Bioinformatik Open Source Software i biologiens tjeneste

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Bioinformatik Open Source Software i biologiens tjeneste"

Transkript

1 Bioinformatik Open Source Software i biologiens tjeneste Kenneth Geisshirt Silex Science ApS Bioinformatik p.1/19

2 Om Silex Science ApS Grundlagt maj 2002 Ejeren er Cortex Holding Fokusområderne hos Silex Science ApS er: High Performance Computing Open Source-baseret videnskabeligt og teknisk programmel Molekylær visualisering og modellering Bioinformatik Bioinformatik p.2/19

3 Molekylær biologi Molekylær biologien undersøger levende væsener på det molekylære plan. En del af molekylær biologiens data er sekvenser. En sekvens er en streng over et endeligt alfabet Bioinformatik p.3/19

4 DNA DNA er arvemassen - de sekvenser som bærer informationen om et levende væsen Alfabetet A, C, G, T. består af fire bogstaver (baser): DNA er dobbelt-strenget A T og G C sidder overfor hinanden Informationen grupperes i gener Menneskets genom består af basepar! Bioinformatik p.4/19

5 Proteiner Proteiner er kroppens arbejdsheste. Gener (DNA) oversættes til proteiner Alfabetet består af de 20 aminosyrer Proteiner kan modificeres efter oversættelse Sekundær struktur er en sekvens over alfabetet H, E, C 3-dimensional struktur giver funktionen Bioinformatik p.5/19

6 Proteiner Hormoner er små proteiner (peptider) Enzymer katalyserer biokemiske reaktioner Membranproteiner kan transportere molekyler over cellemembranen Transport af kemiske forbindelser, f.eks. hæmoglobins transport af oxygen Bioinformatik p.6/19

7 Offentlige databaser Op gennem 1990 erne blev forskellige organismers arvemasse kortlagt. GenBank indeholder alle DNA-sekvenser (100 GB) SwissProt har proteinsekvenser samt annoteringer om funktion PDB er til 3d-struktur af proteiner Alle har adgang til disse databaser. Bioinformatik p.7/19

8 Bioinformatik Bioinformatik er anvendelsen af informationsteknologi til håndteringen af biologiske data. Det er en tværfaglig disciplin: Molekylær biologi og biokemi Datalogi Statistik Kemi og fysik Bioinformatik p.8/19

9 Bioinformatik i praksis En typisk bioinformatik-gruppe i industrien: Computerne kører UNIX (og ofte Linux) Programmeringssproget er Perl Medlemmerne har en ph.d.-grad i biokemi eller molekylær biologi Stor åbenhed omkring teknologi Bioinformatik p.9/19

10 NCBI Toolkit CoreLib er et generisk bibliotek i ISO C AsnLib til håndtering af Abstract Syntax Notation 1 (ASN.1) Vibrant bruges til grafisk brugergrænseflader SEQ* indeholder funktioner til håndtering af sekvenser Licens: public domain Bioinformatik p.10/19

11 BLAST Basic Local Alignment Search Tool Søgning af sekvenser Alignment Bygger på NCBI Toolkit A T - C - T G A T - T G C A T - A - Licens: public domain Bioinformatik p.11/19

12 Predator Forudsigelse af sekundær struktur Skrevet i ISO C Benytter neurale netværk Nøjagtigheden er ca. 68 % Licens: kræver at en bestemt artikel citeres. Bioinformatik p.12/19

13 output layer Bioinformatik p.13/19 Neurale netværk hidden layer input layer

14 EMBOSS European Molecular Biology Open Software Suite Et bibliotek skrevet i ISO C (til UNIX) En række (kommando-linje) programmer (100+) Undersøtter Uniform Sequence Addresses Licens: GNU LGPL (bibliotek) og GNU GPL (programmer) Bioinformatik p.14/19

15 EMBOSS - eksempler Rotte-gener: seqret genbank::nc1102.seq:org:rattus genbank::rats.seq Gram-positive cocci surface proteins anchoring hexapeptide: preg ncbi::swissprot lp.tg[stgavde] -outfile swissprot.preg Statistik: pepstats ncbi::swissprot -outfile swissprot.stat Bioinformatik p.15/19

16 BioPerl BioPerl er et større bibliotek i Perl: Håndtering af sekvenser (læse, skrive, intern repræsentation) Kald af eksterne programmer (BLAST, Hmmer, etc,) Håndtering af alignment formater Licens: Artistic Bioinformatik p.16/19

17 BioPerl - eksempel use Bio::Seq; use Bio::SeqIO; $seq = Bio::Seq->new(-id => "myseq", -seq => "CGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC -type => Dna ); $seqout = Bio::SeqIO->new( -format => fasta, -fh => \*STDOUT); $trans = $seq->translate(); # make a translation $seqout->write_seq($trans); Bioinformatik p.17/19

18 Litteratur Developing Bioinformatics Computer Skills. C. Gibas & P. Jambeck. O Reilly & Associates, Introduction to Computational Biology. M.S. Watermann. Chapman & Hall/CRC, Bioinformatics: The Machine Learning Approach. P. Baldi & S. Brunak. MIT Press, Computational Molecular Biology - An Algorithmic Approach. P.A. Pevzner. MIT Press, Bioinformatik p.18/19

19 Hjemmesider Det humane genom-projekt: National Center for Biotechnology Information: Open Source Bioinformatics: How Perl Saved the Human Genome Project af L. Stein: ls bio.html Bioinformatik p.19/19

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier

Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Immunologisk bioinformatik - et undervisningsprojekt til de danske gymnasier Isa Kirk Biotech Academy Institut for Systembiologi, Danmarks Tekniske Universitet 2. november 2010 1 Indhold 1 Introduktion

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 14. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side 1 af 14 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13

Side 1 af 13. Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Side1af13 Eksamen: Bioinformatik It og Sundhed 27 Jan 2011 kl 9-13 Navn: Studie nummer: Dette eksamenssæt vil også kunne ses som en pdf fil nederst på kursus-hjemmesiden udfor den sidste dag d. 27 Jan

Læs mere

1. Formål, fag og læringsmål

1. Formål, fag og læringsmål Den fagspecifikke del af STUDIEORDNINGEN for BACHELORUDDANNELSEN i BIOKEMI ved det Naturvidenskabelige fakultet Københavns Universitet (version 31/8 2009) 1. Formål, fag og læringsmål Bacheloruddannelsen

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Foreløbig godkendelse af Kandidatuddannelse i medicinsk bioinformatik

Foreløbig godkendelse af Kandidatuddannelse i medicinsk bioinformatik Syddansk Sdu@sdu.dk Afgørelse om foreløbig godkendelse 10. december 2013 Ministeren for forskning, innovation og videregående uddannelser har på baggrund af gennemført prækvalifikation af Syddansk s ansøgning

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 17 Danmarks Tekniske Universitet Skriftlig prøve, den 21/1-2013 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Kresten Cæsar Torp Supplerende materiale til Biokemibogen liv, funktion, molekyle

Kresten Cæsar Torp Supplerende materiale til Biokemibogen liv, funktion, molekyle BIOINFORMATIK Kresten Cæsar Torp Supplerende materiale til Biokemibogen liv, funktion, molekyle indhold DNA 2 Hvilke databaser skal man vælge? 2 Søgning på en nukleotidsekvens 2 Proteiner 4 Søgning på

Læs mere

Indholdsfortegnelse. Side 1 af 12

Indholdsfortegnelse. Side 1 af 12 Den uddannelsesspecifikke del af studieordningen for bacheloruddannelsen i biokemi ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet 2010 (Rev. 2016) Indholdsfortegnelse 1 Titel, tilknytning

Læs mere

Naturvidenskab og teknologi som makkerpar

Naturvidenskab og teknologi som makkerpar THOMAS RASMUSSEN Naturvidenskab og teknologi som makkerpar Et styrket samarbejde mellem gymnasier, virksomheder og universiteter er en væsentlig faktor, når man skal vise, hvad basisviden kan bruges til

Læs mere

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

Sundheds CVU Nordjylland INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00

Sundheds CVU Nordjylland INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00 INTERN PRØVE ANATOMI, FYSIOLOGI OG BIOKEMI S06V D. 15. JUNI 2006 KL. 09.00 13.00 ANATOMI OG FYSIOLOGI Opgave 1 Den menneskelige organisme er opbygget af celler. a. Beskriv cellens opbygning, heri skal

Læs mere

Bilag 15 Oversigt over erhvervsakademiuddannelser, professionsbacheloruddannelser samt bachelor- og kandidatuddannelser relateret til landbrug,

Bilag 15 Oversigt over erhvervsakademiuddannelser, professionsbacheloruddannelser samt bachelor- og kandidatuddannelser relateret til landbrug, Bilag 15 Oversigt over erhvervsakademiuddannelser, professionsbacheloruddannelser samt bachelor- og kandidatuddannelser relateret til landbrug, fødevarehåndtering samt natur og miljø 1 FIVU s bidrag til

Læs mere

Bioinformatik. Udviklingen inden for gen- og bioteknologi går stærkt rigtig stærkt! Genom-sekventeringsprojekterne

Bioinformatik. Udviklingen inden for gen- og bioteknologi går stærkt rigtig stærkt! Genom-sekventeringsprojekterne Bioinformatik Udviklingen inden for gen- og bioteknologi går stærkt rigtig stærkt! Genom-sekventeringsprojekterne genererer enorme mængder data; i dag kendes baserækkefølgen for hundredvis af genomer deriblandt

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 af 1 Danmarks Tekniske Universitet Side 1 af 11 sider Skriftlig prøve, den 27/5-2010 Kursus navn: Kursus nr. 27611 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved

Læs mere

Velkommen. Studieleder. Der er mulighed for at købe mad i kantinen Praktisk øvelse Stjepan Kracun - postdoc Andreas Blennow - Lektor

Velkommen. Studieleder. Der er mulighed for at købe mad i kantinen Praktisk øvelse Stjepan Kracun - postdoc Andreas Blennow - Lektor Velkommen Tom Hamborg Nielsen Studieleder Dias 1 Aktivitet Ansvarlig 9.30-9.45 Intro til Biologi-Bioteknologi-studiet Tom Hamborg Nielsen lektor 9.45-10.15 Forelæsning: intro til Enzymer Tom Hamborg Nielsen

Læs mere

Indholdsfortegnelse. Side 1 af 9

Indholdsfortegnelse. Side 1 af 9 Den uddannelsesspecifikke del af studieordningen for bacheloruddannelsen i biokemi ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet 2010 (Rev. 2017) Indholdsfortegnelse 1 Titel, tilknytning

Læs mere

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik Danmarks Tekniske Universitet Løsningsforslag til Øvelse i Immonologisk Bioinformatik Indledning De følgende sider giver en gennemgang af de øverlser i har lavet under jeres besøg på DTU, som en del af

Læs mere

Databasesøgning med BLAST

Databasesøgning med BLAST Databasesøgning med BLAST Denne vejledning giver en introduktion til databasesøgning med forskellige programmer i BLAST-familien. Vejledningen indeholder først en grundig introduktion og gennemgang af

Læs mere

Ansøgning om godkendelse af kandidatuddannelse i escience

Ansøgning om godkendelse af kandidatuddannelse i escience KØBENHAVNS UNIVERSITET Ansøgning om godkendelse af kandidatuddannelse i escience Hidtil er videnskabelig indsigt fortrinsvis opnået enten gennem opstilling af teorier eller gennem observationer i naturen

Læs mere

Velkommen Immunologisk Bioinformatik

Velkommen Immunologisk Bioinformatik Velkommen Immunologisk Bioinformatik EduForce undervisere: Hvem er vi? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvem er I? 3 DTU Systembiologi, Danmarks Tekniske Universitet Dagens Program Kl.

Læs mere

Akkrediteringsrådet har godkendt kandidatuddannelserne i systembiologi ved Danmarks Tekniske Universitet.

Akkrediteringsrådet har godkendt kandidatuddannelserne i systembiologi ved Danmarks Tekniske Universitet. Akkrediteringsrådet har godkendt kandidatuddannelserne i systembiologi ved Danmarks Tekniske Universitet. Godkendelsen er givet på baggrund af Akkrediteringsrådets positive akkreditering samt Universitets-

Læs mere

Biokemi Udforsk livets kerne med en uddannelse i biokemi på Københavns Universitet

Biokemi Udforsk livets kerne med en uddannelse i biokemi på Københavns Universitet det natur- og biovidenskabelige fakultet københavns universitet Biokemi Udforsk livets kerne med en uddannelse i biokemi på Københavns Universitet Biokemi 1 kemi bioteknologi bioinformatik laboratoriearbejde

Læs mere

Statistisk Softwareudvikling

Statistisk Softwareudvikling Statistisk Softwareudvikling Peter Dalgaard Biostatistisk Afdeling Københavns Universitet IT og Sundhed, september 2008 Introduktion Statistisk software Open Source / Free Software R projektet Værktøjer

Læs mere

Proteiner. Proteiner er molekyler der er opbygget af "aminosyrer",nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde

Proteiner. Proteiner er molekyler der er opbygget af aminosyrer,nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde Proteiner Proteiner er molekyler der er opbygget af "aminosyrer",nogle er sammensat af få aminosyrer medens andre er opbygget af mange tusinde Der findes ca. 20 aminosyrer i menneskets organisme. Nogle

Læs mere

Brug din POWER server i højere grad ved hjælp af Linux og Open Source!

Brug din POWER server i højere grad ved hjælp af Linux og Open Source! Brug din POWER server i højere grad ved hjælp af Linux og Open Source! Onsdag den 7. september 2011 Middelfart Resort & KonferenceCenter Torben & TINXDK Torben Sørensen (mig) TINXDK A/S og inote aps -

Læs mere

Indholdsfortegnelse. Side 1 af 10

Indholdsfortegnelse. Side 1 af 10 Den uddannelsesspecifikke del af studieordningen for bacheloruddannelsen i biologi-bioteknologi ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet 2007 (Rev. 2015) Indholdsfortegnelse

Læs mere

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' Forskere kan lave præcise ændringer

Læs mere

INFOMØDE NY SEMESTERORDNING AARHUS UNIVERSITET

INFOMØDE NY SEMESTERORDNING AARHUS UNIVERSITET INFOMØDE 23.02.17 NY SEMESTERORDNING 1 KVARTER SEMESTER - E2017 1 Års studier = 60 ECTS Undervisning har siden 2004 været opdelt i 4 kvarter på hver 7 uger De fleste kurser har været 5 ECTS, nogle få har

Læs mere

EN DANSK STRATEGI FOR FORSKNING OG FORSKERUDDANNELSE INDEN FOR BIOINFORMATIK

EN DANSK STRATEGI FOR FORSKNING OG FORSKERUDDANNELSE INDEN FOR BIOINFORMATIK EN DANSK STRATEGI FOR FORSKNING OG FORSKERUDDANNELSE INDEN FOR BIOINFORMATIK Udarbejdet på opfordring af Danmarks Grundforskningsfond Trykt april 2002 Indholdsfortegnelse side 1. Sammenfatning... 3 2.

Læs mere

Epigenetik Arv er andet end gener

Epigenetik Arv er andet end gener Epigenetik Arv er andet end gener Indhold Indledning Afsnit1: Epigenetik og DNA Afsnit 2: DNA, nukleosomer og kromatin Afsnit 3: Epigenetik og celledifferentiering Afsnit 4: Genetisk ens individer kan

Læs mere

ROSKILDE UNIVERSITET Studienævnet for Biologi

ROSKILDE UNIVERSITET Studienævnet for Biologi ROSKILDE UNIVERSITET Studienævnet for Biologi Fagmodul i Molekylærbiologi med ændringer 1. februar 2016 DATO/REFERENCE JOURNALNUMMER 1. februar 2016 2012-1215 Denne fagmodulbeskrivelse erstatter fagmodulbeskrivelsen

Læs mere

Protein databases Rasmus Wernersson. (Slides af Henrik Nielsen & Morten Nielsen).

Protein databases Rasmus Wernersson. (Slides af Henrik Nielsen & Morten Nielsen). Protein databases Rasmus Wernersson (Slides af Henrik Nielsen & Morten Nielsen). Background- Nucleotide databases GenBank, http://www.ncbi.nlm.nih.gov/genbank/ National Center for Biotechnology Information

Læs mere

Sundheds CVU Aalborg INTERN PRØVE ANATOMI OG FYSIOLOGI HOLD S05S D. 9. JANUAR 2006 KL. 9.00 13.00

Sundheds CVU Aalborg INTERN PRØVE ANATOMI OG FYSIOLOGI HOLD S05S D. 9. JANUAR 2006 KL. 9.00 13.00 INTERN PRØVE HOLD S05S D. 9. JANUAR 2006 KL. 9.00 13.00 Opgave 1: a) Beskriv nyrernes udseende og placering i kroppen b) Beskriv nyrernes makroskopiske opbygning, gerne ved hjælp af en figur, der viser

Læs mere

Side 1 af 8. Undervisningsbeskrivelse. Stamoplysninger til brug ved prøver til gymnasiale uddannelser. Termin. Maj 2013.

Side 1 af 8. Undervisningsbeskrivelse. Stamoplysninger til brug ved prøver til gymnasiale uddannelser. Termin. Maj 2013. Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Institution Uddannelse Fag og niveau Lærer(e) Maj 2013 Skive Tekniske Gymnasium HTX Kemi B Helle Ransborg

Læs mere

Immunologisk Bioinformatik

Immunologisk Bioinformatik Immunologisk Bioinformatik Et undervisningsmateriale til de danske gymnasier Af Isa Kristina Kirk Materialet er lavet af Isa Kristina Kirk for Biotech Academy ved Danmarks Tekniske Universitet, DTU, i

Læs mere

Hvorfor er genfinding et vanskeligt problem?

Hvorfor er genfinding et vanskeligt problem? 19th January 2005 Genfinding og skjulte Markov-modeller Af Asger Hobolth og Leif Schauser Indledning I disse år kortlægges en række organismers arvelige materiale. Det humane om blev kortlagt i 2001, og

Læs mere

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet

Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Genomics og big data sikrer ny indsigt i sygdom og nye muligheder for sundhedsvæsenet Exiqons cloud-løsning hjælper forskere med at analysere og forstå genomics og big data Hvad er genomics? Genomics er

Læs mere

Indholdsfortegnelse. Side 1 af 19

Indholdsfortegnelse. Side 1 af 19 Den uddannelsesspecifikke del af studieordningen for bacheloruddannelsen i biologi ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet 2009 (Rev. 2015) Indholdsfortegnelse 1 Titel, tilknytning

Læs mere

QGIS Brugermde 9. marts Diaspora*: twitter.com/soerenbc soerenbredlundcaspersen.

QGIS Brugermde 9. marts Diaspora*: twitter.com/soerenbc soerenbredlundcaspersen. QGIS Brugermde 9. marts 2017 e-mail: soeren-b-c@ubuntu.com Diaspora*: sbc@diasp.de twitter.com/soerenbc soerenbredlundcaspersen.dk s historie Hvorfor / Prøv / Hvem er jeg? Gymnasielærer (matematik & fysik)

Læs mere

Kombi-kandidatuddannelser

Kombi-kandidatuddannelser Februar 2015 Oversigt over kandidatkombinationsuddannelser på RUC Denne oversigt viser alle de kombinationskandidatuddannelser, du kan læse på RUC. Fag 1 er dit primære fag, og du kan kombinere med alle

Læs mere

Studievejledning Antal Antal pjecer jeg ønsker at bestille: Alternativer til Psykologi (september 2008)

Studievejledning Antal Antal pjecer jeg ønsker at bestille: Alternativer til Psykologi (september 2008) Studievejledning Antal Antal pjecer jeg ønsker at bestille: Alternativer til Psykologi (september 2008) Dimittendguiden 2015 Regler om optagelse og indskrivning ved Aalborg Universitet (2013) Studievejledningen

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-juni 2016 Institution VID Gymnasier htx Uddannelse Fag og niveau Lærer(e) Hold HTX Biologi C Lennart Degn

Læs mere

Anvendt BioKemi: Blod som et kemisk system, Struktur af blod

Anvendt BioKemi: Blod som et kemisk system, Struktur af blod Anvendt BioKemi: Struktur 1) MM1 Intro: Terminologi, Enheder Math/ biokemi : Kemiske ligninger, syre, baser, buffer Små / Store molekyler: Aminosyre, proteiner 2) MM2 Anvendelse: blod som kemiske systemer

Læs mere

Struktur og funktion af gener

Struktur og funktion af gener Molekylærbiologi og genetik S4, F2008 f Malene Munk Jørgensen Emne: Struktur og funktion af gener Link: undervisningsplanen for S4-molekylærbiologi og genetik MMJ, VI niversity ollege Bioanalytikeruddannelsen

Læs mere

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere:

Velkommen. Test dit eget DNA med PCR. Undervisningsdag på DTU Systembiologi. Undervisere: Velkommen Test dit eget DNA med PCR Undervisningsdag på DTU Systembiologi Undervisere: Hvem er I? 2 DTU Systembiologi, Danmarks Tekniske Universitet Hvilke baser indgår i DNA? A. Adenin, Guanin, Cytosin,

Læs mere

Biologi opgave Opsamling: Cellebiologi (Bioanalytiker modul3)

Biologi opgave Opsamling: Cellebiologi (Bioanalytiker modul3) 1 Delphine Bonneau Biologi opgave Opsamling: Cellebiologi 1-6 Pelle har spist en kæmpe stor kage, og efterfølgende stiger hans blodsukker. Derfor sender kroppen besked til de endokrine kirtler i bugspytkirtlen

Læs mere

Efterbehandling til Enzymer - Klip dit tis i stykker CIRKUS NATURLIGVIS

Efterbehandling til Enzymer - Klip dit tis i stykker CIRKUS NATURLIGVIS Efterbehandling til Enzymer - Klip dit tis i stykker CIRKUS NATURLIGVIS Enzymer kan godt være svære at forstå, og oplægget indeholder rigtig meget information. Derfor er det en god idé, at lave noget efterbehandling.

Læs mere

Roskile Universitet Studienævn for Naturvidenskabelige uddannelser

Roskile Universitet Studienævn for Naturvidenskabelige uddannelser Roskile Universitet Studienævn for Naturvidenskabelige uddannelser Fagmodul i Molekylærbiologi DATO/REFERENCE JOURNALNUMMER 1.september 2017 2012-1215 Ændringer af 1. september 2015, 1. februar 2016 og

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 14 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse

Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Identifikation af potentielle microrna gener ved hjælp af komparativ genomanalyse Per Tøfting 23. september 2008 Speciale i softwarekonstruktion IT-Vest Aarhus Universitet Agenda Formål microrna Strategien

Læs mere

Bakteriers immunsystem

Bakteriers immunsystem FORSKNING 25 Bakteriers immunsystem åbner døren til en ny æra for biologien Bakteriers immunforsvar mod virus kaldet CRISPR-Cas viser vejen til en teknologi, der rummer et enormt potentiale indenfor bioteknologien.

Læs mere

Web of Science Vejledning

Web of Science Vejledning Web of Science Vejledning Der er adgang til Web of Science fra databaselisten på Fagbibliotekets hjemmeside, eller hvis du er udenfor hospitalets netværk via fjernadgang til DEFF (www.tidsskrifter.deff.dk)

Læs mere

Bioinformatik Algoritmiske Aspekter. Christian Nørgaard Storm Pedersen BRICS. Datalogisk Institut Aarhus Universitet.

Bioinformatik Algoritmiske Aspekter. Christian Nørgaard Storm Pedersen BRICS. Datalogisk Institut Aarhus Universitet. Bioinformatik Algoritmiske Aspekter hristian Nørgaard Storm Pedersen BRIS Datalogisk Institut Aarhus Universitet IT-, April, 2001 Bioinformatik Bioinformatik er udvikling og anvendelse af algoritmer og

Læs mere

Kædesøgning via citationer (Cited Reference Search) Web of Science er et citationsindex, som gør artiklernes referencelister er søgbare.

Kædesøgning via citationer (Cited Reference Search) Web of Science er et citationsindex, som gør artiklernes referencelister er søgbare. Web of Science Udgiver: Thomson Reuters Type: Bibliografisk database / henvisning til artikler Indhold og omfang Tværvidenskabelig database med repræsentation af over 12.000 peer-reviewed videnskabelige

Læs mere

Kvarter -> Semester -E2017

Kvarter -> Semester -E2017 Kvarter -> Semester -E2017 Undervisning har siden 2004 været opdelt i 4 kvarter på hver 7 uger De fleste kurser har været 5 ECTS, nogle få har været 10 ECTS og kørt over 2 kvarter Fra E2017 omlægges undervisning

Læs mere

You can apply for transfer or change of study programme for the following programmes in the summer intake: ARTS

You can apply for transfer or change of study programme for the following programmes in the summer intake: ARTS You can apply for transfer or change of study programme for the following programmes in the summer intake: ARTS Anthropology - General Anthropology Anthropology - Global Studies and Development Anthropology

Læs mere

Immunologisk bioinformatik

Immunologisk bioinformatik Immunologisk bioinformatik Øvelsesvejledning Introduktion til øvelsen Når man i dagligdagen taler om influenza, bliver virussen ofte forbundet med forbigående og ufarlig sygdom. Som regel har mennesker

Læs mere

Fysikken bag hverdagens materialer.

Fysikken bag hverdagens materialer. Fysikken bag hverdagens materialer. Carsten Svaneborg, Lektor Institut for Fysik, Kemi og Farmaci Syddansk Universitetet Campusvej 55, 5320 Odense M zqex@sdu.dk Http://www.zqex.dk Oversigt Intro hverdagens

Læs mere

Er der flere farver i sort?

Er der flere farver i sort? Er der flere farver i sort? Hvad er kromatografi? Kromatografi benyttes inden for mange forskellige felter og forskningsområder og er en anvendelig og meget benyttet analytisk teknik. Kromatografi bruges

Læs mere

MiSeq i den daglige rutine. MRSA og VRE Isolater.

MiSeq i den daglige rutine. MRSA og VRE Isolater. MiSeq i den daglige rutine. MRSA og VRE Isolater. 4. juni 2014 DTU Peder Worning, KMA Hvidovre Hvorfor Genomsekventere i Rutinen? Hvad bruger vi DNA-sekvenser til? Typning og bestemmelse af MRSA PCR baserede

Læs mere

Datalogistudiet. Rolf Fagerberg. Institut for Matematik og Datalogi Syddansk Universitet. Studiestart, 1. september 2014

Datalogistudiet. Rolf Fagerberg. Institut for Matematik og Datalogi Syddansk Universitet. Studiestart, 1. september 2014 Datalogistudiet Rolf Fagerberg Institut for Matematik og Datalogi Syddansk Universitet Studiestart, 1. september 2014 Datalogistudiet Studiestart, 1. september, 2014 1 / 15 Hvad arbejder du med bagefter?

Læs mere

Design og implementation af klynge-løsning til biologisk forskning

Design og implementation af klynge-løsning til biologisk forskning Design og implementation af klynge-løsning til biologisk forskning Skriftligt 2.dels projekt Datalogisk Institut Københavns Universitet (DIKU) Lars G.T. Jørgensen (larsj@diku.dk) & Sidsel Jensen (purps@diku.dk)

Læs mere

Indholdsfortegnelse. Side 1 af 11

Indholdsfortegnelse. Side 1 af 11 Den uddannelsesspecifikke del af studieordningen for bacheloruddannelsen i biologi-bioteknologi ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet 2007 (Rev. 2017) Indholdsfortegnelse

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Maj-Jun 2010 Institution Sukkertoppen Uddannelse Fag og niveau Lærer(e) Hold htx Biologi B Thomas Haack Den

Læs mere

Master's degree programme (120 ECTS). Academic year Faculty Annual tuition fees (60 ECTS) Agrobiology (Animal Health and Welfare) Science

Master's degree programme (120 ECTS). Academic year Faculty Annual tuition fees (60 ECTS) Agrobiology (Animal Health and Welfare) Science Master's degree programme (120 ECTS). Academic year 2018 2019. Faculty Annual tuition fees (60 ECTS) Agrobiology (Animal Health and Welfare) Science and Technology EUR 13,500 Agrobiology (Organic Agriculture

Læs mere

C.V. for PER NIELSEN

C.V. for PER NIELSEN NAVN: Per Nielsen ADRESSE: Bistrup Park 81 3460 Birkerød e mail: per42nielsen@gmail.com FØDT: 25. juli 1961 UDDANNELSE: 1991 Ph.D., Danmarks Tekniske Universitet, Laboratoriet for Anvendt Matematisk Fysik

Læs mere

Modeller og simulering af kunstig liv

Modeller og simulering af kunstig liv Modeller og simulering af kunstig liv Carsten Svaneborg, Lektor Center for Fundamental Levende Teknologi (FLinT) Institut for Fysik, Kemi og Farmaci Syddansk Universitetet Campusvej 55, 5320 Odense M zqex@sdu.dk

Læs mere

Indholdsfortegnelse. Side 1 af 10

Indholdsfortegnelse. Side 1 af 10 Den uddannelsesspecifikke del af studieordningen for bacheloruddannelsen i molekylær biomedicin ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet 2009 (Rev. 2016) Indholdsfortegnelse

Læs mere

Medarbejderen. Til din Life Science virksomhed:

Medarbejderen. Til din Life Science virksomhed: Til din Life Science virksomhed: Medarbejderen med de kompetencer Kort og godt om din næste, potentielle medarbejder, der gennem hele sin uddannelse har haft skarp fokus på det bioteknologiske arbejdsmarked:

Læs mere

HTX CPH WEST 2O16 FAG&STUDIERETNINGER

HTX CPH WEST 2O16 FAG&STUDIERETNINGER HTX CPH WEST 2O16 FAG&STUDIERETNINGER Din HTX uddannelse består af studieretningsfag i en samlet pakke, obligatoriske fag samt valgfag. På Ishøj Tekniske Gymnasium tilbyder vi i alt fem forskellige studieretninger.

Læs mere

Adgang til den mikrobiologiske sorte boks via DNA analyser

Adgang til den mikrobiologiske sorte boks via DNA analyser Workshop Aarhus, 15. maj 2017 Adgang til den mikrobiologiske sorte boks via analyser Per Halkjær Nielsen CENTER FOR MICROBIAL COMMUNITIES INSTITUT FOR KEMI OG BIOVIDENSKAB AALBORG UNIVERSITET, DANMARK

Læs mere

Enzymer og katalysatorer

Enzymer og katalysatorer Enzymer og katalysatorer Niveau: 8. klasse Varighed: 6 lektioner Præsentation: I forløbet Enzymer og katalysatorer arbejdes der med, hvordan den naturlige reaktionshastighed kan ændres ved hjælp af enzymer

Læs mere

\ \ Computerens Anatomi / /

\ \ Computerens Anatomi / / HTX Roskilde - mat-it-prog, 1.4 \ \ Computerens Anatomi / / Introduktion En PC ( personlige computer ) eller computer er bygget op af forskellige komponenter. Vi vil hermed gennemgå størstedelen af computerens

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin August 2015 maj 2016 Institution Erhvervsgymnasiet Grindsted Uddannelse Fag og niveau Lærer HTX Teknologi

Læs mere

Anbefalede studieforløb på kandidatuddannelsen i datalogi

Anbefalede studieforløb på kandidatuddannelsen i datalogi Anbefalede studieforløb på kandidatuddannelsen i datalogi Andrzej Filinski Studieleder DIKU Business Club HR-møde 8. oktober 2015 Baggrund: Studieordningen fra 2009 Gennemgribende revision af uddannelsen

Læs mere

Digital dannelse eller bare dannelse. Thomas Illum Hansen, forskningschef UC Lillebælt

Digital dannelse eller bare dannelse. Thomas Illum Hansen, forskningschef UC Lillebælt Digital dannelse eller bare dannelse Thomas Illum Hansen, forskningschef UC Lillebælt Digital dannelse eller bare dannelse Knud Grue-Sørensens definition af dannelse (1975): Dannelse betegner den proces

Læs mere

Gener, biologiske markører og valg af den rigtige behandling

Gener, biologiske markører og valg af den rigtige behandling Gener, biologiske markører og valg af den rigtige behandling Et spørgsmål om at udnytte viden, teknologi og sundhedsresurser optimalt Vi oplever i disse år en sand revolution i udviklingen af nye teknologier

Læs mere

Indholdsfortegnelse. Side 1 af 8

Indholdsfortegnelse. Side 1 af 8 Den uddannelsesspecifikke del af studieordningen for bacheloruddannelsen i nanoscience ved Det Natur- og Biovidenskabelige Fakultet, Københavns Universitet 2013 (Rev. 2015) Indholdsfortegnelse 1 Titel,

Læs mere

Undervisningsbeskrivelse for STX 2m Kemi B

Undervisningsbeskrivelse for STX 2m Kemi B Undervisningsbeskrivelse for STX 2m Kemi B Termin Afslutning i juni skoleår 13/14 Institution Marie Kruses Skole Uddannelse Fag og niveau Lærer(e) Hold STX Kemi A valgfag Hasse Bonde Rasmussen 3gKE Denne

Læs mere

Fagbilag bioteknologi

Fagbilag bioteknologi fagbilag bioteknologi 1 Fagbilag bioteknologi 1. Identitet og formål 1.1 Siden penicillinets opdagelse for ca. 50 år siden, har der været en rivende udvikling indenfor området bioteknologi. Bioteknologi

Læs mere

Undervisningsbeskrivelse

Undervisningsbeskrivelse Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Institution Uddannelse Fag og niveau Lærer(e) Hold Termin hvori undervisningen afsluttes: maj-juni 2015 Marie

Læs mere

Perspektiverende Datalogi Klassiske Algoritmer. Gerth Stølting Brodal

Perspektiverende Datalogi Klassiske Algoritmer. Gerth Stølting Brodal Perspektiverende Datalogi Klassiske Algoritmer Gerth Stølting Brodal Ugens Program Mandag 10.15 12.00 Introduktion til Algoritmik Gerth Stølting Brodal Tirsdag 9.15 12.00 Øvelser Open Learning Center 12.15

Læs mere

Godkendte uddannelser til optagelse i IDA som medlem

Godkendte uddannelser til optagelse i IDA som medlem Godkendte uddannelser til optagelse i IDA som medlem KOT-nr. Københavns Universitet 10117 Farmaci, København K, Studiestart: sommerstart 10140 Veterinærmedicin, København K, Studiestart: sommerstart 10150

Læs mere

Faget bidrager til at give eleverne forudsætninger for ansvarlig og kritisk stillingtagen til anvendelse og udvikling af bioteknologi.

Faget bidrager til at give eleverne forudsætninger for ansvarlig og kritisk stillingtagen til anvendelse og udvikling af bioteknologi. Bioteknologi A 1. Identitet og formål 1.1 Identitet Bioteknologi er teknologisk udnyttelse af biologiske systemer til forskning, analyse, produktion og sygdomsbehandling. Bioteknologi tager udgangspunkt

Læs mere

Titel 1 Celler opbygning og funktion 15. Titel 2 Genetik livets kode 16. Titel 3 Gæring 11. Titel 4 Sundhed og kost 18

Titel 1 Celler opbygning og funktion 15. Titel 2 Genetik livets kode 16. Titel 3 Gæring 11. Titel 4 Sundhed og kost 18 Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Juni 2014/2015 Institution Marie Kruses Skole Uddannelse Fag og niveau Lærer(e) Stx Bioteknologi A Ditte H.

Læs mere

Enzymer og katalysatorer

Enzymer og katalysatorer Enzymer og katalysatorer Reaktionsligningen: viser den kemiske reaktion, der leverer energi til alle stofskifteprocesser i cellerne i kroppen. Kemisk er der tale om en forbrændingsproces, hvori atmosfærisk

Læs mere

5. Bio A, Idræt B, Mat B

5. Bio A, Idræt B, Mat B Studieretningsbeskrivelse for 5. Bio A, Idræt B, Mat B I studieretningerne sætter de tre fag præg på undervisningen i klassens øvrige fag. Det sker gennem et samarbejde mellem to eller flere fag om et

Læs mere

Det interdisciplinære Nanoscience Center. Interdisciplinary Nanoscience Center Aarhus Universitet, Danmark www.inano.au.dk

Det interdisciplinære Nanoscience Center. Interdisciplinary Nanoscience Center Aarhus Universitet, Danmark www.inano.au.dk Det interdisciplinære Nanoscience Center Interdisciplinary Nanoscience Center Aarhus Universitet, Danmark www.inano.au.dk Hvem arbejder ved inano og AU Nøgletal 2009 Aarhus Universitet inano Akademisk

Læs mere

Danmarks Tekniske Universitet

Danmarks Tekniske Universitet Side 1 of 16 Danmarks Tekniske Universitet Skriftlig prøve, den 26/1-2012 Kursus navn: Kursus nr. 27633 Introduktion til Bioinformatik Tilladte hjælpemidler: Alle "Vægtning" Angivet ved de individuelle

Læs mere

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres.

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres. Epigenetik Men hvad er så epigenetik? Ordet epi er af græsk oprindelse og betyder egentlig ved siden af. Genetik handler om arvelighed, og hvordan vores gener videreføres fra generation til generation.

Læs mere

Nye tiltag på De Ingeniør-, Natur og Sundhedsvidenskabelige Fakulteter. Aalborg Universitet v/prodekan Lars Døvling Andersen

Nye tiltag på De Ingeniør-, Natur og Sundhedsvidenskabelige Fakulteter. Aalborg Universitet v/prodekan Lars Døvling Andersen Nye tiltag på De Ingeniør-, Natur og Sundhedsvidenskabelige Fakulteter Aalborg Universitet v/prodekan Lars Døvling Andersen 2 Ingeniør-, Natur og Sundhedsvidenskab Program Aftagerpaneler Ny school-struktur

Læs mere

Strukturen Projektarbejdet Studiemiljøet Karrieremuligheder

Strukturen Projektarbejdet Studiemiljøet Karrieremuligheder Den Naturvidenskabelige bacheloruddannelse The International Bachelor Study Program in Natural Science Strukturen Projektarbejdet Studiemiljøet Karrieremuligheder RUC s uddannelsesstruktur Optagelse Hum-Bas

Læs mere

Fri software for Microsoft Windows. Velkommen! V/ Carsten Agger, agger@c.dk

Fri software for Microsoft Windows. Velkommen! V/ Carsten Agger, agger@c.dk Fri software for Microsoft Windows Velkommen! V/ Carsten Agger, agger@c.dk Fri software for Microsoft Windows Hvorfor bruge fri software? Hvad er fri software? Hvad kan man med fri software? Hvad kan man

Læs mere

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer)

at du trænes i at genkende aminosyrer i en simpel proteinstruktur (pentapeptid = lille protein bestående af 5 (penta) aminosyrer) Elevvejledning til det Virtuelle Kræftlaboratorium Det Virtuelle Kræftlaboratorium stiller krav til en grundig forståelse af det centrale dogme inden for molekylærbiologien, hvordan DNA oversættes til

Læs mere

DNA og stamtræer. Fra DNA-sekvens til stamtræ. 50 Brug Botanisk Have i undervisningen

DNA og stamtræer. Fra DNA-sekvens til stamtræ. 50 Brug Botanisk Have i undervisningen DN og stamtræer Kan vi se skoven for bar træer? 11 Ole Seberg, professor*, oles@snm.ku.dk Gitte Petersen, professor*, gittep@snm.ku.dk * otanisk Have og Museum, Statens Naturhistoriske Museum Københavns

Læs mere

Side 1 af 7. Undervisningsbeskrivelse. Stamoplysninger til brug ved prøver til gymnasiale uddannelser. Termin. Maj 2014. Skive Tekniske Gymnasium

Side 1 af 7. Undervisningsbeskrivelse. Stamoplysninger til brug ved prøver til gymnasiale uddannelser. Termin. Maj 2014. Skive Tekniske Gymnasium Undervisningsbeskrivelse Stamoplysninger til brug ved prøver til gymnasiale uddannelser Termin Institution Uddannelse Fag og niveau Lærer(e) Hold Maj 2014 Skive Tekniske Gymnasium HTX Kemi B Trine Rønfeldt

Læs mere