Det Medicinske Selskab i København. > Efterår 2014

Størrelse: px
Starte visningen fra side:

Download "Det Medicinske Selskab i København. > Efterår 2014"


1 Det Medicinske Selskab i København > Efterår 2014

2 > Sæsonprogram for efterår 2014 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 23. september kl : Tirsdag den 7. oktober kl : Tirsdag den 18. november kl : Professor, overlæge Gitte Moos Knudsen, Neurocentret, Rigshospitalet Billeddannelse af hjernens molekyler og funktion er det klinisk anvendeligt? Professor Gunna Christiansen, Institut for Biomedicin, Aarhus Universitet Consumergenetics omet og Forbrugeren Debatmøde Professor Torsten Lauritzen, Institut for Folkesundhed Almen Medicin, Aarhus Universitet Screening for type 2 diabetes og risiko for hjertekarsygdom Enhedschef, professor, dr. med. Torben Jørgensen, Forskningscenter for Forebyggelse og Sundhed Systematisk eller opportunistisk screening for risiko for hjertekarsygdomme? 2

3 Tirsdag den 23. september 2014 kl Billeddannelse af hjernens molekyler og funktion er det klinisk anvendeligt? Professor, overlæge Gitte Moos Knudsen, Neurocentret, Rigshospitalet Billeddannende teknikker, såsom positronemissionstomografi (PET) kan sammen med nye radiosporstoffer afbilde fundamentale dele af hjernens neurotransmission, metabolisme og proteiner. Magnetisk resonans billeddannelse (MRI) har ligeledes gennem de senere år været under kraftig udvikling, således at man nu bl.a. kan visualisere hjernens netværk, ligesom man fortsætter med at kortlægge hjernens funktioner, når den arbejder. Foredraget vil gennemgå principperne for disse billeddannende metoder og giver en oversigt over, hvor langt man er nået med de forskningsmæssigt. Det vil også berøre de kliniske områder, hvor metoderne allerede i dag kan bidrage diagnostisk eller behandlingsmæssigt, f.eks. indenfor bevægelsesforstyrrelser, lægemiddeludvikling eller neurodegenerative sygdomme. 3

4 Tirsdag den 7. oktober 2014 kl Consumergenetics omet og Forbrugeren Professor Gunna Christiansen, Institut for Biomedicin, Aarhus Universitet For 99$ kan man købe en genom-undersøgelse direkte til forbrugeren fra firmaet 23andMe. Undersøgelsen er baseret på identifikation af variationer i arvemassen, de såkaldte single nucleotide polymorphisms (SNP) der findes ved ca. hver 200 baser i genomet. De fundne variationer er karakteristiske for den enkelte person, og korrelerer man variationerne med sundhedsoplysninger indsamlet fra den undersøgte og fra en stor mængde andre personer, vil man kunne beregne, om den undersøgte har en gennemsnitlig, en forhøjet eller en lavere risiko for at udvikle over 200 forskellige sygdomme og tilstande, en genetisk risikoprofil. SNP testen reproducerbar og data er præcise, men for multifaktorielle, komplekse sygdomme er risikovurderingen usikker. De komplekse etiske dilemmaer, der knytter sig til forbruger-genetik som paternalisme, ret til viden/ikke-viden, information og rådgivning samt konsekvenser for sundhedsvæsnet bliver diskuteret. Kromosom 2 GAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerAlaProPheSerPheLeuSer GAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerAlaProPheSerPheLeuSer Homozygot GAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerAlaProPheSerPheLeuSer GAAATCATCAAGCCTAGGTCATCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerSerProPheSerPheLeuSer Heterozygot SNP GAAATCATCAAGCCTAGGTCATCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerSerProPheSerPheLeuSer GAAATCATCAAGCCTAGGTCATCACCTTTTAGCTTCCTGAGC GluIleIleLysProArgSerSerProPheSerPheLeuSer Homozygot SNP SNP på kromosom 2 Der zoomes ind på kromosom 2 (øverst), så en SNP illustreres. Hos homozygote ses G (grøn) på begge kopier af kromosom 2. Hos en heterozygot med SNP ses G (grøn) på det ene kromosom 2 og T (rød) på det andet. Hos personer med dobbelt SNP ses T (rød) på begge kromosom 2. 4

5 Tirsdag den 18. november 2014 kl Debatmøde Screening for type 2 diabetes og risiko for hjertekarsygdom Professor Torsten Lauritzen, Institut for Folkesundhed Almen Medicin, Aarhus Universitet I 2012 konkluderede et Cochrane review, at helbredstjek ikke reducerede sygelighed eller dødelighed. De inkluderede studier var alle fra før 1992, og kun få er udført i almen praksis. Almen praksis synes at have bedre betingelser end andre institutioner for at finde patienter med ikke-erkendt sygdom eller risiko for sygdom. På mødet vil resultater fra helbredsundersøgelser i almen praksis blive fremlagt inklusiv nyeste resultater fra ADDITION studiet (Anglo-Dutch-Danish study of intentive treatment in people with screen detected diabetes in primary care). På basis af de hidtidige erfaringer opfordres praktiserende læger til at iværksætte tidlig opsporing af diabetes og risiko for hjerte-kar-sygdom blandt egne patienter, f.eks. via opportunistisk screening, som tager udgangspunkt i en højrisikostrategi. Tirsdag den 18. november 2014 kl Systematisk eller opportunistisk screening for risiko for hjertekarsygdomme? Enhedschef, professor, dr. med. Torben Jørgensen, Forskningscenter for Forebyggelse og Sundhed Så snart et helbredsproblem bliver massivt nok, rejses spørgsmålet, om man skal screene for tidlige tilfælde eller for risiko for det pågældende helbredsfænomen. Screening er et tveægget sværd, idet det kan føre til sygeliggørelse og overbehandling uden samtidig at have effekt på de sygdomme, man ønsker at forebygge. Derfor har 5

6 6 WHO opstillet nogle meget skarpe krav, inden en systematisk screening indføres. Et af kravene omhandler, at der skal være en effekt på incidensen og dødeligheden af den pågældende sygdom. Screening for risiko for hjertekarsygdom har været gennemført siden 60 erne. Tidligere undersøgelser har konkluderet, at en screening ikke har effekt på udviklingen af hjertekarsygdom, men disse undersøgelser har været kritiseret for metodesvagheder. Inter99 er den seneste af disse undersøgelser, og det netop publicerede resultat viser som tidligere undersøgelser ingen effekt. Inter99 studiet viste, at en mulig grund til den manglende effekt var, at man ikke fik fat i de personer med størst behov for intervention. En anden forklaring kunne være, at det er svært at holde fast i en livsstil, som er anderledes end det, strukturen i samfundet byder befolkningen. Havde strukturen i samfundet vist vejen for rimelig sund levevis, ville de generelle sundhedsråd formentlig være tilstrækkelige folk er ikke dumme. På trods af den massive evidens for at et generelt helbredstjek ikke virker, er der fortsat læger som støtter tanken. Måske fordi det virker intuitivt rigtigt på trods af al evidens.

7 > bestyrelsen Præsident, klinikchef, overlæge Ida Hageman Psykiatrisk Center København Vicepræsident, centerleder, professor, overlæge, Gunhild Waldemar Nationalt Center for Demens, Rigshospitalet Vicedirektør Torben Mogensen Hvidore Hospital Enhedschef, overlæge Anne Mette Dons Tilsyn & Patientsikkerhed Sundhedsstyrelsen Enhedschef, professor, Torben Jørgensen Forskningscenter for Forebyggelse og Sundhed Læge, ph.d. Jakob Burcharth Kirurgisk Gastroenterologisk afdeling D, Herlev Hospital Speciallæge Ida-Marie Stender Hudklinikken på Jægersborg Allé Speciallæge Christian Freitag Holte Lægehus Professor, overlæge, dr. med Niels Kroman Brystkirurgisk Klinik, Rigshospitalet Klinikchef, overlæge Karen Vitting Andersen Pædiatrisk Klinik, Rigshospitalet Professor, overlæge, dr. med. Jens Peter Bonde Arbejds- og Miljømedicinsk afdeling, Bispebjerg Hospital Alment praktiserende læge Merete Sass Sørensen København Læge, ph.d. Signe Westring Worm Epidemiklinikken, Rigshospitalet Professor, overlæge, dr. med. Anja Pinborg Gynækologisk/ obstetrisk afdeling, Hvidovre Hospital 7

8 Læs mere om Det Medicinske Selskab i København på Ændringer i programmet kan forekomme og vil blive meddelt via selskabets hjemmeside og fælles til medlemmerne. Sekretær Bitten Dahlstrøm træffes på telefon Vi glæder os til at se jer til en ny og spændende sæson i selskabet. Med venlig hilsen Ida Hageman præsident Gunhild Waldemar vicepræsident 8

Det Medicinske Selskab i København. > Efterår 2015

Det Medicinske Selskab i København. > Efterår 2015 Det Medicinske Selskab i København > Efterår 2015 > Sæsonprogram for efterår 2015 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 22. september kl. 20.00: Tirsdag den 6. oktober kl. 20.00:

Læs mere

Det Medicinske Selskab i København. > Efterår 2016

Det Medicinske Selskab i København. > Efterår 2016 Det Medicinske Selskab i København > Efterår 2016 > SÆSONPROGRAM for efterår 2016 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 20. september kl. 20.00: Ole Johannes Hartling, ledende

Læs mere

Det Medicinske Selskab i København. > Efterår 2012

Det Medicinske Selskab i København. > Efterår 2012 Det Medicinske Selskab i København > Efterår 2012 > Sæsonplan for efterår 2012 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 25. september Kl. 20.00 Astrid Krag, Ministeriet for Sundhed

Læs mere

Det Medicinske Selskab i København. > Forår 2015

Det Medicinske Selskab i København. > Forår 2015 Det Medicinske Selskab i København > Forår 2015 > Sæsonprogram for forår 2015 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 3. februar kl. 20.00: Tirsdag den 3. marts kl. 20.00: Tirsdag

Læs mere

Det Medicinske Selskab i København. > Efterår 2013

Det Medicinske Selskab i København. > Efterår 2013 Det Medicinske Selskab i København > Efterår 2013 > Sæsonplan for efterår 2013 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 24. september kl 20.00 Professor Allan Krasnik, Det Sundhedsvidenskabelige

Læs mere

Det Medicinske Selskab i København. > Forår 2016

Det Medicinske Selskab i København. > Forår 2016 Det Medicinske Selskab i København > Forår 2016 > SÆSONPROGRAM for forår 2016 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 2. februar 2016 kl. 20.00: Tirsdag den 1. marts 2016 kl. 20.00:

Læs mere

Det Medicinske Selskab i København. > Efterår 2011

Det Medicinske Selskab i København. > Efterår 2011 Det Medicinske Selskab i København > Efterår 2011 > Sæsonplan for efterår 2011 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 27. september Kl. 20.00 Fhv. ledende overlæge Peter Kramp Sindssyg

Læs mere

Det Medicinske Selskab i København. > Forår 2017

Det Medicinske Selskab i København. > Forår 2017 Det Medicinske Selskab i København > Forår 2017 > SÆSONPROGRAM for forår 2017 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 7. februar 2017 kl. 20.00: Marie Louise Nørredam, reservelæge,

Læs mere

Det Medicinske Selskab i København. > Forår 2013

Det Medicinske Selskab i København. > Forår 2013 Det Medicinske Selskab i København > Forår 2013 > Sæsonplan for forår 2013 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 5. februar 2013 Kl. 20.00 Klinikchef, professor, overlæge, dr.

Læs mere

Det Medicinske Selskab i København. > Forår 2014

Det Medicinske Selskab i København. > Forår 2014 Det Medicinske Selskab i København > Forår 2014 > Sæsonplan for forår 2014 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 4. februar 2014 kl. 20.00: Fysisk aktivitet/sedentarisme For meget

Læs mere

Det Medicinske Selskab i København. > Efterår 2010

Det Medicinske Selskab i København. > Efterår 2010 Det Medicinske Selskab i København > Efterår 2010 > Sæsonplan for efterår 2010 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 5. oktober Kl. 20.00 Alm. prakt. læge Mikkel Vass Tænk dig

Læs mere

Det Medicinske Selskab i København. > Forår 2012

Det Medicinske Selskab i København. > Forår 2012 Det Medicinske Selskab i København > Forår 2012 > Sæsonplan for forår 2012 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 7. februar Kl. 20.00 Professor Ekse Willerslev, Biologisk Institut,

Læs mere

PROGRAM Konference om kronisk sygdom med fokus på lighed i sundhed. Den 18. marts 2015 Kl. 9.00-16.00 DGI-Byen, København

PROGRAM Konference om kronisk sygdom med fokus på lighed i sundhed. Den 18. marts 2015 Kl. 9.00-16.00 DGI-Byen, København PROGRAM Konference om kronisk sygdom med fokus på lighed i sundhed Den 18. marts 2015 Kl. 9.00-16.00 DGI-Byen, København PROGRAM Kl. 8.15-9.00 Registrering og morgenmad Kl. 9.00-9.15 Velkomst v. Sophie

Læs mere

Tidlig opsporing Hvor og hvornår er der evidens for tidlig opsporing?

Tidlig opsporing Hvor og hvornår er der evidens for tidlig opsporing? Region Hovedstaden Forskningscenter for Forebyggelse og Sundhed Tidlig opsporing Hvor og hvornår er der evidens for tidlig opsporing? Torben Jørgensen, Enhedschef Forskningscenter for Forebyggelse

Læs mere

Målet om tidligere og bedre opsporing hvordan når vi det i 2025?

Målet om tidligere og bedre opsporing hvordan når vi det i 2025? Tidlig opsporing af risikofaktorer for sygdom og ikke-erkendte kroniske sygdomme Helbredsundersøgelser og screening Målet om tidligere og bedre opsporing hvordan når vi det i 2025? Torsten Lauritzen Praktiserende

Læs mere

Torsten Lauritzen Professor,, Institut for Folkesundhed, Aarhus Universitet Faglig chefrådgiver, Diabetesforeningen

Torsten Lauritzen Professor,, Institut for Folkesundhed, Aarhus Universitet Faglig chefrådgiver, Diabetesforeningen Torsten Lauritzen Professor,, Institut for Folkesundhed, Aarhus Universitet Faglig chefrådgiver, Diabetesforeningen Perspektivering af Diabetes Impact Study Sundhedsfagligt og politisk En behandlingssucces:

Læs mere

Det Medicinske Selskab i København. > Forår 2010

Det Medicinske Selskab i København. > Forår 2010 Det Medicinske Selskab i København > Forår 2010 > Sæsonplan for forår 2010 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 9. februar Kl. 18.00 Kl. 20.00 Tirsdag den 2. marts Kl. 17.30 Kl.

Læs mere

I m m u n o l o g i o g t r a n s p l a n t a t i o n

I m m u n o l o g i o g t r a n s p l a n t a t i o n I m m u n o l o g i o g t r a n s p l a n t a t i o n Auditoriet afsnit P2132 Rigshospitalet Mandag d. 12. april 2010 FØR TRANSPLANTATION 09.00 10.00 Recipientudredning og godkendelse Jesper Melchior Hansen

Læs mere

Hvorfor dør de mindst syge?

Hvorfor dør de mindst syge? Hvorfor dør de mindst syge? Torsten Lauritzen Professor,, Institut for Folkesundhed, Aarhus Universitet Faglig chefrådgiver, Diabetesforeningen Diabetes-udviklingen En ssucces: Faldende risiko

Læs mere

Det Medicinske Selskab i København. > Forår 2011

Det Medicinske Selskab i København. > Forår 2011 Det Medicinske Selskab i København > Forår 2011 > Sæsonplan for forår 2011 Møderne afholdes i Domus Medica, Kristianiagade 12 Tirsdag den 8. februar Tirsdag den 8. marts Kl. 21.00 Tirsdag den 29. marts

Læs mere

Forskningscenter for Forebyggelse og Sundhed Et forskningscenter for folkesundhed

Forskningscenter for Forebyggelse og Sundhed Et forskningscenter for folkesundhed Region Hovedstaden Forskningscenter for Forebyggelse og Sundhed Forskningscenter for Forebyggelse og Sundhed Et forskningscenter for folkesundhed 1964-2016 Oplæg i Sundhedsudvalget, Region Hovedstaden

Læs mere

Affektiv lidelse: udfordringer og behandlingsmuligheder i Danmark

Affektiv lidelse: udfordringer og behandlingsmuligheder i Danmark Affektiv lidelse: udfordringer og behandlingsmuligheder i Danmark Projektgruppen Professor, overlæge, Lars Vedel Kessing* (formand) Overlæge Hanne Vibe Hansen* (lægefaglig sekretær) Professor,

Læs mere


EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER Zell am See 11. 18. marts 2017 Hotel Alpenblick KURSUSLEDELSE Sven Søren Larsen Flemming Burcharth Claus Perrild FORORD Efteruddannelseskursus for praktiserende

Læs mere

Amadeus Speciallægecenter ET SUNDT LIV - for dig eller din virksomhed

Amadeus Speciallægecenter ET SUNDT LIV - for dig eller din virksomhed Amadeus Speciallægecenter ET SUNDT LIV - for dig eller din virksomhed 0808_AMADEUS_brochure1.indd 1 9/16/08 10:55:13 AM Amadeus Speciallægecenter Amadeus er et speciallægecenter, som hjælper dig eller

Læs mere

Se dette nyhedsbrev i en browser

Se dette nyhedsbrev i en browser Se dette nyhedsbrev i en browser Medlemsmøde og generalforsamling d. 26. april kl. 16-20 OBS - Tryk på "Se dette nyhedsbrev i en browser" (øverst) eller tryk "Vis billeder" i dit mailprogram. Der indkaldes

Læs mere

Alkohol Hvad virker?

Alkohol Hvad virker? Alkohol Hvad virker? Lanceringskonference sundhedsprofil 2010 Region Hovedstaden Herlev 20. januar 2011 Torben Jørgensen, professor, Forskningscenter for Forebyggelse og Sundhed Glostrup hospital,

Læs mere

Program Træning som behandling af hjertepatienter

Program Træning som behandling af hjertepatienter Læringsmål Program Træning som behandling af hjertepatienter Modul 1: 4. 6. oktober 2016 Modul 2: 24. november 2016 Hvidovre Hospital, Undervisningsbygningen Kettegård Allé 30, 2650 Hvidovre Modul 1: Lokale

Læs mere

Guide: Sådan minimerer du risikoen for KOL-følgesygdomme

Guide: Sådan minimerer du risikoen for KOL-følgesygdomme Guide: Sådan minimerer du risikoen for KOL-følgesygdomme Tre simple blodprøver kan forudsige, hvem af de 430.000 danske KOL-patienter, der er i størst risiko for at udvikle de følgesygdomme, der oftest

Læs mere

Årsrapport 2012: second opinion ordningen og eksperimentel kræftbehandling

Årsrapport 2012: second opinion ordningen og eksperimentel kræftbehandling Årsrapport 2012: second opinion ordningen og eksperimentel kræftbehandling 2013 Årsrapport 2012: Second Opinion ordningen og eksperimentel kræftbehandling Sundhedsstyrelsen Axel Heides Gade 1 2300 København

Læs mere

Præsentation. MTV om behandling og rehabilitering af PTSD. herunder traumatiserede flygtninge

Præsentation. MTV om behandling og rehabilitering af PTSD. herunder traumatiserede flygtninge Præsentation MTV om behandling og rehabilitering af PTSD herunder traumatiserede flygtninge 1 Agenda Hvad er PTSD? Proces Styregruppen Projektgruppen Validering og kvalificering Formål MTV metoden Elementer

Læs mere

Projektoversigt. Forskningsenheden for Almen Praksis Institut for Folkesundhed Aarhus Universitet Bartholins Allé 2 8000 Århus C

Projektoversigt. Forskningsenheden for Almen Praksis Institut for Folkesundhed Aarhus Universitet Bartholins Allé 2 8000 Århus C Forskningsenheden for Almen Praksis Institut for Folkesundhed Aarhus Universitet Bartholins Allé 2 8000 Århus C Projektoversigt Tlf.: 89 42 60 10 Fax: 86 12 47 88 Oktober

Læs mere


EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER Zell am See. 14. marts 2015 Hotel Alpenblick KURSUSLEDELSE Sven Søren Larsen Flemming Burcharth Claus Perrild FORORD Efteruddannelseskursus for praktiserende

Læs mere

Diagnostiske centre i Danmark - Behovet set fra almen praksis

Diagnostiske centre i Danmark - Behovet set fra almen praksis Diagnostiske centre i Danmark - Behovet set fra almen praksis Mads Lind Ingeman & Peter Vedsted Mads Lind Ingeman Speciallæge i Almen Medicin, Ph.D.-studerende Center for Cancerdiagnostik i Praksis CaP

Læs mere

Frede Olesen, Praktiserende læge, professor, Forskningsenheden for Almen Praksis, Aarhus Universitet Formand for Kræftens Bekæmpelse i Danmark

Frede Olesen, Praktiserende læge, professor, Forskningsenheden for Almen Praksis, Aarhus Universitet Formand for Kræftens Bekæmpelse i Danmark , Praktiserende læge, professor, d Forskningsenheden for Almen Praksis, Aarhus Universitet Formand for Kræftens Bekæmpelse i Danmark Fire hovedveje til succes Behandling/behandlingsmetoder

Læs mere

Tilbage til fysisk krævende arbejde med dårlig ryg. Et prospektivt, kontrolleret interventionsstudie GoBack.

Tilbage til fysisk krævende arbejde med dårlig ryg. Et prospektivt, kontrolleret interventionsstudie GoBack. Protokolresumé: Tilbage til fysisk krævende arbejde med dårlig ryg. Et prospektivt, kontrolleret interventionsstudie GoBack. Forsøgsansvarlig: Forsøgskoordinerende: Klinisk ansvarlig: Biostatistiker: Ann

Læs mere


EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER EFTERUDDANNELSESKURSUS FOR PRAKTISERENDE LÆGER Zell am See 12. 19. marts 2016 Hotel Alpenblick KURSUSLEDELSE Sven Søren Larsen Flemming Burcharth Claus Perrild FORORD Efteruddannelseskursus for praktiserende

Læs mere

Danmark har et alvorligt sundhedsproblem

Danmark har et alvorligt sundhedsproblem Danmark har et alvorligt sundhedsproblem Introduktion til workshop Jan Mainz Professor, vicedirektør, Ph.D. Aalborg Universitetshospital - Psykiatrien Den største udfordring for psykiatrien er psykiatriske

Læs mere

MR- skanning forbedrer diagnostik af prostatakræft

MR- skanning forbedrer diagnostik af prostatakræft MR- skanning forbedrer diagnostik af prostatakræft MR-skanning er det bedste billedværktøj til at finde kræft i prostata og kommer til at spille en stor rolle i diagnostik og behandling af sygdommen i

Læs mere


DEN MOTIVERENDE SAMTALE Sune Rubak. DEN MOTIVERENDE SAMTALE Sune Rubak Den motiverende samtale Hvad er Den motiverende samtale Ad modum Miller & Rollnick? Den motiverende samtale 1. Behandleren er facilitator 2. Motivation

Læs mere

Kun 10 % er i alkoholbehandling hvordan får vi flere i alkoholbehandling?

Kun 10 % er i alkoholbehandling hvordan får vi flere i alkoholbehandling? Kun 10 % er i alkoholbehandling hvordan får vi flere i alkoholbehandling? Lars Iversen, professor emer. dr med, Statens Institut for Folkesundhed Hvor mange har alkoholproblemer

Læs mere

DD2 Status. Henning Beck-Nielsen Diabetes UpDate Nyborg, 14. november 2011

DD2 Status. Henning Beck-Nielsen Diabetes UpDate Nyborg, 14. november 2011 DD2 Status Henning Beck-Nielsen Diabetes UpDate Nyborg, 14. november 2011 > Hvorfor DD2? 250.000 patienter med type 2 diabetes (T2D) i Danmark 65 nye tilfælde hver dag i Danmark Forkorter livet med omkring

Læs mere


Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING Årsrapport 2011: SECOND OPINION ORDNINGEN OG EKSPERIMENTEL KRÆFT- BEHANDLING 2012 Årsrapport 2011: Second opinion ordningen og eksperimentel kræftbehandling Sundhedsstyrelsen Axel Heides Gade 1 2300 København

Læs mere

Hvordan skal vi bruge den nye viden om menneskets hjerne?

Hvordan skal vi bruge den nye viden om menneskets hjerne? Udvalget for Videnskab og Teknologi UVT alm. del - Bilag 19 Offentligt Hvordan skal vi bruge den nye viden om menneskets hjerne? Program for Teknologirådets konsensuskonference om hjerneforskning den 4,

Læs mere

40. årsmøde i Dansk Karkirurgisk Selskab 6. 7. november 2009. Schæffergården København

40. årsmøde i Dansk Karkirurgisk Selskab 6. 7. november 2009. Schæffergården København 40. årsmøde i Dansk Karkirurgisk Selskab 6. 7. november 2009 Schæffergården København Program fredag 6. november 2009 E kursus: Tilbyder vi den bedste behandling til vore patienter? 9.00 9.15 Ankomst,

Læs mere


EFTERUDDANNELSESKURSUS EFTERUDDANNELSESKURSUS Zell am See 9. 16. marts 2013 Hotel Alpenblick KURSUSLEDELSE Flemming Burcharth FORORD Efteruddannelseskursus for praktiserende læger i marts måned på et skisportssted med tilhørende

Læs mere



Læs mere

Fremtidens velfærdsløsninger. Aldring. Aldring. Antal ældre. Forebyggelse frem for pleje forbliv aktiv og selvhjulpen. Vi fødes som kopier

Fremtidens velfærdsløsninger. Aldring. Aldring. Antal ældre. Forebyggelse frem for pleje forbliv aktiv og selvhjulpen. Vi fødes som kopier Fremtidens velfærdsløsninger Forebyggelse frem for pleje forbliv aktiv og selvhjulpen 1. november 2011 Vi fødes som kopier Carsten Hendriksen Overlæge, lektor, dr. med. Bispebjerg Hospital og Center for

Læs mere

Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for analinkontinens hos voksne

Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for analinkontinens hos voksne Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for analinkontinens hos voksne Repræsentant Niels Qvist Læge Marianne Glavind Kristensen Læge Birgitte Bøje Sygeplejerske Peter Torsten

Læs mere

Eksperter samlet om HPV-spørgsmålet

Eksperter samlet om HPV-spørgsmålet Notat af Jeppe S. Kerckhoffs, politisk konsulent Eksperter samlet om HPV-spørgsmålet 19. august var de fremmeste eksperter inden for lægeverden samlet til et afgørende dialogmøde i Sundhedsstyrelsen om

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

Kontrolforløb for Gynækologiske Kræftpatienter - en medicinsk teknologivurdering. Ole Mogensen

Kontrolforløb for Gynækologiske Kræftpatienter - en medicinsk teknologivurdering. Ole Mogensen Kontrolforløb for Gynækologiske Kræftpatienter - en medicinsk teknologivurdering Ole Mogensen Kræftrejsen Udredning diagnostik Operation Efterbehandling kemoterapi og/eller stråleterapi Informeret samtykke

Læs mere

CF neonatal screening (logistik og praktiske forhold)

CF neonatal screening (logistik og praktiske forhold) CF neonatal screening (logistik og praktiske forhold) Information fra Sundhedsstyrelsen Information til forældre

Læs mere

Guide til sygdomsforebyggelse på sygehus og i almen praksis. Fakta om rygning

Guide til sygdomsforebyggelse på sygehus og i almen praksis. Fakta om rygning Guide til sygdomsforebyggelse på sygehus og i almen praksis Indhold Hvad er rygning? Hvad betyder rygning for helbredet? Hvordan er danskernes rygevaner? Hvilke konsekvenser har rygning i Danmark? Danskerne

Læs mere

Forskningsplan for Afd. P. Afdeling for Psykoser, AUH Risskov 2011-2015

Forskningsplan for Afd. P. Afdeling for Psykoser, AUH Risskov 2011-2015 Århus Universitetshospital Risskov Afd. P - Afdeling for Psykoser Forskningsplan for Afd. P Skovagervej 2 DK- 8240 Risskov Tel. +45 7847 1627 Afdeling for Psykoser, AUH Risskov

Læs mere

Evaluering af klinik på modul 2 efteråret (klinikperiode uge 48-49, 50-51)

Evaluering af klinik på modul 2 efteråret (klinikperiode uge 48-49, 50-51) Evaluering af klinik på modul 2 efteråret 2014 (klinikperiode uge 48-49, 50-51) 1 Indholdsfortegnelse Gennemførelsesoversigt... 3 Studerende i somatisk sektor... 4 2 Gennemførelsesoversigt Gennemførselsoversigt

Læs mere

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering

Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering Dansk Selskab for Medicinsk Genetik s (DSMG) politik vedrørende klinisk anvendelse af genomisk sekventering De sidste 10 års store fremskridt indenfor gensekventeringsteknologi har gjort det muligt at

Læs mere

KORA, 15. maj 2014 Iben Holbæk Lundager Projektleder Tjek dit helbred Randers Sundhedscenter

KORA, 15. maj 2014 Iben Holbæk Lundager Projektleder Tjek dit helbred Randers Sundhedscenter KORA, 15. maj 2014 Iben Holbæk Lundager Projektleder Tjek dit helbred Randers Sundhedscenter Birger og Birthe Randers Kommune 30.000 borgere 30-49 år Birger tømmer postkassen og går en tur på

Læs mere

Neonatal screeningsalgoritme for cystisk fibrose

Neonatal screeningsalgoritme for cystisk fibrose Neonatal screeningsalgoritme for cystisk fibrose Forslag til dansk screeningsalgoritme for CF 1. First tier: Alle nyfødte får målt immunoreaktiv trypsinogen (IRT) i den etablerede filterpapirblodprøve,

Læs mere

Lands- og landsdelsafdelinger

Lands- og landsdelsafdelinger Lands- og landsdelsafdelinger Oversigt Oversigt over afdelinger på lands- og landsdelssygehuse samt andre institutioner, der varetager lands- og landsdelsfunktioner i henhold til Sundhedsstyrelsens Vejledning

Læs mere

Fase 3 hjerterehabilitering - kan det forsømte indhentes?

Fase 3 hjerterehabilitering - kan det forsømte indhentes? Revideret mhp. offentliggørelse Konference om hjerterehabilitering for Hjerteforeningens faglige netværk 20. oktober 2009 Fase 3 hjerterehabilitering - kan det forsømte indhentes? Læge, ph.d.-studerende

Læs mere

Hold styr på dit stamtræ også når det gælder prostatakræft Arv og øvrige dispositioner for prostatakræft

Hold styr på dit stamtræ også når det gælder prostatakræft Arv og øvrige dispositioner for prostatakræft Hold styr på dit stamtræ også når det gælder prostatakræft Arv og øvrige dispositioner for prostatakræft Fejl i DNA molekylet er årsag til alle former for kræft også prostatakræft. Arvelighed

Læs mere

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt.

Søger personer med nyopdaget type 2 diabetes til et nationalt videnskabeligt projekt. Deltagerinformation Projekttitel: DD2 - Dansk center for strategisk forskning i type 2 diabetes Godkendt af Den Videnskabsetiske Komité for Region Syddanmark, journal nr. S-201000082. Søger personer med

Læs mere

Habilitetserklæring for medlemmer af nævn & råd 1, konsulenter m.m. for Sundhedsstyrelsen.

Habilitetserklæring for medlemmer af nævn & råd 1, konsulenter m.m. for Sundhedsstyrelsen. Habilitetserklæring for medlemmer af nævn & råd 1, konsulenter m.m. for Sundhedsstyrelsen. Sundhedsstyrelsen foretrækker, at habilitetserklæringen udfyldes elektronisk og ikke i hånden. 1.0 Personoplysninger

Læs mere

Hospitals- og psykiatriplan 2020

Hospitals- og psykiatriplan 2020 Region Hovedstaden Hospitals- og psykiatriplan 2020 Kort fortalt De væsentligste temaer og ændringer frem mod 2020 Fra høringsudkastet. Læs mere på hospitalsplan hospitalerne 2020 Gribskov

Læs mere

Alzheimers sygdom - hvad sker der i hjernen og hvornår starter sygdommen?

Alzheimers sygdom - hvad sker der i hjernen og hvornår starter sygdommen? Nationalt Videnscenter for Demens Alzheimers sygdom - hvad sker der i hjernen og hvornår starter sygdommen? Steen G. Hasselbalch, professor, overlæge, Nationalt Videnscenter for Demens, Neurologisk

Læs mere

Dag 1, d. 29. august: Forsknings-ABC og kritisk litteraturlæsning

Dag 1, d. 29. august: Forsknings-ABC og kritisk litteraturlæsning Lokalitet: Hvidovre Hospital Aud. 1, Forsknings- og Undervisningsbygningen Kettegård Allé 30, 2650 Hvidovre Dag 1, d. 29. august: Forsknings-ABC og kritisk litteraturlæsning 9.00-9.30: Ankomst og kaffe

Læs mere

Overdødeligheden blandt psykisk syge: Danmark har et alvorligt sundhedsproblem

Overdødeligheden blandt psykisk syge: Danmark har et alvorligt sundhedsproblem Overdødeligheden blandt psykisk syge: Danmark har et alvorligt sundhedsproblem Jan Mainz Professor, vicedirektør, Ph.D. Aalborg Universitetshospital - Psykiatrien Case En 64-årig kvinde indlægges akut

Læs mere

Fremadrettede perspektiver. Praktiserende læge, klinisk farmakolog, professor, ph.d. Jens Søndergaard

Fremadrettede perspektiver. Praktiserende læge, klinisk farmakolog, professor, ph.d. Jens Søndergaard Fremadrettede perspektiver Praktiserende læge, klinisk farmakolog, professor, ph.d. Jens Søndergaard Faser i KOL rejsen Almen praksis, sygehuse, kommuner mm Endelig diagnose Første diagnose, ventetid på

Læs mere

DSKB efterårsmøde 6. november 2015

DSKB efterårsmøde 6. november 2015 DSKB efterårsmøde 6. november 2015 Søren Ladefoged overlæge, ph.d. Kronisk nyresygdom: Analysemetoder og klinisk evaluering Rekommandationer for vurdering af glomerulær filtrationsrate og albuminuri

Læs mere

Høring vedrørende Sundhedsstyrelsens Anbefalinger for sundhedspersonalets

Høring vedrørende Sundhedsstyrelsens Anbefalinger for sundhedspersonalets Til adressaterne på den vedlagte liste over høringsparter 7-203-02-516/6/CIU Høring vedrørende s Anbefalinger for sundhedspersonalets møde med pårørende til alvorligt syge Hermed udsender Anbefalinger

Læs mere

Hvordan skal vi bruge den nye viden om menneskets hjerne?

Hvordan skal vi bruge den nye viden om menneskets hjerne? Hvordan skal vi bruge den nye viden om menneskets hjerne? Program for Teknologirådets konsensuskonference om hjerneforskning den. 4, 5. & 7. November 2005 i Fællessalen på Christiansborg. 1. session: Fredag

Læs mere


FORMÅL OG VEDTÆGTER FOR ØSTERBROUNDERSØGELSEN THE COPENHAGEN CITY HEART STUDY FORMÅL OG VEDTÆGTER FOR ØSTERBROUNDERSØGELSEN THE COPENHAGEN CITY HEART STUDY 1. Østerbroundersøgelsen er oprettet som en selvstændig forskningsenhed. Stk. 2. Østerbroundersøgelsen drives hovedsagelig

Læs mere


INFORMATIONSMØDE D. 24. NOVEMBER 2010. kl. 16.00 18.00 VELKOMMEN INFORMATIONSMØDE D. 24. NOVEMBER 2010 kl. 16.00 18.00 VELKOMMEN 1 Videncentret i TV2-Nyhederne mandag d. 26.10.2010 2 Program Velkomst v/ forskningsleder Sine Skovbjerg 16.05-16.15: Status for Videncentret

Læs mere

Ansøgningsskema til puljen på 5 mio. kr. til samfinansiering af projekter mellem kommuner og region:

Ansøgningsskema til puljen på 5 mio. kr. til samfinansiering af projekter mellem kommuner og region: Ansøgningsskema til puljen på 5 mio. kr. til samfinansiering af projekter mellem kommuner og region: 1 Ansøger Anne Marie Lyngsø 2 Kontaktperson/projektleder Navn: Anne Marie Lyngsø Adresse: Klinisk Enhed

Læs mere

Helkeramik og cementering med Jacob Slavensky.

Helkeramik og cementering med Jacob Slavensky. Kursus 1 Helkeramik og cementering med Jacob Slavensky. Vi har alle hørt om, hvor pæne restaureringer vi kan lave med helkeramik. Vi har også alle hørt om, hvor besværligt det er med præparation, aftrykstagning,

Læs mere

Kræftplan III indeholder en række emner og deraf afsatte midler. I bilag ses fordelte midler.

Kræftplan III indeholder en række emner og deraf afsatte midler. I bilag ses fordelte midler. Fakta om Kræftplan III Kræftplan III indeholder en række emner og deraf afsatte midler. I bilag ses fordelte midler. Diagnostisk pakke: Der skal udarbejdes en samlet diagnostisk pakke for patienter med

Læs mere

Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for udredning af generaliserede smerter i bevægeapparatet

Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for udredning af generaliserede smerter i bevægeapparatet Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for udredning af generaliserede smerter i bevægeapparatet Repræsentant Karen Lisbeth Faarvang Læge Kirstine Amris Læge Sven Viskum

Læs mere

Kræftens Bekæmpelses høringssvar på Region Sjællands udkast til Sundhedsaftale 2015-18

Kræftens Bekæmpelses høringssvar på Region Sjællands udkast til Sundhedsaftale 2015-18 14. september 2014 Region Sjælland Alleen 15 4180 Sorø Att.: Kvalitet og Udvikling Område Sjælland Område Sjælland Ringstedgade 71 4700 Næstved Tel +45 +45 2646 UNDER PROTEKTION AF HENDES

Læs mere

Habilitetserklæring for medlemmer af nævn & råd, konsulenter m.m. for Sundhedsstyrelsen.

Habilitetserklæring for medlemmer af nævn & råd, konsulenter m.m. for Sundhedsstyrelsen. Habilitetserklæring for medlemmer af nævn & råd, konsulenter m.m. for Sundhedsstyrelsen. OBS: Blanket skal udfyldes elektronisk for at undgå signaturkopiering 1.0 Personoplysninger 1.1 Navn Anne Rasmussen

Læs mere

Status. Center for kliniske retningslinjer. - Nationalt Clearinghouse for sygeplejefaglige kliniske retningslinjer

Status. Center for kliniske retningslinjer. - Nationalt Clearinghouse for sygeplejefaglige kliniske retningslinjer Status Center for kliniske retningslinjer - Nationalt Clearinghouse for sygeplejefaglige kliniske retningslinjer 2004: Etablere godkendelsesråd 2005: Vi vil have et Clearing house. Mål: Oktober 2007 2008

Læs mere

Second opinion DPCG 6. november 2008. Hans von der Maase Klinikchef, professor, dr. med Onkologisk Klinik Rigshospitalet

Second opinion DPCG 6. november 2008. Hans von der Maase Klinikchef, professor, dr. med Onkologisk Klinik Rigshospitalet Second opinion DPCG 6. november 2008 Hans von der Maase Klinikchef, professor, dr. med Onkologisk Klinik Rigshospitalet Bekendtgørelse om ret til sygehusbehandling og fødselshjælp m.v. Bekendtgørelse nr.

Læs mere

Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale.

Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale. Redskaber til systematisk opsporing Kursus til dig, der skal undervise frontpersonale i tidlig opsporende samtale. Ulrik Becker København 010414 Danskerne synes følgende er ok:

Læs mere

Psykiatriske patienter skal sidestilles med andre patienter

Psykiatriske patienter skal sidestilles med andre patienter Psykiatriske patienter skal sidestilles med andre patienter Psykiske sygdomme er blandt de allermest udbredte. Alligevel får psykiatriske patienter ikke samme tilbud som andre patienter. Lægeforeningen

Læs mere

Pandoras æske eller vejen til forebyggelse af sygdomme?

Pandoras æske eller vejen til forebyggelse af sygdomme? Genetisk hornhindediagnostik: Pandoras æske eller vejen til forebyggelse af sygdomme? Genteknologi et vigtigt værktøj til forebyggelse af hornhindesygdomme? Genetisk diagnostik og dets anvendelsesmuligheder

Læs mere


ØVRE GASTROINTESTINAL CANCER SEMINAR Dansk PancreasCancer Gruppe ØVRE GASTROINTESTINAL CANCER SEMINAR Status for DPCG & DPCD 2014 1. Nationale Kliniske Retningslinjer 2. DPCD Årsrapport 2013-2014 3. Den Nationale Kliniske Kræftdatabase (DNKK)

Læs mere

Her er symptomerne: Opdag diabetes i tide

Her er symptomerne: Opdag diabetes i tide Her er symptomerne: Opdag diabetes i tide Hjertekarsygdomme, dårlige øjne og nyreproblemer. Det er blot nogle af de sygdomme, som sender folk til lægen, hvorefter de kommer hjem med ikke blot én, men hele

Læs mere

Second opinion - kan vi tilbyde mere behandling? Hans von der Maase Klinikchef, professor, dr. med. Onkologisk Klinik Rigshospitalet

Second opinion - kan vi tilbyde mere behandling? Hans von der Maase Klinikchef, professor, dr. med. Onkologisk Klinik Rigshospitalet Second opinion - kan vi tilbyde mere behandling? Hans von der Maase Klinikchef, professor, dr. med. Onkologisk Klinik Rigshospitalet En afdeling kan efter rådgivning fra et af SST nedsat ekspertpanel (second

Læs mere

Efteruddannelseskursus 2014

Efteruddannelseskursus 2014 Dansk Selskab for Otolaryngologi, Hoved- og Halskirurgi s Efteruddannelseskursus 2014 Fredag d. 29/8 og lørdag d. 30/8 Hotel Koldingfjord, Kolding Sidste tilmeldingsfrist d. 1. juni 2014 Kære medlemmer!

Læs mere

Erfaringsmæssigt er en temadag med fokus på uddannelse, vejledning etc. Et godt udgangspunk for forandringer og fokusering.

Erfaringsmæssigt er en temadag med fokus på uddannelse, vejledning etc. Et godt udgangspunk for forandringer og fokusering. Sygehusledelsen Randers Centralsygehus Skovlyvej 1 8900 Randers har modtaget rapport fra besøget. skal bede om afdelingens tilbagemelding med en realistisk Inspektorrapporten med bilag vil være at finde

Læs mere

Brug af kliniske kvalitetsdata. Jens Hillingsø, klinikchef, overlæge, ph.d., MPG Kirurgisk Klinik Ctx, Rigshospitalet

Brug af kliniske kvalitetsdata. Jens Hillingsø, klinikchef, overlæge, ph.d., MPG Kirurgisk Klinik Ctx, Rigshospitalet Brug af kliniske kvalitetsdata Jens Hillingsø, klinikchef, overlæge, ph.d., MPG Kirurgisk Klinik Ctx, Rigshospitalet Kvalitetsbegrebet Kvalitet Kvalitet: Egenskab ved en ydelse eller et produkt, der betinger

Læs mere

Kommissorium for Advarselsudvalg

Kommissorium for Advarselsudvalg Kommissorium for Advarselsudvalg Panel til gennemgang af whereabouts-overtrædelser Baggrund: Alle udøvere i Anti Doping Danmarks prioriterede testgruppe A er forpligtet til at overholde samtlige krav specificeret

Læs mere

Sygeplejefaglige kompetencer Akutafdelingen, Hospitalsenheden Vest (HEV)

Sygeplejefaglige kompetencer Akutafdelingen, Hospitalsenheden Vest (HEV) Sygeplejefaglige kompetencer Akutafdelingen, (HEV) Denne skrivelse omfatter et bud på de kompetencer der skal være til stede fremover hos sygeplejersker i Akutafdelinger i Regionen. Det overordnede mål

Læs mere

Styrelse frikender rituel omskæring, men kritikere ønsker fortsat forbud

Styrelse frikender rituel omskæring, men kritikere ønsker fortsat forbud Styrelse frikender rituel omskæring, men kritikere ønsker fortsat forbud Line Vaaben 28. juni 2013 AFSTEMNING: Sundhedsstyrelsen finder ikke anledning til at forbyde rituel omskæring af drengebørn i Danmark,

Læs mere

UC Diakonissestiftelsen Geriatrikursus 2016

UC Diakonissestiftelsen Geriatrikursus 2016 UC Diakonissestiftelsen Geriatrikursus 2016 5 moduler á 2 dage: 25. og 26. august 13. og 14. september 28. og 29. september 12. og 13. oktober 31. oktober og 1. november Geriatrikursus 2016 Formål: At

Læs mere

Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for Dystoci

Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for Dystoci Medlemsliste for arbejdsgruppe vedr. Nationale Kliniske Retningslinjer for Dystoci Repræsentant Misan Stehouwer Jordemoder Lena Mariann Eriksen Jordemoder Anne-Mette Schroll Jordemoder Christina Rørbye

Læs mere

Programkomitéen for Individ, Sygdom og Samfund

Programkomitéen for Individ, Sygdom og Samfund Programkomitéen for Individ, Sygdom og Samfund Kim Krogsgaard (formand) Kim Krogsgaard er direktør for Fonden for Grete Lundbecks Europæiske Hjerneforskningspris og er tidligere forskningschef på Hvidovre

Læs mere

Forebyggelse af akut kritisk forværring ved hjælpe af et Early Warning Score system

Forebyggelse af akut kritisk forværring ved hjælpe af et Early Warning Score system Forebyggelse af akut kritisk forværring ved hjælpe af et Early Warning Score system Gitte Bunkenborg Ph.d. stud. Lunds Universitet, Udviklingssygeplejerske, Hvidovre Hospital Intensiv Terapiafsnit 542

Læs mere

Undersøgelser og behandling ved begrundet mistanke om kræft i hjernen

Undersøgelser og behandling ved begrundet mistanke om kræft i hjernen Undersøgelser og behandling ved begrundet mistanke om kræft i hjernen PAKKEFORLØB Denne pjece indeholder en generel og kortfattet beskrivelse af, hvad et pakkeforløb for kræft er. Det er den sygehusafdeling,

Læs mere

HØRINGSADRESSELISTE Kommunale parter m.fl. Faglige organisationer m.fl.

HØRINGSADRESSELISTE Kommunale parter m.fl. Faglige organisationer m.fl. HØRINGSADRESSELISTE Kommunale parter m.fl. Danske Regioner Regionernes Lønnings- og Takstnævn KL Region Hovedstaden Region Sjælland Region Syddanmark Region Midtjylland Region Nordjylland Faglige organisationer

Læs mere

Notat om uddannelsesmæssig og social ulighed i levetiden

Notat om uddannelsesmæssig og social ulighed i levetiden Det Politisk-Økonomiske Udvalg, Sundhedsudvalget PØU alm. del - Bilag 99,SUU alm. del - Bilag 534 Offentligt ØKONOMIGRUPPEN I FOLKETINGET (3. UDVALGSSEKRETARIAT) NOTAT TIL DET POLITISK-ØKONOMISKE UDVALG

Læs mere