Kl. 9.00-16.00 DGI-Byen, København PROGRAM Kl. 8.15-9.00 Registrering og morgenmad Kl. 9.00-9.15 Velkomst v. Sophie

Læs mere

Det Medicinske Selskab i København. > Forår 2011

Det Medicinske Selskab i København. > Forår 2011 Det Medicinske Selskab i København > Forår 2011 > Sæsonplan for forår 2011 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 8. februar Tirsdag den 8. marts Kl. 21.00 Tirsdag den 29. marts

Læs mere

40. årsmøde i Dansk Karkirurgisk Selskab 6. 7. november 2009. Schæffergården København

40. årsmøde i Dansk Karkirurgisk Selskab 6. 7. november 2009. Schæffergården København 40. årsmøde i Dansk Karkirurgisk Selskab 6. 7. november 2009 Schæffergården København Program fredag 6. november 2009 E kursus: Tilbyder vi den bedste behandling til vore patienter? 9.00 9.15 Ankomst,

Læs mere

Amadeus Speciallægecenter ET SUNDT LIV - for dig eller din virksomhed

Amadeus Speciallægecenter ET SUNDT LIV - for dig eller din virksomhed Amadeus Speciallægecenter ET SUNDT LIV - for dig eller din virksomhed 0808_AMADEUS_brochure1.indd 1 9/16/08 10:55:13 AM Amadeus Speciallægecenter Amadeus er et speciallægecenter, som hjælper dig eller

Læs mere

EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER

EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER Zell am See. 14. marts 2015 Hotel Alpenblick KURSUSLEDELSE Sven Søren Larsen Flemming Burcharth Claus Perrild FORORD Efteruddannelseskursus for praktiserende

Læs mere

EFTERUDDANNELSESKURSUS

EFTERUDDANNELSESKURSUS EFTERUDDANNELSESKURSUS Zell am See 9. 16. marts 2013 Hotel Alpenblick KURSUSLEDELSE Flemming Burcharth FORORD Efteruddannelseskursus for praktiserende læger i marts måned på et skisportssted med tilhørende

Læs mere

Retningslinjer for visitation og henvisning på fedmeområdet udsendes til relevante parter

Retningslinjer for visitation og henvisning på fedmeområdet udsendes til relevante parter 17-12-2010 Retningslinjer for visitation og henvisning på fedmeområdet udsendes til relevante parter Indenrigs- og Sundhedsministeriet og Danske Regioner har konstateret en markant stigning i antallet

Læs mere

Fremtidens velfærdsløsninger. Aldring. Aldring. Antal ældre. Forebyggelse frem for pleje forbliv aktiv og selvhjulpen. Vi fødes som kopier

Fremtidens velfærdsløsninger. Aldring. Aldring. Antal ældre. Forebyggelse frem for pleje forbliv aktiv og selvhjulpen. Vi fødes som kopier Fremtidens velfærdsløsninger Forebyggelse frem for pleje forbliv aktiv og selvhjulpen 1. november 2011 Vi fødes som kopier Carsten Hendriksen Overlæge, lektor, dr. med. Bispebjerg Hospital og Center for

Læs mere

Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING

Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING 2012 Årsrapport 2011: Second opinion ordningen og eksperimentel kræftbehandling Sundhedsstyrelsen Axel Heides Gade 1 2300 København

Læs mere

Annonceopslag - Almen medicin

Annonceopslag - Almen medicin Annonceopslag - Almen medicin 26 hoveduddannelsesforløb i Almen medicin opslås ledige til besættelse 1. halvår 2016 Hovedstaden i Videreuddannelsesregion Øst Almen medicin, som er det største lægelige

Læs mere

Diagnostiske centre i Danmark - Behovet set fra almen praksis

Diagnostiske centre i Danmark - Behovet set fra almen praksis Diagnostiske centre i Danmark - Behovet set fra almen praksis Mads Lind Ingeman & Peter Vedsted Mads Lind Ingeman Speciallæge i Almen Medicin, Ph.D.-studerende Center for Cancerdiagnostik i Praksis CaP

Læs mere

Kan pakkeforløb og pakker forbedre patientforløbet? Peter Treufeldt, Vicedirektør Region Hovedstadens Psykiatri

Kan pakkeforløb og pakker forbedre patientforløbet? Peter Treufeldt, Vicedirektør Region Hovedstadens Psykiatri Kan pakkeforløb og pakker forbedre patientforløbet? Peter Treufeldt, Vicedirektør Region Hovedstadens Psykiatri Fælles regionale pakkeforløb i psykiatrien Danske Regioner fremlagde i 2011 en strategi for

Læs mere

Fup og fakta om Antidepressiv medicin Lars Vedel Kessing, professor, speciallæge i psykiatri, Psykiatrisk Center København

Fup og fakta om Antidepressiv medicin Lars Vedel Kessing, professor, speciallæge i psykiatri, Psykiatrisk Center København Fup og fakta om Antidepressiv medicin Lars Vedel Kessing, professor, speciallæge i psykiatri, Psykiatrisk Center København Mediebomber om depression Læger overdiagnosticerer og overbehandler depression!

Læs mere

Alzheimers sygdom - hvad sker der i hjernen og hvornår starter sygdommen?

Alzheimers sygdom - hvad sker der i hjernen og hvornår starter sygdommen? Nationalt Videnscenter for Demens Alzheimers sygdom - hvad sker der i hjernen og hvornår starter sygdommen? Steen G. Hasselbalch, professor, overlæge, dr.med. Nationalt Videnscenter for Demens, Neurologisk

Læs mere

FORMÅL OG VEDTÆGTER FOR ØSTERBROUNDERSØGELSEN THE COPENHAGEN CITY HEART STUDY

FORMÅL OG VEDTÆGTER FOR ØSTERBROUNDERSØGELSEN THE COPENHAGEN CITY HEART STUDY FORMÅL OG VEDTÆGTER FOR ØSTERBROUNDERSØGELSEN THE COPENHAGEN CITY HEART STUDY 1. Østerbroundersøgelsen er oprettet som en selvstændig forskningsenhed. Stk. 2. Østerbroundersøgelsen drives hovedsagelig

Læs mere

Høring vedrørende Sundhedsstyrelsens Anbefalinger for sundhedspersonalets

Høring vedrørende Sundhedsstyrelsens Anbefalinger for sundhedspersonalets Til adressaterne på den vedlagte liste over høringsparter j.nr. 7-203-02-516/6/CIU Høring vedrørende s Anbefalinger for sundhedspersonalets møde med pårørende til alvorligt syge Hermed udsender Anbefalinger

Læs mere

Efteruddannelseskursus 2014

Efteruddannelseskursus 2014 Dansk Selskab for Otolaryngologi, Hoved- og Halskirurgi s Efteruddannelseskursus 2014 Fredag d. 29/8 og lørdag d. 30/8 Hotel Koldingfjord, Kolding Sidste tilmeldingsfrist d. 1. juni 2014 Kære medlemmer!

Læs mere

INFORMATIONSMØDE D. 24. NOVEMBER 2010. kl. 16.00 18.00 VELKOMMEN

INFORMATIONSMØDE D. 24. NOVEMBER 2010. kl. 16.00 18.00 VELKOMMEN INFORMATIONSMØDE D. 24. NOVEMBER 2010 kl. 16.00 18.00 VELKOMMEN 1 Videncentret i TV2-Nyhederne mandag d. 26.10.2010 2 Program Velkomst v/ forskningsleder Sine Skovbjerg 16.05-16.15: Status for Videncentret

Læs mere

! " "#! $% &!' ( ) & " & & #'& ') & **" ') '& & * '& # & * * " &* ') * " & # & "* *" & # & " * & # & " * * * * $,"-. ",.!"* *

!  #! $% &!' ( ) &  & & #'& ') & ** ') '& & * '& # & * *  &* ') *  & # & * * & # &  * & # &  * * * * $,-. ,.!* * ! " "#! $% &! ( ) & " & & #& ) & **" ) & & * & # & * * " &* ) * " & # & "* *" & # & " ** *"&* + " * * & # & " * * * * $,"-. ",.!"* * ** * + & & # & * & & ) &"" " & /& "* * ** & *0) & # )#112.#11111#1#3*

Læs mere

Det bliver lettere at se forskel på syge og raske gener i Danmark

Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at se forskel på syge og raske gener i Danmark Det bliver lettere at diagnosticere genetisk betingede sygdomme i Danmark, efter at forskere har nået første milepæl i kortlægningen af

Læs mere

Visionsplan 2020 for dansk nefrologi

Visionsplan 2020 for dansk nefrologi Visionsplan 2020 for dansk nefrologi Kronisk nyresygdom For højt blodtryk Akut nyresvigt Autoimmune nyresygdomme Transplantation Dialyse Medicinsk behandling og lindring af nyresvigt Medfødte og arvelige

Læs mere

Forebyggelse, formidling og forskning - vidt og bredt

Forebyggelse, formidling og forskning - vidt og bredt Forebyggelse, formidling og forskning - vidt og bredt Forebyggelse de overordnede linjer De overordnede linjer varetages af Torben Jørgensen, fra Forskningscenter for forebyggelse og sundhed og Lene Sillasen,

Læs mere

Center for kliniske retningslinjer

Center for kliniske retningslinjer Center for kliniske retningslinjer - Nationalt Clearinghouse for sygeplejefaglige kliniske retningslinjer 2004: Etablere godkendelsesråd 2005: Vi vil have et Clearing house. Mål: Oktober 2007 2008 Dansk

Læs mere

Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale.

Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale. Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale. Ulrik Becker København 010414 ulbe@si-folkesundhed.dk Danskerne synes følgende er ok:

Læs mere

Foreløbig redegørelse om medicinforbrug på Psykiatrisk Center Glostrup

Foreløbig redegørelse om medicinforbrug på Psykiatrisk Center Glostrup Koncern Plan og Udvikling Enhed for Hospitals- og Psykiatriplanlægning Kongens Vænge 2 3400 Hillerød Til regionsrådet Opgang Blok B Telefon 48 20 50 00 Direkte 38 66 60 39 Web www.regionh.dk Journal nr.:

Læs mere

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt.

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt. Deltagerinformation Projekttitel: DD2 - Dansk center for strategisk forskning i type 2 diabetes Godkendt af Den Videnskabsetiske Komité for Region Syddanmark, journal nr. S-201000082. Søger personer med

Læs mere

Hvor meget kan en øget indsats flytte? COHERE Steen Rank Petersen, Chefkonsulent

Hvor meget kan en øget indsats flytte? COHERE Steen Rank Petersen, Chefkonsulent Hvor meget kan en øget indsats flytte? COHERE Steen Rank Petersen, Chefkonsulent Baggrund Større andel af ældre borgere i befolkningen, flere med kronisk sygdom Færre i den arbejdsdygtige alder Økonomisk

Læs mere

BEHANDLINGS- VEJLEDNING VED SOCIAL FOBI I COLLABRI

BEHANDLINGS- VEJLEDNING VED SOCIAL FOBI I COLLABRI BEHANDLINGS- VEJLEDNING VED SOCIAL FOBI I COLLABRI Behandlingsvejledning ved depression i Collabri Denne behandlingsvejledning vedr. social fobi i Collabri er udarbejdet med baggrund i Sundhedsstyrelsens

Læs mere

Pakkeforløb for på hjertesygdomme. hjerteområdet. Undersøgelser og behandling ved begrundet mistanke om. hjerteklapsygdom

Pakkeforløb for på hjertesygdomme. hjerteområdet. Undersøgelser og behandling ved begrundet mistanke om. hjerteklapsygdom Pakkeforløb for på hjertesygdomme hjerteområdet Undersøgelser og behandling ved begrundet mistanke om hjerteklapsygdom Pakkeforløb - I denne pjece findes en generel og kort beskrivelse af, hvad et pakkeforløb

Læs mere

Sundhed i fællesskab SF i Region Hovedstadens valgprogram om sundhed 2010 2013

Sundhed i fællesskab SF i Region Hovedstadens valgprogram om sundhed 2010 2013 Sundhed i fællesskab SF i Region Hovedstadens valgprogram om sundhed 2010 2013 Et styrket sundhedsvæsen for os alle SF ønsker et styrket sundhedsvæsen for alle borgere. Det kræver ressourcer og nye måder

Læs mere

Indstilling fra Det Landsdækkende Uddannelsesudvalg i specialet klinisk genetik

Indstilling fra Det Landsdækkende Uddannelsesudvalg i specialet klinisk genetik Den Lægelige Videreuddannelse Region Syd Sekretariatet 13. april 2004 J.nr.2-03-00132-2003 EKJ Indstilling fra Det Landsdækkende Uddannelsesudvalg i specialet klinisk genetik Indledning Klinisk genetik

Læs mere

Foreløbige afbud: Økonomi- og planlægningsafdelingen. Planlægningsenheden. Glostrup Hospital Nordre Ringvej 57 2600 Glostrup

Foreløbige afbud: Økonomi- og planlægningsafdelingen. Planlægningsenheden. Glostrup Hospital Nordre Ringvej 57 2600 Glostrup Økonomi- og planlægningsafdelingen Planlægningsenheden Glostrup Hospital Nordre Ringvej 57 2600 Glostrup Møde i: Sundhedsfagligt Råd, Klinisk Biokemi Dato: 26. august 2014 Kl.: 14.00-16.00 Sted: Glostrup

Læs mere

ARVELIG TARMKRÆFT OG GENTESTNING v/ Inge Bernstein, MD, Ph.d. - HNPCC-registret, Gastroenheden, Hvidovre Hospital. Hvordan tæmmer man tarmen?

ARVELIG TARMKRÆFT OG GENTESTNING v/ Inge Bernstein, MD, Ph.d. - HNPCC-registret, Gastroenheden, Hvidovre Hospital. Hvordan tæmmer man tarmen? DEN 25. MARTS 2009 - FRA KL. 18.30 21.00 I SUNDHEDSCENTRET FOR KRÆFTRAMTE ARVELIG TARMKRÆFT OG GENTESTNING v/ Inge Bernstein, MD, Ph.d. - HNPCC-registret, Gastroenheden, Hvidovre Hospital Til den yngre

Læs mere

Vedr.: 1. Referat af generalforsamlingen, den 28.marts 2007. 2. Fremtidig kommunikation til Selskabets medlemmer via e-mail, -

Vedr.: 1. Referat af generalforsamlingen, den 28.marts 2007. 2. Fremtidig kommunikation til Selskabets medlemmer via e-mail, - DANSK SELSKAB FOR MEDICINSK MAGNETISK RESONANS Nyhedsbrev Dato: August 2007 Vedr.: 1. Referat af generalforsamlingen, den 28.marts 2007. 2. Fremtidig kommunikation til Selskabets medlemmer via e-mail,

Læs mere

10.28-10.37 www.plastikinstruksen.dk 1. reservelæge Pavia Lumholt På vegne af Afdeling for Plastikkirurgi og Brandsårsbehandling

10.28-10.37 www.plastikinstruksen.dk 1. reservelæge Pavia Lumholt På vegne af Afdeling for Plastikkirurgi og Brandsårsbehandling 10.10-12.00 Frie foredrag Chair: Peter A. Siemssen 10.10-10.19 En prospektivt konsekutiv sammenligning af to kendte regimer til behandling af delhudstransplantation på crus Marie von Sperling Reservelæge,

Læs mere

Video som patientbeslutningsstøtte

Video som patientbeslutningsstøtte Video som patientbeslutningsstøtte Hvad betyder det for patienten, og hvilken effekt har video på patientens valg af behandling? Rapport over et studie gennemført i samarbejde mellem Ortopædkirurgisk Afdeling,,

Læs mere

Status for DPCG & DPCD 2013

Status for DPCG & DPCD 2013 ØVRE GASTROINTESTINAL CANCER SEMINAR Status for DPCG & DPCD 2013 Styregruppe Repræsentanter fra behandlende afdelinger i DK (Dansk Kirurgisk Selskab)(DKS) (Dansk Selskab for Klinisk Onkologi)(DSKO) (Dansk

Læs mere

Sundt Samarbejde: Sådan sender vi pressemeddelelser ud

Sundt Samarbejde: Sådan sender vi pressemeddelelser ud Sundt Samarbejde: Sådan sender vi pressemeddelelser ud I Sundt Samarbejde er princippet co-branding. Det betyder, at både Aarhus Universitet og Region Midtjylland fremstår som tydelige afsendere. For at

Læs mere

Alternativ behandling dialogen mellem læge og patient

Alternativ behandling dialogen mellem læge og patient ALTERNATIV BEHANDLING 775 Alternativ behandling dialogen mellem læge og patient Anette I.S. Ranneries & Bo Christensen I den forrige artikel i denne serie blev de nyeste Cochrane-oversigter om effekten

Læs mere

MÆND SUNDHEDSPOLITIK I DANMARK FORSLAG TIL GRUNDLAG FOR EN FORSLAG OM, AT DANMARK FÅR EN SUNDHEDSPOLITIK FOR MÆND

MÆND SUNDHEDSPOLITIK I DANMARK FORSLAG TIL GRUNDLAG FOR EN FORSLAG OM, AT DANMARK FÅR EN SUNDHEDSPOLITIK FOR MÆND FORSLAG TIL GRUNDLAG FOR EN SUNDHEDSPOLITIK FOR MÆND I DANMARK FREMSÆTTES I FORBINDELSE MED MEN S HEALTH WEEK 2011 TIL POLITIKERE OG ANDRE BESLUTNINGSTAGERE I SUNDHEDSVÆSNET - OG TIL BEFOLKNINGEN FORSLAG

Læs mere

Nordisk konference 2013

Nordisk konference 2013 Nordisk konference 2013 Evidensbaseret behandling af børneog ungdomspsykiatriske lidelser Hjørnesten og implementering 12. og 13. juni 2013 Aalborg AALBORG UNIVERSITETSHOSPITAL - PSYKIATRIEN VELKOMMEN

Læs mere

Det Nationale Indikatorprojekt. Dansk Lunge Cancer Register

Det Nationale Indikatorprojekt. Dansk Lunge Cancer Register Det Nationale Indikatorprojekt og Dansk Lunge Cancer Register Rapport over udvalgte indikatorer: 1. KVARTAL 2011 Data opdateret af DLCR sekretariatet: 27. april 2011 Rapport udarbejdet for DLCR af: Anders

Læs mere

Ledelsesregulativ for Region Hovedstaden

Ledelsesregulativ for Region Hovedstaden Ledelsesregulativ for Region Hovedstaden 20. marts 2015 1. INDLEDNING... 3 2. OVERORDNET ADMINISTRATIV ORGANISERING... 4 2.1 Koncerndirektion... 4 2.2 Koncerncentre... 5 2.3 Hospitaler... 6 2.3.1 Hospitalsdirektioner...

Læs mere

Projekt FearFighter Kim Mathiasen Cand. Psych. Klinik for OCD og Angstlidelser Aarhus Universitetshospital

Projekt FearFighter Kim Mathiasen Cand. Psych. Klinik for OCD og Angstlidelser Aarhus Universitetshospital Projekt FearFighter Kim Mathiasen Cand. Psych. Aarhus Universitetshospital Definition of ccbt... any computerized information technology that uses patient input to make at least some psychotherapy decisions

Læs mere

Undersøgelse af arvelige faktorer ved autisme

Undersøgelse af arvelige faktorer ved autisme Undersøgelse af arvelige faktorer ved autisme Nyhedsbrev nr. 3, februar 2006 Introduktion Det er med glæde, at vi her kan præsentere vores tredje nyhedsbrev til alle familierne, som deltager i projektet

Læs mere

Academy for sygeplejersker

Academy for sygeplejersker Academy for sygeplejersker 5.-6. september 2013 Trinity Hotel & Konference Center Middelfart/Fredericia TEMA Co-morbiditet, behandlingssvigt/-risici og fremtidig patientmonitorering Invitation Det er os

Læs mere

Status for alkoholbehandlingen i Danmark

Status for alkoholbehandlingen i Danmark Status for alkoholbehandlingen i Danmark Dansk Selskab for Addiktiv Medicin 120912 Ulrik Becker Adj. Professor, Statens Institut for Folkesundhed, SDU Overlæge, dr.med. Gastroenheden, Hvidovre Hospital

Læs mere

Velkommen som social- og sundhedsassistent elev på Palliativ medicinsk afdeling. Bispebjerg Hospital.

Velkommen som social- og sundhedsassistent elev på Palliativ medicinsk afdeling. Bispebjerg Hospital. Velkommen som social- og sundhedsassistent elev på Palliativ medicinsk afdeling. Bispebjerg Hospital. Palliativ Medicinsk afdeling tilbyder lindrende behandling til uhelbredeligt syge kræftpatienter bosiddende

Læs mere

Hvordan påvirkes det fysiske aktivitetsniveau ved en højrisikostrategi? Resultater fra Inter99

Hvordan påvirkes det fysiske aktivitetsniveau ved en højrisikostrategi? Resultater fra Inter99 Hvordan påvirkes det fysiske aktivitetsniveau ved en højrisikostrategi? Resultater fra Inter99 Hjertekonference - om forskning i fysisk aktivitet og hjertesundhed Torsdag 28. oktober 2008, Store auditorium,

Læs mere

Implementering og effekt af kliniske retningslinjer

Implementering og effekt af kliniske retningslinjer Implementering og effekt af kliniske retningslinjer INGE MADSEN, MI. Ekstern lektor, Centeret for Kliniske Retningslinjer og lektor, VIA. SUND, Aarhus N. CENTERET FOR KLINISKE RETNINGSLINJER, Institut

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Træning øger cellulært genbrug Træning øger genbrug i museceller. Er det derfor, at motion er

Læs mere

PATIENTINDDRAGELSE PATIENTOPLEVELSER OG PATIENTSIKKERHED

PATIENTINDDRAGELSE PATIENTOPLEVELSER OG PATIENTSIKKERHED Academy for sygeplejersker Onsdag den 17. og torsdag den 18. juni 2015 PATIENTINDDRAGELSE PATIENTOPLEVELSER OG PATIENTSIKKERHED Invitation Det er os en glæde at invitere til Pfizer Academy 2015 for dermatologiske

Læs mere

Det geriatriske landkort

Det geriatriske landkort Nord Ålborg Overlæge Ole B.F. Nielsen Midt Århus Else Marie Damsgaard Randers Ubesat stilling Horsens Overlæge Ishay Barat sengeafdeling (16), ambulatorium, team Antal speciallæger: 3 2 sengeafsnit, udgående

Læs mere

Brandmænds risiko for kræft. Niels Ebbehøj Overlæge Arbejds- og miljømedicin, Bispebjerg Hospital. Informationsmøde januar 2013

Brandmænds risiko for kræft. Niels Ebbehøj Overlæge Arbejds- og miljømedicin, Bispebjerg Hospital. Informationsmøde januar 2013 Brandmænds risiko for kræft Niels Ebbehøj Overlæge Arbejds- og miljømedicin, Bispebjerg Hospital Informationsmøde januar 2013 Revision af et oplæg fra Jens Peter Bonde, december 2012 Disposition Kræftfremkaldende

Læs mere

Skema for indberetning af kontaktpersonordningen efter ny opgørelsesmetode

Skema for indberetning af kontaktpersonordningen efter ny opgørelsesmetode Skema for indberetning af kontaktpersonordningen efter ny opgørelsesmetode Region: Syddanmark Indlagte patienter Ambulante Andel af patienter med kontaktperson på 3. dagen Andel af patienter tildelt Andel

Læs mere

Befolkningens sundhed om 20 år? En fremskrivning med udgangspunkt i den aktuelle viden

Befolkningens sundhed om 20 år? En fremskrivning med udgangspunkt i den aktuelle viden Befolkningens sundhed om 20 år? En fremskrivning med udgangspunkt i den aktuelle viden Charlotte Glümer, professor, overlæge 1 Hvad kommer jeg ind på? Hvorfor er det svært at forudsige sygdomsmønsteret

Læs mere

Faglig konsulent: Mickey Gjerris, lektor i bioetik og medlem af Det Etiske Råd.

Faglig konsulent: Mickey Gjerris, lektor i bioetik og medlem af Det Etiske Råd. PLANLÆGNINGSGRUPPE Arne Ørtved, Grundtvigsk Forums Folkeoplysningsudvalg. Henrik Christensen, Dansk Friskoleforening. Ole Borgå, Efterskoleforeningen. Christian Schultz, Husholdnings- og Håndarbejdsskolerne.

Læs mere

BEHANDLINGS- VEJLEDNING VED PANIKANGST I COLLABRI

BEHANDLINGS- VEJLEDNING VED PANIKANGST I COLLABRI BEHANDLINGS- VEJLEDNING VED PANIKANGST I COLLABRI Behandlingsvejledning ved panikangst i Collabri Denne behandlingsvejledning vedr. panikangst i Collabri er udarbejdet med baggrund i Sundhedsstyrelsens

Læs mere

FAKTA OM LANDSSYGEHUSET

FAKTA OM LANDSSYGEHUSET FAKTA OM LANDSSYGEHUSET Mission Landssygehuset yder sundhedstjeneste på højt fagligt niveau. Vi skal udvikle og uddanne vores medarbejdere og understøtte forskning Vision Patienten er i centrum Medarbejderne

Læs mere

Nyt fra DID - Dansk Intensiv Database

Nyt fra DID - Dansk Intensiv Database Nyt fra DID - Dansk Intensiv Database Christian Fynbo Christiansen Læge, lektor, PhD Epidemiolog, Dansk Intensiv Database På vegne af styregruppen DID - styregruppen Ebbe Rønholm, speciallæge, Formand

Læs mere

Fælles konference om Overvægt - et fælles ansvar den 1. november 2011 i ToRVEhallerne i Vejle

Fælles konference om Overvægt - et fælles ansvar den 1. november 2011 i ToRVEhallerne i Vejle Fælles konference om Overvægt - et fælles ansvar den 1. november 2011 i ToRVEhallerne i Vejle Program for konferencen Overvægt et fælles ansvar Ordstyrer: cand. brom. Regitze Siggaard, partner i Aktivo

Læs mere

Udvalgte data på overvægt og svær overvægt

Udvalgte data på overvægt og svær overvægt Udvalgte data på overvægt og svær overvægt Den 20. januar 2010 Indhold Globalt... 3 Danmark... 7 Forekomsten af overvægt... 7 Hver femte dansker er for fed... 13 Samfundsøkonomiske konsekvenser af svær

Læs mere

Nordisk konference 2015 Psykiske problemer i ungdommen

Nordisk konference 2015 Psykiske problemer i ungdommen Nordisk konference 2015 Psykiske problemer i ungdommen Den 29. og 30. april 2015, Comwell Sport Rebild Bakker Psykiske problemer i ungdommen Velkommen Ungdommen er en af de mest dynamiske perioder i livet

Læs mere

Projektets konkrete mål er at nedbringe antallet af børn med iltmangel i forbindelse med fødslen med 50 procent.

Projektets konkrete mål er at nedbringe antallet af børn med iltmangel i forbindelse med fødslen med 50 procent. Sikre fødsler D. 30. august 2012 Om Sikre fødsler Sikre fødsler har som formål at opnå konsistent høj patientsikkerhed på alle landets fødeafdelinger, sådan at alle fødsler forløber sikkert. Projektets

Læs mere

Evaluering af den medicinske behandling i botilbud til sindslidende

Evaluering af den medicinske behandling i botilbud til sindslidende Evaluering af den medicinske behandling i botilbud til sindslidende Delrapport Resumé Regionshuset Århus Center for Kvalitetsudvikling Evaluering af den medicinske behandling i botilbud til sindslidende

Læs mere

Rationale, arbejdsmetode og erfaringer fra Bispebjerg Hospital. Redigeret af. Ann-Dorthe Zwisler Lone Schou Lotte Vind Sørensen

Rationale, arbejdsmetode og erfaringer fra Bispebjerg Hospital. Redigeret af. Ann-Dorthe Zwisler Lone Schou Lotte Vind Sørensen Rationale, arbejdsmetode og erfaringer fra Bispebjerg Hospital Redigeret af Ann-Dorthe Zwisler Lone Schou Lotte Vind Sørensen Rationale, arbejdsmetode og erfaringer fra Bispebjerg Hospital Redigeret af

Læs mere

Netværksforum Region Midt Forebyggende hjemmebesøg November 2012

Netværksforum Region Midt Forebyggende hjemmebesøg November 2012 Netværksforum Region Midt Forebyggende hjemmebesøg November 2012. Bente Høy, MPH, Ph.D. 1 Styregruppe Margit Andersen, Anne Marie Olsen, Karen Grøn, Lene Dørfler, Henning Jensen, Bente Høy Bente Høy, MPH,

Læs mere

Helkeramik og cementering med Jacob Slavensky.

Helkeramik og cementering med Jacob Slavensky. Kursus 1 Helkeramik og cementering med Jacob Slavensky. Vi har alle hørt om, hvor pæne restaureringer vi kan lave med helkeramik. Vi har også alle hørt om, hvor besværligt det er med præparation, aftrykstagning,

Læs mere

Mindfulness Meditation & Opmærksomhed

Mindfulness Meditation & Opmærksomhed Mindfulness Meditation & Opmærksomhed DELTAGERINFORMATION Projektets originaltitel: Mindfulness and Attention (MIA) Har du lyst til at deltage i en videnskabeligt forskningsprojekt? Projektets formål og

Læs mere

Forbedring af evidensbaseret behandling = ændring af evidens?

Forbedring af evidensbaseret behandling = ændring af evidens? Forbedring af evidensbaseret behandling = ændring af evidens? Almindelige psykiske lidelser som angst, depression, spiseforstyrrelser mv. har stor udbredelse. I Danmark og andre europæiske lande vurderes

Læs mere

EFTER- OG VIDERE- UDDANNELSE

EFTER- OG VIDERE- UDDANNELSE Overgangsalderen livsstil, levevilkår og livskvalitet en sund overgang eller en sygelig tilgang? SUNDHEDSFAGLIG DIPLOMUDDANNELSE/KOMPETENCEGIVENDE VIDEREUDDANNELSE MED SPECIALE I KLIMAKTERIET FOR SYGEPLEJERSKER

Læs mere

Analyse af henvisningsmønstret i almen praksis

Analyse af henvisningsmønstret i almen praksis Ny publikation fra Dansk Sundhedsinstitut: Analyse af henvisningsmønstret i almen praksis Delanalyse 2. En registerundersøgelse Sammenfatning Kim Rose Olsen Torben Højmark Sørensen Peter Vedsted Dorte

Læs mere

Undersøgelser og behandling ved begrundet mistanke om kræft i æggestokkene

Undersøgelser og behandling ved begrundet mistanke om kræft i æggestokkene Undersøgelser og behandling ved begrundet mistanke om kræft i æggestokkene PAKKEFORLØB Denne pjece indeholder en generel og kortfattet beskrivelse af, hvad et pakkeforløb for kræft er. Det er den sygehusafdeling,

Læs mere

Udvalgte udviklingstendenser i dansk retspsykiatri

Udvalgte udviklingstendenser i dansk retspsykiatri Sammenfatning af publikation fra : Udvalgte udviklingstendenser i dansk retspsykiatri Charlotte Bredahl Jacobsen Katrine Schepelern Johansen Januar 2011 Hele publikationen kan downloades gratis fra DSI

Læs mere

Lægeforeningen redegør i dette notat for emner, som regeringen bør inddrage i den nationale forebyggelsesplan.

Lægeforeningen redegør i dette notat for emner, som regeringen bør inddrage i den nationale forebyggelsesplan. Lægeforeningen Notat 26. juni 2009 Jr. 2009-3782/265277 PK Emne: Til: Fra: En national forebyggelsesplan for hele befolkningen Ministeren for Sundhed og Forebyggelse Lægeforeningen Lægeforeningen redegør

Læs mere

Amadeus Speciallægerne HAR DU TJEK PÅ DIT HELBRED? - Helbredsundersøgelse for private og virksomheder

Amadeus Speciallægerne HAR DU TJEK PÅ DIT HELBRED? - Helbredsundersøgelse for private og virksomheder Amadeus Speciallægerne HAR DU TJEK PÅ DIT HELBRED? - Helbredsundersøgelse for private og virksomheder Helbredsundersøgelse Amadeus Speciallægerne er specialiseret i forebyggende helbredsundersøgelser og

Læs mere

Oversigt over workshops på årsmødet den 10. 11. januar 2014

Oversigt over workshops på årsmødet den 10. 11. januar 2014 Beskrivelse af workshops Oversigt over workshops på årsmødet den 10. 11. januar 2014 Mål med mening (3 timer) Er overlevelsen efter akut myokardieinfarkt forbedret? Har vi færre infektioner? Er vi blevet

Læs mere

Holstebro 24/3 2009. Turnuslæger, Holstebro 23/9 2008

Holstebro 24/3 2009. Turnuslæger, Holstebro 23/9 2008 Holstebro 24/3 2009 Karriereplanlægning Turnuslæger, Holstebro 23/9 2008 Karrierevejledning 4 i bekendtgørelse nr. 1248 af 24. oktober 2007 om speciallæger Regionerne i henhold til Sundhedsstyrelsens vejledning

Læs mere

En tablet daglig mod forhøjet risiko

En tablet daglig mod forhøjet risiko En tablet daglig mod forhøjet risiko Af: Dorte Glintborg, Institut for Rationel Farmakoterapi, Sundhedsstyrelsen. Der kommer flere og flere lægemidler på markedet, som ikke skal helbrede men forebygge

Læs mere

Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale.

Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale. Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale. Ulrik Becker Slagelse ulbe@si-folkesundhed.dk Sundhedsloven 141. Kommunalbestyrelsen tilbyder

Læs mere

Nyhedsbrev fra dchi. s. 6 kommende arrangementer. www.dchi.aau.dk

Nyhedsbrev fra dchi. s. 6 kommende arrangementer. www.dchi.aau.dk Nyhedsbrev fra dchi s. 2 Inflation i interessen for sundhedsøkonomi s. 3 workshop: Public health, healthcare evaluations and labor markets s. 4 DChi s ph.d projekter s. 5 DCHI medsponsor for minikonference

Læs mere

Hospitalsinfektioner - hvordan smittes man og hvorfor går det så ofte galt?

Hospitalsinfektioner - hvordan smittes man og hvorfor går det så ofte galt? HOSPITALS- HYGIEJNE 2014 Paneldebat - hvad har vi opnået de sidste 10 år og hvor skal de næste 10 år føre os hen? KONFERENCE DEN 26. og 27. februar 2014 - KØBENHAVN First Hotel Copenhagen Hør talere fra:

Læs mere

Infrarød Screening. med Total Vision anatomi software

Infrarød Screening. med Total Vision anatomi software Infrarød Screening med Total Vision anatomi software Infrarød Screening med Total Vision anatomi software Der er ubegrænsede muligheder med vores høje kvalitetsinfrarød screeningssystem. Energetic Health

Læs mere

Niels Høigaard Rasmussen - CURRICULUM VITAE

Niels Høigaard Rasmussen - CURRICULUM VITAE Niels Høigaard Rasmussen - CURRICULUM VITAE Uddannelse og ansættelser Uddannelse Januar 1990 November 2001 Medicinsk embedseksamen, Københavns Universitet. Specialist i anæstesiologi. Aktuel ansættelse

Læs mere

HERMES studiet (Herlev Hospital Empowerment of Relatives through More & Earlier Information Supply)

HERMES studiet (Herlev Hospital Empowerment of Relatives through More & Earlier Information Supply) Bispebjerg og Frederiksberg Hospitaler Bedre information til kræftpatienters pårørende baseret på systematisk afdækning af behov HERMES studiet (Herlev Hospital Empowerment of Relatives through More &

Læs mere

Visioner og strategier for sundhedsvidenskabelig forskning

Visioner og strategier for sundhedsvidenskabelig forskning Visioner og strategier for sundhedsvidenskabelig forskning - Det kræver faglig ledelse Oplæg ved Helen Bernt Andersen Sygeplejedirektør Rigshospitalet Fra projekt til program 27. November 2012 Rigshospitalet

Læs mere

Hornhindetransplantation

Hornhindetransplantation Af Kim Nielsen Teknisk chef, cand.scient. ph.d. Den Danske Hornhindebank Øjenafdelingen, Århus Sygehus FIGUR 1 Syg hornhinde Flere års ventetid på hornhindetransplantation Af Jesper Hjortdal Medicinsk

Læs mere

HJERTEREHABILITERING en medicinsk teknologivurdering

HJERTEREHABILITERING en medicinsk teknologivurdering HJERTEREHABILITERING en medicinsk teknologivurdering Evidens fra litteraturen og DANREHAB-forsøget 2006 Medicinsk Teknologivurdering puljeprojekter 2006; 6(10) Center for Evaluering og Medicinsk Teknologivurdering

Læs mere

CENTER FOR KLINISKE RETNINGSLINJER CLEARINGHOUSE

CENTER FOR KLINISKE RETNINGSLINJER CLEARINGHOUSE Kursus for bedømmere af kliniske retningslinjer ECTS: Kurset er postgraduat og ækvivalerer 5 ECTS point ved bestået eksamen. Der udstedes eksamensbevis. Formål: Kurset giver kompetence til at fungere som

Læs mere

Hvad ved vi om HC i Kina?

Hvad ved vi om HC i Kina? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Kinesisk Huntingtons Chorea-netværk lanceret Kinesisk HC-netværk er blevet lanceret. En god nyhed

Læs mere

ta ud Epilepsi 2011 Tirsdag d. 31. maj kl. 9.00 17.45 Radisson Blu H.C. Andersen Hotel Claus Bergs Gade 7 Odense

ta ud Epilepsi 2011 Tirsdag d. 31. maj kl. 9.00 17.45 Radisson Blu H.C. Andersen Hotel Claus Bergs Gade 7 Odense ta ud og gem Epilepsi konferencen 2011 Tirsdag d. 31. maj kl. 9.00 17.45 Radisson Blu H.C. Andersen Hotel Claus Bergs Gade 7 Odense Dansk Epilepsiforening inviterer til Epilepsikonferencen 2011 Tirsdag

Læs mere

Workshop om Obstetrisk telemedicin Historie og præsentahon. Olav Bjørn Petersen Overlæge, PhD, adj. Lektor Gynækologisk- Obstetrisk afd Y AUH Skejby

Workshop om Obstetrisk telemedicin Historie og præsentahon. Olav Bjørn Petersen Overlæge, PhD, adj. Lektor Gynækologisk- Obstetrisk afd Y AUH Skejby Workshop om Obstetrisk telemedicin Historie og præsentahon Olav Bjørn Petersen Overlæge, PhD, adj. Lektor Gynækologisk- Obstetrisk afd Y AUH Skejby Baggrund Baggrund 3 Hjemmemonitorering af gravide?:

Læs mere

Den udvidede profylakse mod rhesus D-immunisering af gravide i Danmark

Den udvidede profylakse mod rhesus D-immunisering af gravide i Danmark Den udvidede profylakse mod rhesus D-immunisering af gravide i Danmark Af Merete Berthu Damkjær, Anette Perslev og Finn Stener Jørgensen Biografi Merete Berthu Damkjær er cand.med. fra Københavns Universitet

Læs mere

Milepæle på kronikerområdet de seneste 10 år

Milepæle på kronikerområdet de seneste 10 år Milepæle på kronikerområdet de seneste 10 år Anne Frølich, overlæge, Forskningslederfor kroniske sygdomme, Bispebjerg hospital, Ekstern lektor, PhD, Københavns Universitet Anne.Froelich.01@regionh.dk Forekomsten

Læs mere

guide GENTEST DINE GENER AFSLØRER SYGDOM December 2014 Se flere guider på bt.dk/plus og b.dk/plus

guide GENTEST DINE GENER AFSLØRER SYGDOM December 2014 Se flere guider på bt.dk/plus og b.dk/plus guide December 2014 DINE GENER AFSLØRER SYGDOM Se flere guider på bt.dk/plus og b.dk/plus 2 INDHOLD SIDE 3 Vil du gerne vide, om du er i fare for f.eks. at udvikle tarmkræft eller tidlig demenssygdom?

Læs mere

Diabetes i Danmark. Diabetes i Danmark. Milepæle DANSK VOKSEN DIABETESDATABASE (DVDD) TVÆRSEKTORIEL SAMARBEJDE

Diabetes i Danmark. Diabetes i Danmark. Milepæle DANSK VOKSEN DIABETESDATABASE (DVDD) TVÆRSEKTORIEL SAMARBEJDE DANSK VOKSEN DIABETESDATABASE (DVDD) TVÆRSEKTORIEL SAMARBEJDE Formandskab: Peter Rossing, forskningsleder, overlæge dr.med. Steno Diabetes Center Helle Adolfsen, sygeplejefaglig direktør, cand.cur., E-MBA

Læs mere

GAMIAN-EUROPE S PANEUROPÆISKE SPØRGEUNDERSØGELSE OM FYSISK OG PSYKISK HELBRED

GAMIAN-EUROPE S PANEUROPÆISKE SPØRGEUNDERSØGELSE OM FYSISK OG PSYKISK HELBRED GAMIAN-EUROPE S PANEUROPÆISKE SPØRGEUNDERSØGELSE OM FYSISK OG PSYKISK HELBRED Vi vil gerne opfordre dig til at deltage i dette originale forskningsprojekt. Du skal kun deltage, hvis du selv har lyst, og

Læs mere