Genetiske afstande og afstandsmatricer

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Genetiske afstande og afstandsmatricer"

Transkript

1 Genetiske afstande og afstandsmatricer Denne vejledning indeholder en række små øvelser og opgaver der illustrerer, hvordan man ud fra genetiske sekvenser kan udregne en gennemsnitlig evolutionær afstand mellem to sekvenser og benytte disse såkaldte p-afstande til at opbygge afstandsmatricer ud fra en multipel alignment. Vejledningen vil først give en kort introduktion til hvordan disse beregninger kan laves i hånden vha. små eksempler, hvorefter det vises hvordan dette hurtigt og nemt kan laves i programmet MEGA. Se link 3 i tema 12 i Bioteknologi 6 for en introduktion til MEGA. Beregning af evolutionær afstand mellem to sekvenser Den evolutionære afstand mellem to genetiske sekvenser kan defineres på mange måder. I denne vejledning vil vi udelukkende beskæftige os med to måder. De to metoder er det totale antal forskelle og den såkaldte p-afstand. Beregning af det totale antal forskelle mellem to sekvenser Givet en parvis alignment af to sekvenser kan man let optælle antallet af forskelle mellem de to sekvenser. Herunder er vist et simpelt eksempel med et lille udsnit af hæmoglobin A-proteinet fra henholdsvis mennesket (Homo sapiens) og koen (Bos taurus). Med rødt er markeret de to kolonner i den parvise alignment hvor de to sekvenser har forskellige aminosyrer. Menneske Ko MVLSPADKTNVKAAW MVLSAADKGNVKAAW Bemærk at der er anvendt et-bogstavskoden for aminosyrer, se Bioteknologi 6, side 10. Det totale antal forskelle mellem de to sekvenser i denne lille alignment er altså to. Ofte ignoreres kolonner hvor der er indsat et gap i den ene af de to sekvenser, i beregningen af det totale antal forskelle, men man kan selvfølgelig vælge at inddrage disse kolonner også i beregningen. Grunden til at man normalt udelader kolonner med gaps, er at det ikke er let at argumentere biologisk for hvordan de skal tælles med. Man kan selvfølgelig vælge den simpleste løsning at ethvert gap tæller som en forskel på lige fod med en aminosyreændring, men det har jeg valgt ikke at gøre i denne vejledning. Det betyder at hvis man har en alignment med mange gaps, så får man måske ikke et retvisende billede af den evolutionære afstand mellem de to sekvenser. Hvis vi tager ovenstående eksempel igen, men laver en anden alignment, fås følgende: Menneske Ko MVLSP-ADK-TNVKAAW MVLS-AADKG-NVKAAW Det totale antal forskelle mellem de to sekvenser i denne alignment er nu 0. Det kan jo se mærkeligt ud at den totale afstand her er 0, og det er det også. Problemet er dog ikke i måden at udregne det totale antal forskelle, men mere i at den viste alignment sandsynligvis ikke viser den rigtige evolutionære historie af de to sekvenser, og derfor giver det ikke så meget mening at beregne en evolutionær afstand mellem sekvenserne. Dette illustrerer vigtigheden i at have en god alignment når man skal lave biologisk sekvensanalyse. Ovenstående metode kan udføres på præcis samme måde hvad enten sekvenserne er nucleotider eller protein. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

2 Beregning af p-afstand mellem to sekvenser Det totale antal forskelle mellem to sekvenser er ikke et særligt informativt mål for den evolutionære afstand mellem to sekvenser da det jo afhænger af sekvensernes længde. Hvis vi antager at de evolutionære ændringer sker med ca. samme hastighed alle steder i genomet, vil vi forvente at det totale antal forskelle vil stige lineært som funktion af sekvensalignmentens længde. Derfor har vi brug for et andet mål, den såkaldte p-afstand, der lettere kan bruges til sammenligning mellem forskellige sekvenser, arter osv. Princippet i udregning af p-afstanden er blot at man ud fra en parvis alignment af to sekvenser og det totale antal forskelle, dividerer antal forskelle med længden af den parvise alignment fraregnet eventuelle gaps. Se eventuelt side 29 i Bioteknologi 6 for en nærmere forklaring af begrebet p-afstand. Lad os tage et eksempel. Herunder er vist en alignment af et udvalgt stykke af insulingenet og den tilsvarende proteinsekvens fra henholdsvis mennesket og koen. Nucleotidalignment Menneske GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG Ko GGA GGC CCG GGC GCG GGC GGC CTG GAG GGG Proteinalignment Menneske GGPGAGSLQPLALEG Ko GGPGAG-----GLEG Forskellene er markeret med rødt i de to alignments. I nucleotidalignmenten optælles det totale antal forskelle til fem, mens det i proteinalignmenten optælles til en. Forskellen på antal forskelle i nucleotid- og proteinalignmenten skyldes at fire ud af de fem ændringer i nucleotidalignmenten er synonyme, så de ændrer ikke den aminosyre det pågældende codon koder for. Der er ti codons af tre nucleotider i den øverste alignment når man fraregner codons med gaps. Tilsvarende er der ti aminosyrer i den nederste alignment når man fraregner gaps. P- afstandene bliver altså: Nucleotidalignment P-afstand = totale antal forskelle / antal nucleotider = 5 / 30 = 0,17 Proteinalignment P-afstand = totale antal forskelle / antal aminosyrer = 1 / 10 = 0,10 Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

3 Manuel opbygning af afstandsmatrice En afstandsmatrice er blot en tabel der viser samtlige parvise evolutionære afstande baseret på en multipel alignment. I en multipel alignment med N sekvenser vil der være: N 1 Antal parvise afstande = i i=1 Hvilket blot betyder at hvis der eksempelvis er N = 5 sekvenser, så er der = 10 parvise afstande. Afstandsmatricer fås i mange former, her vil vi fokusere på hvordan man laver en, der viser det totale antal forskelle, men det er trivielt at gøre det tilsvarende med p-afstande i stedet. Her tages udgangspunkt i et lille udsnit af en alignment af DNA-polymerase gamma-i fra fire arter, mus (Mus musculus), rotte (Rattus norvegicus), menneske (Homo sapiens) og gær (Saccharomyces cerevisiae). Udsnittet er vist herunder: Mus Rotte Menneske Gær SWAWAEGWTRYGP KWVWAEGWTRYGP AWAWAEGWTRYGP EWLRKPGWVKYVP Da der er N = 4 sekvenser, skal vi lave = 6 parvise afstande. Disse indsættes i en simpel tabel for overskuelighedens skyld. Tabellen kan se ud som vist herunder. Bemærk at der er indsat et 0 alle steder hvor de to sekvenser er ens og den ene halvdel af tabellen er hvid. Grunden til dette er at det ikke gør nogen forskel, om man sammenligner mus med rotte eller omvendt rotte med mus, resultatet bliver det samme. I Bioteknologi 6 kan du på side 30 se et eksempel hvor de blanke felter i stedet viser p-afstanden. Mus 0 Rotte 0 Menneske 0 Når man skal udfylde en afstandsmatrice, tager man to sekvenser ad gangen og beregner. Lad os starte med at sammenligne mus og rotte. Forskellene er markeret med rødt. Mus Rotte SWAWAEGWTRYGP KWVWAEGWTRYGP Alt i alt er det totale antal forskelle mellem de to sekvenser to. Dette indføres nu i afstandsmatricen. Mus 0 2 Rotte 0 Menneske 0 Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

4 På tilsvarende vis kan man nu lave en sammenligning mellem sekvenserne fra mus og menneske. Mus Menneske SWAWAEGWTRYGP AWAWAEGWTRYGP I dette tilfælde findes kun en forskel. Dette indsættes i afstandsmatricen, og denne ser nu ud som vist herunder. Med rødt er markeret den afstand vi lige har beregnet. Mus Rotte 0 Menneske 0 På fuldstændig tilsvarende vis kan de resterende fire parvise afstande udregnes, og resultatet bliver følgende: Mus Rotte Menneske 0 8 Det er selvfølgelig et meget lille eksempel og skulle man finde på at lave en evolutionær analyse af dette resultat, vil man komme frem til det overraskende resultat at mennesket og musens sekvenser er dem der ligner hinanden mest, og derfor er de måske tættest beslægtet af de fire arter. Dette er selvfølgelig ikke rigtigt da mus og rotte er meget tættere beslægtet med hinanden, end nogen af dem er med mennesket. Årsagen til dette er at datasættet er meget lille, og tilfældigheder spiller derfor en meget stor rolle. Havde man analyseret hele proteinet, får man nedenstående matrice: Mus Rotte Menneske Som man kan se, passer resultaterne nu med hvad vi umiddelbart ville forvente. Musen og rottens sekvenser er klart mere ens end de er med nogle andre sekvenser, og de tre pattedyr er markant mere ens end nogle af dem er med gær. Det kan umiddelbart virke som en større opgave at tælle 559 forskelle op i en alignment, og det er det også hvis man gør det i hånden, og risikoen for at lave tællefejl er meget stor. Derfor bruger vi i stedet computeren til at lave disse beregninger for os og som vi vil se i næste afsnit, så er det meget hurtigt og let at lave disse beregninger i MEGA. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

5 Udregning af afstandsmatricer i MEGA Efter at have lært og forstået hvordan disse matricer kan laves i hånden, er der ingen grund til at gøre det i hånden fremover. Ved hjælp af MEGA er det let, hurtigt og garanteret uden fejl at lave en afstandsmatrice hvis ellers ens alignment er indlæst/indtastet korrekt! 1. Åben MEGA og start en ny alignment explorer ved at vælge Align og Edit/Build Alignment. Vælg Create a new alignment og herefter Protein. Skærmbilledet skulle gerne se ud som vist herunder: 2. Indtast de fire korte sekvenser der blev brugt tidligere ved at vælge Edit og Insert Blank Sequence fire gange. Herefter navngives de fire sekvenser Mus, Rotte, Menneske og Ger (MEGA kan ikke acceptere danske ø, æ og å) ved at højreklikke på sekvensnavnene og vælge Edit Sequence Name. Mus SWAWAEGWTRYGP Rotte KWVWAEGWTRYGP Menneske AWAWAEGWTRYGP Gær EWLRKPGWVKYVP 3. Indtast ovenstående fire sekvenser. Nu ses skærmbilledet vist herunder: Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

6 4. Vælg Data og Phylogenetic Analysis og svar nej til at det er proteinkodende nucleotidsekvenser. Find MEGAs hovedvindue frem, det bør ligne nedenstående skærmbillede: Der er nu tre ikoner på dit MEGA-skrivebord. Det første ikon hvorpå der blandt andet er tegnet et rødt T og et blåt A, giver adgang til at se dine data i vinduet Sequence Data Explorer. Det næste ikon lukker dine data, og sidste ikon er dit Alignment Explorer -vindue. MEGA kan altid kun have et datasæt åbnet på skrivebordet ad gangen så hvis du åbner et andet, vil det nuværende forsvinde! 5. Klik på knappen Distance og vælg Compute Pairwise Distances hvorefter følgende vindue bør dukke op: Der er nu forskellige muligheder, det er muligt at din opsætning er lidt anderledes end skærmbilledet viser. Det vigtige her er at der under Substitution Model og ud for Model/Method i det gule felt står No. of differences, da det betyder at programmet giver en afstandsmatrice med de totale antal forskelle. 6. Indstil mulighederne i de gule felter hvis ikke det ser ud som vist herover og tryk derefter på Compute -knappen. Nu dukker der et nyt vindue op med den beregnede afstandsmatrice som vist øverst på næste side: Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

7 Man kan trykke på de forskellige indgange i tabellen. Her er vist hvad der sker når man trykker på indgangen der sammenligner sekvens 1 (mus) med sekvens 2 (rotte). Det eneste der ændrer sig, er den med gult markerede tekst i bunden af vinduet. Antal decimaler kan ændres med knapperne markeret med rødt på skærmbilledet. Tabellen kan vendes ved at trykke på den med grønt markerede knap. 7. Sammenlign den beregnede afstandsmatrice med nedenstående der blev beregnet i hånden. Er de to identiske? Mus Rotte Menneske 0 8 Hvorfor bruge MEGA? Med så små datasæt som ovenstående er der måske ikke den store tid sparet ved at bruge MEGA, men der er sikkerhed for at optællingerne og beregningerne er rigtige og når datasæt bliver bare en smule større, er det langt hurtigere at indtaste data i MEGA i stedet for at lave beregningerne i hånden. 8. Download den alignment der blev benyttet tidligere i udregningen af afstandsmatricen for hele polymerase gamma-i-proteinet, den kan hentes på nedenstående link: 9. Indlæs filen i MEGA, den letteste måde er at dobbeltklikke på filen så åbner den automatisk i MEGA. Før dette gøres, er det dog smart lige at lukke alle andre MEGA-vinduer så man ikke forvirrer sig selv senere. Virker dobbeltklik-metoden ikke, kan filen hentes ind i MEGA ved File og Open a File/Session i stedet. 10. Brug MEGA til at beregne en afstandsmatrice for denne markant større alignment. Resultatet bør se ud som vist herunder: Hvis ikke billedet ser ud som vist, kan du ændre antal decimaler og vende tabellen som beskrevet ovenfor. Du kan også ændre rækkefølgen af arterne i matricen ved at markere og trække et artsnavn. Hvis dette ikke løser problemet, er det nok ikke den rigtige sekvensfil der er indlæst. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

8 11. Luk vinduet med afstandsmatricen og prøv i stedet at få MEGA til at lave en afstandsmatrice baseret på de parvise p-afstande. Eneste ændring der er nødvendig, er under Substitution Model og Model/Method hvor No. of differences skal ændres til pdistance. Det er markeret med rødt på nedenstående skærmbillede. 12. Klik på Compute -knappen. Et vindue i stil med nedenstående dukker nu op: Husk at du kan ændre antallet af decimaler. Resultatet viser at i dette protein er der forskel på menneske og mus i 8,7 % af aminosyrerne. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

9 Opgaver til afstandsmatricer Herunder er der tre opgaver der alle omhandler afstandsmatricer. Opgave 1. Slægtskabsanalyser Til Biologi A august-eksamen 2008 handlede opgave 3 om slægtskabsanalyser og arters tilpasning til vand. I opgaven blev der angivet en multipel alignment som er vist herunder: Kænguru Blåhval Flodhest Zebra Næsehorn Ringsæl CACCACCACCAATACA ACCGATTCCCCACCCA ACCGGCATCCCGCCCA ACTCACACCTCATTCA ACTCACCCCTTTCTCA ACCAACCATTTATACA Desuden var der en delvist udfyldt afstandsmatrice som lettere redigeret er vist herunder: Kænguru Blåhval Flodhest Zebra Næsehorn Ringsæl Kænguru 0 Blåhval 0 Flodhest 10 0 Zebra Næsehorn Ringsæl Beregn de manglende afstande i hånden og udfyld matricen. 2. Indtast den multiple alignment i MEGA og beregn den fulde afstandsmatrice. Opgave 2. Menneskeaberne Mitokondrie-DNA bruges ofte til at fastslå slægtskab mellem arter. Download nedenstående fil fra hjemmesiden Indlæs filen i MEGA og lav en afstandsmatrice ud fra alignment i filen. Bemærk at man i MEGA kan ændre rækkefølgen i matricen ved at trække i de forskellige sekvensnavne. Udfyld afstandsmatricen herunder. Chimpanse Gorilla Bavian Bonobo Makak Orangutang Menneske Chimpanse 0 Gorilla 0 Bavian 0 Bonobo 0 Makak 0 Organgutang 0 Menneske 0 2. Forklar ud fra din afstandsmatrice hvor tæt mennesket er beslægtet med de forskellige andre primater. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

10 Opgave 3. Truede tigre En af de vejledende eksamensopgavesæt der udkom i 2007 indeholdt en opgave om truede tigre. I opgaven fik man en multipel nucleotidalignment af seks tigre, som vist herunder. Sibirisk tiger Sydkinesisk tiger Indokinesisk tiger I Indokinesisk tiger II Sumatra tiger Bengalsk tiger GCACCGTACCCCCCTCACTTTGTGGCACCTCTATATAATGCTACTAGGCTGCCG ACGCCGCACTCCCTCCGCTTTGTGGCATCTCTACATGATGCCATCAAGCCACTG GTACCGCACCCCCCTCGCTTTATAGCACTTCTATATAATGCTACTAGGCTGCTG GCGCCGCACCCCCCTCGCTTTGTGATATCTTTACGTAATGCTACTAGGCTGCCG ACGCCGCACCCCCTTCGCTTTGCGGCGTCTCTACATAACGCCATTAGGTTGCTG GCGCCGGACCCCCCTTGCTCTGTGGCATCTCTACATAACGTCATTAGACTGCTG Derudover var der i opgaven en delvist udfyldt afstandsmatrice, denne er vist herunder i et lidt anderledes format. Bengalsk tiger Sumatra tiger Indokinesisk tiger II Indokinesisk tiger I Siberisk tiger Sydkinesisk tiger Indokinesisk tiger I Indokinesisk tiger II Sumatratiger 10 Sydkinesisk tiger 1. Beregn de manglende afstande i hånden og udfyld matricen. 2. Indtast den multiple alignment i MEGA og beregn den fulde afstandsmatrice. Vær opmærksom på at afstandsmatricen i opgaven er opbygget på en lidt anderledes måde end MEGA viser den. Frank Grønlund Jørgensen Bioteknologi by Nucleus Forlag ISBN

Herunder er vist en afstandsmatrice for fem pattedyr: Ulv (U), moskusokse (M), kænguru (K), isbjørn (I) og vildsvin (V).

Herunder er vist en afstandsmatrice for fem pattedyr: Ulv (U), moskusokse (M), kænguru (K), isbjørn (I) og vildsvin (V). Fylogenetiske træer Dette dokument indeholder først et eksempel på hvordan man kan bruge UPGMA-metoden til at danne fylogenetiske træer ud fra en afstandsmatrice, og derefter en række øvelser der illustrerer

Læs mere

Databasesøgning med BLAST

Databasesøgning med BLAST Databasesøgning med BLAST Denne vejledning giver en introduktion til databasesøgning med forskellige programmer i BLAST-familien. Vejledningen indeholder først en grundig introduktion og gennemgang af

Læs mere

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik

Danmarks Tekniske Universitet. Løsningsforslag til Øvelse i Immonologisk Bioinformatik Danmarks Tekniske Universitet Løsningsforslag til Øvelse i Immonologisk Bioinformatik Indledning De følgende sider giver en gennemgang af de øverlser i har lavet under jeres besøg på DTU, som en del af

Læs mere

DMX styring med USB-interface

DMX styring med USB-interface DMX styring med USB-interface Introduktion...2 DMX bibliotek...3 Programmering af kanaler...7 Sådan skabes et show/en lyssekvens...11 Introduktion DMX LightPlayer er en avanceret men meget brugervenlig

Læs mere

Genetisk drift og naturlig selektion

Genetisk drift og naturlig selektion Genetisk drift og naturlig selektion Denne vejledning indeholder en gennemgang af simulationsværktøjer tilgængeligt online. Værktøjerne kan bruges til at undersøge effekten af populationsstørrelse på genetisk

Læs mere

APPENDIX A INTRODUKTION TIL DERIVE

APPENDIX A INTRODUKTION TIL DERIVE APPENDIX A INTRODUKTION TIL DERIVE z x y z=exp( x^2 0.5y^2) CAS er en fællesbetegnelse for matematikprogrammer, som foruden numeriske beregninger også kan regne med symboler og formler. Det betyder: Computer

Læs mere

Maple. Skærmbilledet. Vi starter med at se lidt nærmere på opstartsbilledet i Maple. Værktøjslinje til indtastningsområdet. Menulinje.

Maple. Skærmbilledet. Vi starter med at se lidt nærmere på opstartsbilledet i Maple. Værktøjslinje til indtastningsområdet. Menulinje. Maple Dette kapitel giver en kort introduktion til hvordan Maple 12 kan benyttes til at løse mange af de opgaver, som man bliver mødt med i matematiktimerne på HHX. Skærmbilledet Vi starter med at se lidt

Læs mere

Excel-1: kom godt i gang!!

Excel-1: kom godt i gang!! Excel-1: kom godt i gang!! Microsoft Excel er et såkaldt regneark, som selvfølgelig bliver brugt mest til noget med tal men man kan også arbejde med tekst i programmet. Excel minder på mange områder om

Læs mere

I denne manual kan du finde en hurtig introduktion til hvordan du:

I denne manual kan du finde en hurtig introduktion til hvordan du: VORES NORDSJÆLLAND HURTIGT I GANG MANUAL 01: Bruger HVAD INDEHOLDER DENNE MANUAL? I denne manual kan du finde en hurtig introduktion til hvordan du: 1. Finder Vores Nordsjælland hjemmesiden 2. Opretter

Læs mere

Sektornet VPN Installationsvejledning Windows Vista/7

Sektornet VPN Installationsvejledning Windows Vista/7 Sektornet VPN Installationsvejledning Windows Vista/7 Version 5.0 Af Jesper Skou Jensen og Mads Udengaard Sørensen 1 Start installationen 1 1 Indledning Denne vejledning gennemgår opsætning af Sektornet

Læs mere

SÅDAN BRUGER DU REGNEARK INTRODUKTION

SÅDAN BRUGER DU REGNEARK INTRODUKTION SÅDAN BRUGER DU REGNEARK INTRODUKTION I vejledningen bruger vi det gratis program Calc fra OpenOffice som eksempel til at vise, hvordan man bruger nogle helt grundlæggende funktioner i regneark. De øvrige

Læs mere

En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau)

En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau) Matematik i WordMat En lille vejledning til lærere og elever i at bruge matematikprogrammet WordMat (begynderniveau) Indholdsfortegnelse 1. Introduktion... 3 2. Beregning... 4 3. Beregning med brøker...

Læs mere

DM01 DM01. 4. Obl. Afl. Jacob Christiansen, 130282, jacob.ch@mail.tdcadsl.dk. D12, Elias 13/5-2003. Side 1 af 7

DM01 DM01. 4. Obl. Afl. Jacob Christiansen, 130282, jacob.ch@mail.tdcadsl.dk. D12, Elias 13/5-2003. Side 1 af 7 DM01 DM01 4. Obl. Afl. Jacob Christiansen, 130282, jacob.ch@mail.tdcadsl.dk D12, Elias 13/5-2003 Side 1 af 7 DM01 Indholdsfortegnelse: BILAG:...2 1 FORMÅL:...3 2 KLASSER:...4 2.1 DNA2:...4 2.1.1 METODER:...4

Læs mere

Indholdsfortegnelse. Indhold

Indholdsfortegnelse. Indhold Indholdsfortegnelse Indhold Login... 2 Registrér komme / gå tider... 4 Flere arbejdsperioder på samme dag?... 6 Frokostpause / ret Frokostpause... 7 Sletning... 8 Afslut uge... 9 Godkendte/afviste ugesedler...

Læs mere

Kom godt i gang med DLBR Webdyr

Kom godt i gang med DLBR Webdyr Kom godt i gang med DLBR Webdyr Kom godt i gang med DLBR Webdyr Udgivet Februar 2011 Redaktør Tryk Videncentret for Landbrug Videncentret for Landbrug Udgiver Videncentret for Landbrug, KvægIT, 8740 5000

Læs mere

Konvertering af DADAS data til Reitan VI-skema

Konvertering af DADAS data til Reitan VI-skema Konvertering af DADAS data til Reitan VI-skema GS1 Denmark Version 5 Juli 2012 1 Konvertering af DADAS data til alternativt vareindmeldelsesskema Skal man konvertere data fra SINFOS/DADAS om til et alternativt

Læs mere

χ 2 -test i GeoGebra Jens Sveistrup, Gammel Hellerup Gymnasium

χ 2 -test i GeoGebra Jens Sveistrup, Gammel Hellerup Gymnasium χ 2 -test i GeoGebra Jens Sveistrup, Gammel Hellerup Gymnasium Man kan nemt lave χ 2 -test i GeoGebra både goodness-of-fit-test og uafhængighedstest. Den følgende vejledning bygger på GeoGebra version

Læs mere

Modul 1 Skolens netværk og FirstClass (FC)

Modul 1 Skolens netværk og FirstClass (FC) Modul 1 Skolens netværk og FirstClass (FC) Computerens netværksdrev og mappen dokumenter Gå ind i "Denne computer" (ikonet ligger på skrivebordet). Her ligger de netværksdrev computeren råder over og separate

Læs mere

Kom godt i gang med I-bogen

Kom godt i gang med I-bogen Kom godt i gang med I-bogen At åbne bogen Det allerførste, du skal gøre, for at kunne arbejde med i-bogen, er at aktivere den. Det gøres ved at oprette en konto på systime.dk og derefter aktivere bogen

Læs mere

Styresystemet er den del af softwaren, der sammenkæder hardware og brugerprogrammer, således at de kan arbejde sammen.

Styresystemet er den del af softwaren, der sammenkæder hardware og brugerprogrammer, således at de kan arbejde sammen. Hvad sker der, når der tændes for PC en? Når computeren tændes, kontrolleres en række funktioner, bl.a. ram, harddisk, mus, tastatur, diskettedrev og lignende, før det rigtige Windows- billede vises på

Læs mere

Oprettelse af en Gmail-konto

Oprettelse af en Gmail-konto Oprettelse af en Gmail-konto 1. Åbn startsiden til Gmail fra adressen: www.gmail.com. I højre side af skærmen får du nu følgende skærmbillede: De to øverste bjælker, markeret med Brugernavn og Adgangskoder,

Læs mere

PC - installation af Maple 18 med GYM-pakken

PC - installation af Maple 18 med GYM-pakken PC - installation af Maple 18 med GYM-pakken Download først de relevante installere til både Maple 18 og til Gym-pakken, og placer dem et sted på din PC, hvor du kan finde dem igen. Hvis du højre-klikker

Læs mere

Kl. mikrobiologisk afdeling Side 1 af 15 Hvidovre Hospital vers.1.6

Kl. mikrobiologisk afdeling Side 1 af 15 Hvidovre Hospital vers.1.6 Kl. mikrobiologisk afdeling Side 1 af 15 Indholdsfortegnelse: Generelt om WWBakt...3 Brugere...3 Anvendelse af patientoplysninger....3 Adgang til programmet...3 Anbefalet skærmindstilling....3 Log på programmet...4

Læs mere

Arrangementer i Listevisning

Arrangementer i Listevisning Kort introduktion til Typo3-plugin ARRANGEMENTER. De indledende øvelser er fuldstændig de samme som i TYPO3 TRIN FOR TRIN 1 side 1-2. Du åbner altså din browser (Internet Explorer er den almindeligste),

Læs mere

Sådan indlægges nyheder på DSqF s hjemmeside trin for trin

Sådan indlægges nyheder på DSqF s hjemmeside trin for trin Sådan indlægges nyheder på DSqF s hjemmeside trin for trin Systemkrav For at kunne bruge Composite kræves: Windows 95 eller nyere (bemærk - kun Windows kan bruges) Browseren Internet Explorer 6.0 eller

Læs mere

Q-Variant i kasseterminalen

Q-Variant i kasseterminalen Q-Variant i kasseterminalen Q-Variant findes her i en mere enkel udgave, der benyttes i kasseterminalen og i restaurantdelen for hurtigt at kunne finde frem til varer, der ikke har stregkode. Klik på i

Læs mere

Introduktion til EXCEL med øvelser

Introduktion til EXCEL med øvelser Side 1 af 10 Introduktion til EXCEL med øvelser Du kender en almindelig regnemaskine, som kan være til stort hjælp, når man skal beregne resultater med store tal. Et regneark er en anden form for regnemaskine,

Læs mere

IT-Brugerkursus. Modul 1 - Introduktion til skolens netværk og FC. Modul 1 - Introduktion til FC og Lectio. Printvenligt format. Indholdsfortegnelse

IT-Brugerkursus. Modul 1 - Introduktion til skolens netværk og FC. Modul 1 - Introduktion til FC og Lectio. Printvenligt format. Indholdsfortegnelse Modul 1 - Introduktion til FC og Lectio IT-Brugerkursus Modul 1 - Introduktion til skolens netværk og FC Printvenligt format Indholdsfortegnelse Formål og opbygning Opgave Vejledning til intranettet Åbne

Læs mere

Manual til Dynamicweb Februar 2010

Manual til Dynamicweb Februar 2010 Manual til Dynamicweb Februar 2010 Login... 2 Skabeloner og formater... 3 Filarkivet... 4 Lav en PDF... 5 Opret en ny side... 7 Navngiv siden... 9 Aktiver siden... 9 Sorter sider... 9 Flyt siden... 11

Læs mere

Udlæsning af stregkodefil til scanneren 1. Opret mappen pdt på C-drevet (c:\pdt).

Udlæsning af stregkodefil til scanneren 1. Opret mappen pdt på C-drevet (c:\pdt). Indholdsfortegnelse Introduktion... 2 Udlæsning af stregkodefil til scanneren... 3 Installation af scanneren... 5 Indlæsning af datafil i scanneren... 7 Brug af scanneren... 8 Sådan scanner du... 8 Sådan

Læs mere

7. Indstilling af den trådløse forbindelse i Windows XP

7. Indstilling af den trådløse forbindelse i Windows XP 7. Indstilling af den trådløse forbindelse i Windows XP Gør klar til indstilling Når du skal i gang med at konfigurere den computer, der skal væres trådløs, er det en god idé at bevare kabelforbindelsen

Læs mere

Konvertering af DADAS data til Dansk Supermarked VI-skema

Konvertering af DADAS data til Dansk Supermarked VI-skema Konvertering af DADAS data til Dansk Supermarked VI-skema GS1 Denmark Version 5 November 2012 1 Konvertering af DADAS data til alternativt vareindmeldelsesskema Skal man konvertere data fra SINFOS/DADAS

Læs mere

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

Kursusbeskrivelse. Forarbejde. Oprettelse af en Access-database

Kursusbeskrivelse. Forarbejde. Oprettelse af en Access-database Kursusbeskrivelse Oprettelse af en Access-database Som eksempel på en Access-database oprettes en simpelt system til administration af kurser. Access-databasen skal indeholde: et instruktørkartotek et

Læs mere

Indholdsfortegnelse. Indhold

Indholdsfortegnelse. Indhold Indholdsfortegnelse Indhold Login... 2 Registrér komme / gå tider... 4 Flere arbejdsperioder på samme dag?... 5 Frokostpause / ret Frokostpause... 7 Sletning... 8 Afslut måned... 9 Godkendte/afviste måneder...

Læs mere

SPSS introduktion Om at komme igang 1

SPSS introduktion Om at komme igang 1 SPSS introduktion Om at komme igang 1 af Henrik Lolle, oktober 2003 Indhold Indledning 1 Indgang til SPSS 2 Frekvenstabeller 3 Deskriptive statistikker gennemsnit, standardafvigelse, median osv. 4 Søjlediagrammer

Læs mere

Indhold. Tablet Guides

Indhold. Tablet Guides Indhold Start tablet og Arbejdsmiljøbog... 2 Grund indstillinger... 3 Opret notat i PDF... 5 Overfør Arbejdsmiljøbogen fra PC til tablet... 6 Overfør filer mellem PC og tablet... 9 Start tablet og Arbejdsmiljøbog

Læs mere

Manual til AVG Antivirus

Manual til AVG Antivirus Manual til AVG Antivirus Det anbefales, at alle brugere benytter sig af et antivirus-program. Formålet med programmet er at forhindre din computer i at blive smittet med virus. Virus-inficerede computere

Læs mere

I. SMART Board. I. SMART Board... 1 II. Forord... 2 III. Smartboard værktøjskasse... 2. IV. Turorials... 3 V. SMART Notebook... 4

I. SMART Board. I. SMART Board... 1 II. Forord... 2 III. Smartboard værktøjskasse... 2. IV. Turorials... 3 V. SMART Notebook... 4 I. SMART Board I. SMART Board... 1 II. Forord... 2 III. Smartboard værktøjskasse... 2 A. Tastatur... 3 B. Optager... 3 C. Kontrolpanel... 3 IV. Turorials... 3 V. SMART Notebook... 4 A. En Notebookside

Læs mere

Cash Flow Forecast 1

Cash Flow Forecast 1 Cash Flow Forecast 1 Indholdsfortegnelse Introduktion til Cash Flow Forecast... 3 Formål... 3 Du kan... 3 Det skal du bruge for at få adgang til værktøjet... 3 Cash Flow Forecast egenskaber... 3 Tilføjelser...

Læs mere

Regneark LibreOffice. Øvelseshæfte. Version: September 2013

Regneark LibreOffice. Øvelseshæfte. Version: September 2013 Regneark LibreOffice Øvelseshæfte Version: September 2013 Indholdsfortegnelse Øvelserne...4 Øvelse 1 Gem en kopi...4 Øvelse 2 Omdøb faneblad + lav en kopi...4 Øvelse 3 - tekstombrydning...5 Øvelse 4 Sorter

Læs mere

Vejledning til RSS (FEEDS)

Vejledning til RSS (FEEDS) Vejledning til RSS (FEEDS) Hvis du vil følge med i hvad der sker på hjemmesider uden at skulle bruge tid og energi på at gå ind og kigge på dem så er feeds eller RSS (really simple syndication) løsningen.

Læs mere

Introduktion til CD ere og Arkivdeling Gammel Dok - September-oktober 2003. Jonas Christiansen Voss

Introduktion til CD ere og Arkivdeling Gammel Dok - September-oktober 2003. Jonas Christiansen Voss Introduktion til CD ere og Arkivdeling Gammel Dok - September-oktober 2003 Jonas Christiansen Voss 2. marts 2004 Indhold 1 CD ere 2 1.1 Brænde dokumenter til CD....................... 2 1.2 Disk Copy.................................

Læs mere

Indhold Opstartsprocedure... 3 Dankort... 3 Korrekt åbningsprocedure af dankortterminalen... 4 Korrekt lukkeprocedure af dankortterminalen...

Indhold Opstartsprocedure... 3 Dankort... 3 Korrekt åbningsprocedure af dankortterminalen... 4 Korrekt lukkeprocedure af dankortterminalen... Quickguide Indhold Opstartsprocedure... 3 Dankort... 3 Korrekt åbningsprocedure af dankortterminalen... 4 Korrekt lukkeprocedure af dankortterminalen... 4 Logon på Dynamics NAV... 4 Overblik over Dynamics

Læs mere

Immunologisk bioinformatik

Immunologisk bioinformatik Immunologisk bioinformatik Øvelsesvejledning Introduktion til øvelsen Når man i dagligdagen taler om influenza, bliver virussen ofte forbundet med forbigående og ufarlig sygdom. Som regel har mennesker

Læs mere

Åbn Paint, som er et lille tegne- og billedbehandlingsprogram der findes under Programmer i mappen Tilbehør. Åbn også Word.

Åbn Paint, som er et lille tegne- og billedbehandlingsprogram der findes under Programmer i mappen Tilbehør. Åbn også Word. 75 Paint & Print Screen (Skærmbillede med beskæring) Åbn Paint, som er et lille tegne- og billedbehandlingsprogram der findes under Programmer i mappen Tilbehør. Åbn også Word. 1. Minimer straks begge

Læs mere

Kom i gang med Course Tool 1.2

Kom i gang med Course Tool 1.2 Kom i gang med Course Tool 1.2 Indhold Indledning...2 Pris beregning...2 Anvendelse...2 Open Source...2 Anbefalinger...2 Installation...3 USB-Pen...3 Download Libre Office (Draw)...3 Indstil makrosikkerhed...4

Læs mere

Upload af billeder til hjemmesiden m.m.

Upload af billeder til hjemmesiden m.m. Upload af billeder til hjemmesiden m.m. Fremgangsmåde VVS-inst.dk Upload af billeder m.m., Side 1 Så går vi i gang Åben Firefox browseren Gå ind på denne adresse, for at komme til hjemmeside programmet.

Læs mere

Brugervejledning til hurtig start af EasyBusiness Online Indholdsfortegnelse:

Brugervejledning til hurtig start af EasyBusiness Online Indholdsfortegnelse: Brugervejledning til hurtig start af EasyBusiness Online Indholdsfortegnelse: 1. Hvordan du bliver tilsluttet EasyBusiness...2 2. Hvordan du foretager en søgning...2 3. Hvordan du gemmer og åbner en søgning...4

Læs mere

- Forøg værdien i SETUP tilstand og Alarm funktionen

- Forøg værdien i SETUP tilstand og Alarm funktionen Introduktion Denne digitale skridttæller viser antal skridt gået, afstand tilbagelagt, kalorier forbrændt, den totale træningstid, og har 30 dages hukommelse, blandt andre nyttige funktioner. Det er også

Læs mere

Sådan redigerer du en hjemmeside i Umbraco

Sådan redigerer du en hjemmeside i Umbraco Brugermanual til din boligafdelings hjemmeside Sådan redigerer du en hjemmeside i Umbraco Indhold Introduktion... 2 Log på Umbraco og redigér din hjemmeside... 3 Opret ny side... 7 Gem side uden at udgive/publicere

Læs mere

Jet Reports tips og tricks

Jet Reports tips og tricks Jet Reports tips og tricks Af Peter Christoffersen Ejer og grundlægger af Zeezit Zeezit Prinsensgade 20 9000 Aalborg info@zeezit.dk www.zeezit.dk Indledning Zeezit er grundlagt af Peter Christoffersen,

Læs mere

Udlæsning af opslagsfil til scanneren 1. Opret mappen pdt på C-drevet (c:\pdt).

Udlæsning af opslagsfil til scanneren 1. Opret mappen pdt på C-drevet (c:\pdt). Indholdsfortegnelse Introduktion... 2 Udlæsning af opslagsfil til scanneren... 3 Installation af scanneren... 4 Indlæsning af datafil i scanneren... 6 Brug af scanneren... 7 Sådan scanner du... 7 Tømning

Læs mere

Oktober Dokumentpakker

Oktober Dokumentpakker Oktober 2017 Dokumentpakker Dokumentpakkerne er et værktøj til at udskrive dynamiske breve, som har en standardtekst i brevet, og hvor der automatisk sættes blandt andet patientens navn, adresse og aftaletid

Læs mere

Bruger Manual PC Valtronics IP Kamera - Windows system

Bruger Manual PC Valtronics IP Kamera - Windows system Bruger Manual PC Valtronics IP Kamera - Windows system Brugervejledning til PC (windows) 1. Installation af kamera Vejledningen er almen for alle Valtronics kameraer, og derfor kan billederne af de forskellige

Læs mere

Opsætning af internet gennem Bolignet-Aarhus

Opsætning af internet gennem Bolignet-Aarhus Opsætning af internet gennem Bolignet-Aarhus Denne vejledning er henvendt til brugere af computere, som benytter Windows XP som styresystem. Windows XP adskiller sig en del fra de øvrige styresystemer.

Læs mere

Velkommen til IT for let øvede

Velkommen til IT for let øvede Velkommen til IT for let øvede Kursus er hjælp til selvhjælp og I får mest ud af det, hvis I også derhjemme afsætter nogle timer til øvelser på jeres computer. Vi sørger for hjemmeopgaver!! Der er masser

Læs mere

Tastevejledning Windows XP

Tastevejledning Windows XP Tastevejledning Windows XP Tastevejledningen dækker den danske udgave af Windows XP. Der er taget udgangspunkt i en standard installation, hvor der ikke er foretaget tilpasninger i skærmopsætning, valg

Læs mere

Vejledning til opbygning af hjemmesider

Vejledning til opbygning af hjemmesider Side 1 af 9 Vejledning til opbygning af hjemmesider Hvis du er inde på din klubs hjemmeside, fx på forsiden, kan du nu gå i gang med at redigere. For at få redigeringsværktøjet frem, skal du klikke på

Læs mere

Fra Blåt Medlem til Excel.

Fra Blåt Medlem til Excel. Fra Blåt Medlem til Excel. Kopi fra Blåt Medlem til Excel 1 Eksport fra Blåt Medlem til Excel 2 Hvad kan du bruge det til 5 Eksempler: Medlemsdelen: Afdelingsopdelt liste med spejderne 5 Fødselsdage og

Læs mere

Regneark for begyndere

Regneark for begyndere Regneark for begyndere Regneark i Open- og LibreOffice Version: August 2012 Indholdsfortegnelse Hvad er et regneark?...4 Grundlæggende opbygning...4 Kast dig ud i det!...5 Du arbejder med: Din første

Læs mere

Kommende nyheder i WinKompas 3.6.50

Kommende nyheder i WinKompas 3.6.50 Kommende nyheder i WinKompas 3.6.50 Vi forventer at næste version af WinKompas bliver frigivet omkring 01-11-2013 Vi har lavet flere ændringer i den nye version, blandt andet får du 2 nye funktionaliteter:

Læs mere

27611 Eksamen Sommer 2007

27611 Eksamen Sommer 2007 - Side 1 af 10-27611 Eksamen Sommer 2007 Dette sæt indeholder 4 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan, under selve eksamen (25. Maj 2007 klokken 9:00

Læs mere

Du har nu en genvej på dit skrivebord hen til den mappe hvor dine filer med bøgerne kommer til at ligge, den virkelige sti = c:\bøger.

Du har nu en genvej på dit skrivebord hen til den mappe hvor dine filer med bøgerne kommer til at ligge, den virkelige sti = c:\bøger. Download af bøger i MP3 format Side 1 af 6 Forudsætninger for at kunne benytte denne mulighed er: En computer med rimelig diskplads (hvert bog fylder små 200 MB). En god Internetforbindelse, for ikke at

Læs mere

BONUSINFORMATIONER i forbindelse med emnet Billeder og grafik

BONUSINFORMATIONER i forbindelse med emnet Billeder og grafik BONUSINFORMATIONER i forbindelse med emnet Billeder og grafik Dette dokument indeholder yderligere informationer, tips og råd angående: Tabelfunktionen SmartArtfunktionen Billedfunktionen Samt en ekstra

Læs mere

Langtved Data A/S Nyhedsbrev

Langtved Data A/S Nyhedsbrev Langtved Data A/S Nyhedsbrev Nr. 2 Indledning I denne udgave af nyhedsbrevet har vi valgt at sætte fokus på interessante faciliteter som allerede benyttes af nogle af vores kunder og som kunne være interessante

Læs mere

FOTO strategi Gem Udvælg Rediger Gem

FOTO strategi Gem Udvælg Rediger Gem FOTO strategi 1. Gem billederne i en mappe på skrivebordet a. Opret en mappe på skrivebordet og navngiv den evt. med årstallet. b. Kopier billederne i kameraets DCIM-mappe og sæt den ind i mappen på skrivebordet.

Læs mere

Opsætning af klient til Hosted CRM

Opsætning af klient til Hosted CRM Opsætning af klient til Hosted CRM Dette dokument beskriver, hvordan der oprettes forbindelse til en Hosted CRM løsning hos TDC Hosting A/S Morten Skovgaard, 24. april 2006 1 Indledning... 2 2 Konfiguration

Læs mere

Fase Forklaring Navigation. Mappen skal indeholde alle elementer til dit site.

Fase Forklaring Navigation. Mappen skal indeholde alle elementer til dit site. 1 Opstart af et site Opret hovedmappen Opret grafikmappen Opret dit site Mappen skal indeholde alle elementer til dit site. Opret en mappe indeni den første og kald den grafik. Heri lægges alle dine grafikfiler.

Læs mere

Hvis du ikke kan logge på systemet, skal du kontakte den Navisionkontaktansvarlige i dit team, der kan bestille en adgang til dig.

Hvis du ikke kan logge på systemet, skal du kontakte den Navisionkontaktansvarlige i dit team, der kan bestille en adgang til dig. Notat 22. maj 2012 SAM/Momsekspertgruppen Vejledning til ØS LDV rapport for momssandsynliggørelse Vejledningen har til formål at beskrive fremgangsmåden for at trække momssandsynliggørelsesrapporter, finde

Læs mere

Dansk Cardiologisk Selskab Arbejdsgruppefunktioner på cardio.dk

Dansk Cardiologisk Selskab Arbejdsgruppefunktioner på cardio.dk Dansk Cardiologisk Selskab Arbejdsgruppefunktioner på cardio.dk ARBEJDSGRUPPESIDE 1 2 4 1. Arbejdsgruppetitel (låst) 2. Medlemsoversigt (autogenereret) 3. Opslagstavle der kan udfyldes af nukleus 5 4.

Læs mere

Udligning af debitorer og kreditorer i ectrl

Udligning af debitorer og kreditorer i ectrl Udligning af debitorer og kreditorer i ectrl En af de mange funktioner til styring af skyldige fakturaer hos leverandører eller tilgodehavender hos kunder er åbenpostudligning. Åbenpostudligningen går

Læs mere

Picto Selector. Lav dine egne flotte symbolark på den nemme måde. Version: Oktober 2012

Picto Selector. Lav dine egne flotte symbolark på den nemme måde. Version: Oktober 2012 Picto Selector Lav dine egne flotte symbolark på den nemme måde Version: Oktober 2012 Indholdsfortegnelse Hvad er Picto Selector?...4 USB?...4 Hent programmet...4 Installer programmet på din computer...5

Læs mere

Vejledning til brug af i-bogen Biologi i udvikling

Vejledning til brug af i-bogen Biologi i udvikling Vejledning til brug af i-bogen Biologi i udvikling I-bogen Biologi i udvikling er baseret på et system hvor lærerne har en lærerbog og eleverne hver deres personlige elevbog. En interessant konsekvens

Læs mere

Dansk. 1. Er sproget Dansk i Open Office og er der dansk stavekontrol?

Dansk. 1. Er sproget Dansk i Open Office og er der dansk stavekontrol? NEED TO KNOW Nedenstående er et bud på nogle af de funktioner man kan have glæde af i Open Office når man skriver opgaver til skolen. - Nedenstående er alene en anvisning på nogle af de punkter der står

Læs mere

Vejledning PROPHIX 11. Driftsbudgettering ved åbning af templates (Kun til Avanceret-brugere)

Vejledning PROPHIX 11. Driftsbudgettering ved åbning af templates (Kun til Avanceret-brugere) PROPHIX 11 Systemansvarlige Michael Siglev Økonomiafdelingen 9940 3959 msi@adm.aau.dk Daniel Nygaard Ricken Økonomiafdelingen 9940 9785 dnr@adm.aau.dk Vejledning (Kun til Avanceret-brugere) Opdateret:

Læs mere

Skabelonfilen er udarbejdet i Word til Windows (Office 2010) og er også afprøvet i Word til Mac.

Skabelonfilen er udarbejdet i Word til Windows (Office 2010) og er også afprøvet i Word til Mac. Nordiske Studier i Leksikografi 13 (København 2015) Brug af stilark Vi vil gerne have at alle forfattere benytter den Word-fil som redaktionen har udarbejdet og sendt ud, både forfattere og redaktører

Læs mere

E-MAIL MICROSOFT OUTLOOK 2010

E-MAIL MICROSOFT OUTLOOK 2010 E-MAIL MICROSOFT OUTLOOK 2010 Erik Thorsager, Esbjerg. 3. udgave: Outlook Side 1 Microsoft Outlook 2010 Hvordan skriver og sender jeg en e-mail? Det engelske ord mail betyder post. E står for elektronisk.

Læs mere

Uddannelsesplaner i MinUddannelse

Uddannelsesplaner i MinUddannelse Uddannelsesplaner i MinUddannelse Denne vejledning giver et overblik over arbejdet med MinUddannelse fra en UU-vejleders synspunkt. Indhold 1. Introduktion... 2 2. Tekniske specifikationer... 2 3. Som

Læs mere

EG Retail - www.eg.dk/retail. Minimanual. SVANEN Grundlæggende

EG Retail - www.eg.dk/retail. Minimanual. SVANEN Grundlæggende EG Retail - www.eg.dk/retail Minimanual SVANEN Grundlæggende Indholdsfortegnelse 1 Opret en vare... 3 2 Overfør data til kassen... 4 3 Udskriv etiketter... 5 4 Udskriv skilte... 6 5 Elektronisk post og

Læs mere

Vejledning til online blanketten Industriens salg af varer

Vejledning til online blanketten Industriens salg af varer Vejledning til online blanketten Industriens salg af varer Din vej gennem blanketten Her er en kort vejledning om hvordan du udfylder online blanketten trin for trin. Har du spørgsmål, er du velkommen

Læs mere

Manual Serif Web & Tableau Public

Manual Serif Web & Tableau Public Manual Serif Web & Tableau Public Indhold 2 Start 3 Festivalprogram 4-19 Kursuskatalog 20-22 Dramaskolehold 23-28 Visitkort konsulenter 29-30 Visitkort scener 31-35 Amatørkulturens tal 36-42 VIGTIGT! For

Læs mere

Go-Kart DMKA Dokumentation

Go-Kart DMKA Dokumentation Go-Kart DMKA Dokumentation April 2009 v.1 Created by MwaZone Auther Mark Weber Andersen Page 2 of 21 Indhold Sidens struktur og opbygning... 3 A. Log-ind... 4 B. Redigere side indhold... 5 Overblik...

Læs mere

Brugervejledning. People Software Solutions Ltd. Version: 2011.1.24

Brugervejledning. People Software Solutions Ltd. Version: 2011.1.24 Brugervejledning People Software Solutions Ltd. Version: 2011.1.24 1 Start programmet Isæt USB-nøglen i et ledigt USB-stik på computeren. Klik på: Klik på ikonet, når mappen på USB-nøglen er åbnet. Skulle

Læs mere

IMPORT AF TILBAGEMELDINGER I UVVEJ

IMPORT AF TILBAGEMELDINGER I UVVEJ IMPORT AF TILBAGEMELDINGER I UVVEJ Portalen har til formål at sikre en hurtig og sikker tilbagemelding på elever, som er udmeldt eller startet på en af følgende inst.: Efterskole, Privatskole, Friskole,

Læs mere

Sådan opretter du en elektronisk aflevering

Sådan opretter du en elektronisk aflevering Sådan arbejder du med opgaver i Gradebook/karakterbog Denne vejledning indeholder en detaljeret beskrivelse af hvordan du bruger gradebook/karakterbogen når du vil arbejde med opgaver og give karakterer

Læs mere

vorbasse.dk Redaktørmanual Kentaur

vorbasse.dk Redaktørmanual Kentaur Redaktørmanual Kentaur Indholdsfortegnelse Kapitel 1 - TYPO3 Brugerfladen 3 Log ind 3 Backend 4 Frontend 5 Hvor skal jeg klikke? 5 Gem, gem og vis, gem og luk 6 Kapitel 2 - Sider & menuer 7 Sammenhæng

Læs mere

FitLight Trainer brugsvejledning. Tablet controller. version 1.7

FitLight Trainer brugsvejledning. Tablet controller. version 1.7 FitLight Trainer brugsvejledning Tablet controller version.7 Indhold Opbevaring og opladning... Opret brugere... Forbind lamper... 4 Kørsel af tilfældig sekvens - bestemt tidsrum... 5 Kørsel af tilfældig

Læs mere

EG Bolig Web for beboervalgte Vejledning

EG Bolig Web for beboervalgte Vejledning EG Bolig Web for beboervalgte Vejledning 1 Indholdsfortegnelse 1 At logge på EG Bolig Web 3 2 Menupunktet Standard 4 3 Menupunktet økonomi 4 o 3.1 Finansudskrifter 5 4 Menupunktet Lejer 8 o 4.1 Lejerkartotek

Læs mere

INSTALLATIONS GUIDE. Waoo leveres af dit lokale energiselskab. Er du. Sikkerhedspakke (Chili Security) TIL PC, MAC OG ANDROID

INSTALLATIONS GUIDE. Waoo leveres af dit lokale energiselskab. Er du. Sikkerhedspakke (Chili Security) TIL PC, MAC OG ANDROID INSTALLATIONS GUIDE Sikkerhedspakke (Chili Security) TIL PC, MAC OG ANDROID Waoo leveres af dit lokale energiselskab. Er du INDHOLD PC...4 Mac...10 Android...18 PC Sådan installerer du Chili Security

Læs mere

Daglig brug af JitBesked 2.0

Daglig brug af JitBesked 2.0 Daglig brug af JitBesked 2.0 Indholdsfortegnelse Oprettelse af personer (modtagere)...3 Afsendelse af besked...4 Valg af flere modtagere...5 Valg af flere personer der ligger i rækkefølge...5 Valg af flere

Læs mere

Kommentarer til øvelser i basalkursus, 2. uge

Kommentarer til øvelser i basalkursus, 2. uge Kommentarer til øvelser i basalkursus, 2. uge Opgave 2. Vi betragter målinger af hjertevægt (i g) og total kropsvægt (målt i kg) for 10 normale mænd og 11 mænd med hjertesvigt. Målingerne er taget ved

Læs mere

5.0 Velkommen til manualen for kanalen HTML-grab Introduktion til kanalen HTML-grab kanalside Hvad er et spot?

5.0 Velkommen til manualen for kanalen HTML-grab Introduktion til kanalen HTML-grab kanalside Hvad er et spot? 5.0 Velkommen til manualen for kanalen HTML-grab 1 5.1 Introduktion til kanalen 1 5.2 HTML-grab kanalside 1 5.2.1 Hvad er et spot? 2 5.2.2 Opret et nyt spot 2 5.2.3 Aktivt og inaktivt spot 3 5.2.4 Rediger

Læs mere

Billeder på hjemmeside

Billeder på hjemmeside Billeder på hjemmeside Indholdsfortegnelse Emne 1. Billedredigering (Microsoft Picture Manager) Side 3 a. Komprimer billeder b. Beskæring af billeder 3 9 2. Billeder og tekst ved hjælp af en skabelon (Template

Læs mere

Modul 3: Sandsynlighedsregning

Modul 3: Sandsynlighedsregning Forskningsenheden for Statistik ST01: Elementær Statistik Bent Jørgensen Modul 3: Sandsynlighedsregning 3.1 Sandsynligheder................................... 1 3.2 Tilfældig udtrækning fra en mængde........................

Læs mere

Installationen af Designskabelonerne gøres ved at installere henholdsvis et lille program samt en række skrifttyper som bruges af skabelonerne.

Installationen af Designskabelonerne gøres ved at installere henholdsvis et lille program samt en række skrifttyper som bruges af skabelonerne. Quickguide til AU s designskabeloner i Word 2007 Denne guide indeholder to elementer: 1. Installation af skabeloner 2. Hvordan skabeloner benyttes Er skabelonerne installeret på din maskine, kan du gå

Læs mere

Windows Vista 1. Side 1 af 10

Windows Vista 1. Side 1 af 10 Windows vista...2 Lukke for PC,en...3 Velkomstcenter...3 Finde/starte et program...4 Alle programmer...5 Menuen Start...5 Stifinder...6 Windows Sidepanel og gadgets...7 Dokumenter...7 Tilbehør...8 Windows

Læs mere

Indlæsning og anvendelse af kontoskema Res_14 til resultatopgørelse 2014. Vejledning

Indlæsning og anvendelse af kontoskema Res_14 til resultatopgørelse 2014. Vejledning Indlæsning og anvendelse af kontoskema Res_14 til resultatopgørelse 2014 Vejledning December 2014 1 Indholdsfortegnelse 1 Formål med denne vejledning... 3 2 Hent filer med kontoskema og kolonneformat...

Læs mere

Microsoft PowerPoint 2010

Microsoft PowerPoint 2010 Microsoft PowerPoint 2010 Opbyg dias... 3 Sidehoved og sidefod... 3 Afspil diasshow... 4 Vis dias... 4 Formatering og baggrund... 5 Overgang... 6 Animation... 7 Indspil tidsindstilling... 8 Gentagen visning...

Læs mere