Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning grundvandsforurening

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning grundvandsforurening"

Transkript

1 Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning grundvandsforurening af Middelfartvej 126, Odense Lokalitet nr August

2 Fyns Amt Middelfartvej 126 Odense Kommune Lokalitet nr Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening Kunde Rådgiver Fyns Amt Hedeselskabet Miljø- og Arealafdelingen Miljø- og Energi Ørbækvej 100 Klostermarken Odense SØ 8800 Viborg Telefon Telefon Telefax Telefax Sag nr Projektleder Claus Westergaard Projektmedarbejder Christian H. Mossing Kvalitetssikring Claus Westergaard Revision nr. 2 Godkendt af Lars Åge Sloth Udgivet

3 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Indholdsfortegnelse 1 Indledning Historik Formål og strategi Organisation 5 2 Reduktiv deklorering 6 3 Lokaliteten Felt- og laboratoriearbejde Feltarbejde Laboratoriearbejde Forholdene på lokaliteten Geologi og hydrogeologi Forureningssituationen og udvikling Redoxsituationen Mikrobiologi Sammenfatning af forholdene på lokaliteten 23 4 Stimuleret Reduktiv Deklorering (SRD) Treatability studier Opsætning af forsøg Redoxforhold i laboratorieforsøg Nedbrydning af klorerede ethener i laboratorieforsøg Sammenfatning af laboratorieforsøg Samlet vurdering af SRD i forhold til lokaliteten Valg af entrepriseområde Fysiske forhold logistik - doseringsmetode Valg af substrat Valg af evt. mikroorganismer Substratmængde Monitering 32 5 Referenceliste 33 Hedeselskabet: Sag nr

4 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense BILAG 1 Borejournaler 2 Analyseresultater, vandprøvetagning maj Notat om isotopfraktioner 4 Notat om oxidationskapacitet 5 Notat om brintmålinger 6 Notat om mikrobiologi (AODC tællinger) 7 Notat om metode til påvisning af Dehalococcoides 8 Notat om treatability forsøg Hedeselskabet: Sag nr

5 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 1 Indledning 1.1 Historik På ejendommen Middelfartvej 126, Odense har der tidligere været drevet renseri. Driften af renseriet har medført en omfattende forurening af jord og grundvand med klorerede opløsningsmidler, primært PCE. NIRAS har tidligere kortlagt forureningen i jord og grundvand jf. (Fyns Amt (1999), Fyns Amt (2001) og Fyns Amt (2003)). Renseribygningen er i dag revet ned til soklen og overdækket med presenninger. I forbindelse med kortlægning af forureningen kunne der konstateres tre kildeområder: Ved kælderen i den tidligere renseribygning. Ved hovedkloakken i Lundsgårdsvej udfor renseribygningen. Nær skel i hjørnet mellem Middelfartvej 124 og Lundsgårdsvej Formål og strategi Denne rapport er et element i en endelig vurdering af en mulig afværgemetode i forhold til forureningsfanen på og nedstrøms ejendommen. Formålet med rapporten er at belyse: Om en evt. oprensning kan baseres på stimuleret in situ reduktiv deklorering ved tilsætning af elektrondonor og/eller bakterier til det øvre sekundære magasin i kildeområdet og eventuelt et eller flere steder i forureningsfanen nedstrøms kildeområdet. Strategien er at gennemføre en række undersøgelser af grundvand og sediment fra kildeområdet samt områder opstrøms og nedstrøms kildeområdet. Dels undersøges de eksisterende forhold på lokaliteten (forureningstilstand, nedbrydningsforhold, grundvandskemi mv.), dels undersøges muligheden for at stimulere reduktiv deklorering i laboratorieforsøg ved tilsætning af donor og bakterier til sediment og grundvand udtaget fra lokaliteten. Resultaterne fra felt og laboratorieundersøgelserne sammenstilles efterfølgende til vurdering af muligheden for at anvende stimuleret reduktiv deklorering som en mulig afværge metode i forhold til forureningsfanen fra lokaliteten. Hedeselskabet: Sag nr

6 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 1.3 Organisation Denne rapport indgår som et grundlag for NIRAS vurdering af afværgemetoder i forhold til forureningen på ejendommen. Hedeselskabet Miljø & Energi as er ansvarlig for at gennemføre og rapportere undersøgelserne/forsøgene om reduktiv deklorering. Rapporten er skrevet i et samarbejde mellem Miljø & Ressourcer DTU og Hedeselskabet. Miljø & Ressourcer DTU og GEUS står for gennemførelse af hovedparten af analyser og laboratorieforsøg, der danner grundlaget for Hedeselskabets vurderinger. GeoSyntec/SIREM v./ Evan Cox og Phil Dennis har via en samarbejdsaftale med Miljø & Ressourcer DTU doneret bakteriekulturen KB-1 til eksperimenterne i laboratoriet. Daniel Hunkeler, University of Neuchatel har gennemført analyserne for isotopfraktionering for klorerede opløsningsmidler. Sideløbende er der foretaget akkrediterede kemiske vandanalyser af Eurofins. Hedeselskabet: Sag nr

7 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 2 Reduktiv deklorering Reduktiv deklorering er den proces, hvorved klorerede ethener nedbrydes trinvis ved sekventiel substitution af et klor-atom med et brint-atom. Den sekventielle nedbrydning af PCE er derfor: PCE TCE DCE VC ethen. Ved reduktiv deklorering fungerer det klorerede opløsningsmiddel ikke som substrat for mikroorganismerne, men derimod som elektronacceptor. Det er derfor en forudsætning for dekloreringsprocessen, at der er et andet substrat tilstede (det kan enten være naturligt eller miljøfremmed). En anden forudsætning for reduktiv deklorering er, at forholdene i grundvandet er stærkt reducerede. De klorerede oplø s- ningsmidler konkurrerer med andre naturlige elektronacceptorer i grundvandet og mikroorganismerne har præference for bl.a. ilt, nitrat og jern før de går over til at anvende de klorerede opløsningsmidler. Der ses derfor ofte betydelig naturlig reduktiv deklorering, hvor der er sket blandingsforureninger med f.eks. oliestoffer og klorerede opløsningsmidler. For en mere detaljeret beskrivelse af forholdene omkring reduktiv deklorering henvises til bilag 8. For at belyse de naturlige forhold på/omkring Middelfartvej 126 er der gennemført følgende: Undersøgelse af forureningsudbredelse/-sammensætning giver et førstehåndsindtryk af om der sker en nedbrydning af de klorerede opløsningsmidler (tilstedeværelse og andel af nedbrydningsprodukter) Belysning af isotop fraktioner da mikroorganismer har en præference for den lette fraktion af kulstoffet i de klorerede opløsningsmidler (C 12 ) kan forholdet mellem de to fraktioner give en indikation af den eventuelle reduktive deklorering. Belysning af redoxforhold indhold af konkurrerende elektronacceptorer i såvel grundvand som sediment samt brintmålinger angiver om forholdene er tilstrækkeligt reducerede til at reduktiv deklorering kan forløbe naturligt. Belysning af mikrobiologi giver et indtryk af det mikrobiologiske miljø og aktivitet i grundvandet. Test af tilstedeværelse af bakterietypen Dehalococcoides vil være en betydelig indikator for om reduktiv deklorering vil kunne forekomme. Laboratorieforsøg med grundvand og sediment fra lokaliteten uden tilsætning af donor eller bakterier giver en vurdering af det naturlige potentia le for anaerob deklorering. Hedeselskabet: Sag nr

8 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Hvis ikke den naturlige reduktive deklorering er tilstrækkelig til at nedbringe en forurenings risiko til et acceptabelt niveau, kan processen stimuleres. Dette kan gøres ved tilsætning af en elektrondonor i form af et organisk substrat og/eller udvalgte mikroorganismer (Dehalococcoides). For at belyse muligheden for at stimulere reduktiv deklorering på Middelfartvej 126 er der gennemført følgende: Udførelse af treatabilityforsøg med grundvand og sediment fra lokaliteten vil belyse om den naturlige reduktive deklorering kan initieres eller stimuleres ved tilsætning af forskellige substrater og/eller udvalgte mikroorganismer af typen Dehalococcoides. Undersøgelse af redoxforhold indhold af konkurrerende elektronacceptorer i såvel grundvand som sediment er betydende for, hvor meget substrat der ville skulle tilføres ved en oprensning baseret på stimuleret reduktiv deklorering. Hedeselskabet: Sag nr

9 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 3 Lokaliteten 3.1 Felt- og laboratoriearbejde I det følgende præsenteres udelukkende resultater af de undersøgelser, der er foretaget i forbindelse med nærværende projekt. I flere af sammenligningerne er der dog anvendt data fra tidligere undersøgelser udført af NIRAS. I det omfang der anvendes data fra disse undersøgelser, henvises til NIRAS rapporter Feltarbejde I forbindelse med nærværende projekt er der i perioden 24. april til 1. maj 2003 udført 5 stk. 6 forede snegleboringer til mellem 9,5 og 15,0 m u. t.. Boringerne er benævnt B300, B301, B301A, B302 og B303. Boringer B300, B301 og B302 er udbygget med Ø63 mm PEH filter for efterfølgende vandprøvetagning. Borejournaler er vedlagt som bilag 1. Fra boring B300, B301A, B302 og B303 er der udtaget intakte sedimentkerner med A-rør (Tabel 3.1). Tabel 3.1: Prøvetagningssteder og geologi for sedimenter, som indgår i analyser for oxidationskapacitet, AODC og laboratorieforsøg på Middelfartvej. Placering Opstrøms Kilde Kilde Fane Fane Boring Nummer B303 B300-III B300-II B301A B302 Prøvetagningsdybde (m.u. t.) m.u. t. 12,0-12,5 7,5-8,0 9,5-10,0 8,8-9, ,5 Geologisk beskrive lse Baseret på boreprofiler fra NIRAS Sand, fint mellem, grå Moræneler, sandet, stenet, gråt Sand, Fint/mellem, lerklumper, enk. sten, gråt Sand, Fint/mellem, gråt Grus, fint, sand, svagt leret, brun* * Der er ikke angivet specifik farve for prøven i Niras s beskrivelse, men prøverne over og under er angivet som rødbrune og brune. Borearbejdet er udført af GEO under tilsyn fra NIRAS. Boringsplacering fremgår af situationsplanen på figur 3.1. Hedeselskabet: Sag nr

10 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense By s tævn ev ej FB101 N FB100 B303 FB5 Hauges Plads Mi d d el fa rtve j I FB2 B5 FB3 FB1 FB6 FB103 B300 FB4 Kl ø ve rmo se vej L un d gå rd sv e j B301 FB10 Ka n c e ll i ve j Sta d io n ve j FB104 FB7 FB9 B302 FB8 GP27 GP25 GP24 FB102 GP26 GP23 FB11 GP22 GP21 GP17 GP31 I GP19 GP11 GP13 GP m Gotersvej FB/B, boringer B300-B303, boringer hvor der er udtaget sedimentprøver GP-boringer Geologisk profil Renserigrund Figur 3.1: Situationsplan med boringsplaceringer I de nye boringer er efterfølgende udtaget vandprøver af NIRAS og DTU, dels som led i den generelle forureningsbeskrivelse, dels som led i de undersøgelser/forsøg, der opstilles på DTU. DTU har udtaget supplerende vandprøver i en række boringer til feltanalyser for brint og vandprøver til analyser for isotopfraktionering af klorerede opløsningsmidler. Desuden har NIRAS supplerende udtaget vandprøver til boringskontrolanalyser i en række boringer, for at grundvandskemi og redoxforhold i forureningsfanen kan vurderes. Hedeselskabet: Sag nr

11 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Laboratoriearbejde Der er gennemført en række analyser og forsøg på det udtagne sediment og grundvand på ejendommen. De specifikke materialer og metoder i forbindelse med disse er beskrevet i notater, der er vedlagt som bilag. Følgende laboratorieanalyser/- forsøg er gennemført hos Miljø & Ressourcer DTU: Generel mikrobiologisk karakterisering Bestemmelse af sedimentets oxidationskapacitet Isotopfraktionsbestemmelse for klorerede opløsningsmidler (University of Neuchatel) Feltmålinger af brint i grundvandet Treatabilityforsøg i flaskeforsøg med sediment og grundvand fra lokaliteten. Supplerende analyser for klorerede opløsningsmidler til at understøtte resultater fra treatabilityforsøg og isotopfraktionering Følgende analyser er gennemført hos GEUS: Udvikling og gennemførelse af analysemetode for kvalitativ og kvantitativ bestemmelse af tilstedeværelsen af Dehalococcoides bakterier i grundvandet. Følgende analyser er gennemført hos Eurofins: Akkrediterede analyser af klorerede opløsningsmidler og nedbrydningsprodukter heraf. Akkrediterede analyser af redoxparametre m.m. (boringskontrol) Hedeselskabet: Sag nr

12 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 3.2 Forholdene på lokaliteten NIRAS har gennemført en række moniteringsrunder på lokaliteten siden Resultatet af de to første runder er tidligere rapporteret i hhv. (Fyns Amt, 1999) og (Fyns Amt, 2001). Den tredje moniteringsrunde er gennemført efter etablering af yderligere 5 boringer til bedre forureningsafgrænsning. Resultatet er tillige rapporteret i (Fyns Amt, 2003). De tre moniteringsrunder er gennemført i henholdsvis 1997/1988, 2000 og Geologi og hydrogeologi Den geologiske beskrivelse er baseret på NIRAS tidligere tolkninger af geologien (Fyns Amt, 1999), (Fyns Amt, 2001) og (Fyns Amt, 2003) sammenholdt med informationen fra de fem nye boringer. Figur 3.2. viser et geologisk profil (længdesnit I-I - placeringen fremgår af figur 3.1 side 9) baseret på den geologiske beskrivelse i (Fyns Amt, 1999). LÆNGDESNIT I - I Kote (m) 20 I FB5 FB2 FB1 FB4 GP27 FB8 GP24 I GP31 GP17 GP19 Kote (m) 20 Ler/sand 10 Ler Ler/sand Ler Ler Sand, tørt Ler 10 Sand Afproppet Sand Sand Figur 3.2: Geologisk profil, længdesnit Den lokale geologi i området indtil ca. 10 m u. t. er overordnet præget af inhomogene lerede aflejringer. Der ses en meget stor variation i sandindholdet i leret og deraf følgende vandindhold, således at leret ved lavt sandindhold er tør, mens den er slap og fugtig ved højere sandindhold. Der ses sandslirer/-striber i leret med vekslende orientering. Moræneleret underlejres ca m u. t. af et lag af smeltevandssand. Mægtigheden af laget af smeltevandssand varierer noget fra få meters mægtighed i kildeområdet til større mægtigheder (5-10 meter) længere nedstrøms kildeområdet. Laget af smeltevandssand underlejres af moræneler i flere af de dybe boringer. De sekundære grundvand er knyttet til laget af smeltevandssand. Vandspejlet i det sekundære magasin er spændt med et trykniveau omkring 5 m u. t. Den overordnede strømningsretning i det sekundære grundvand er mod sydøst med nogen årstidsvariation. Hedeselskabet: Sag nr

13 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Forureningssituationen og udvikling Klorerede opløsningsmidler og nedbrydningsprodukter I det følgende henvises til bilag i (Fyns Amt, 2003). Analysedata fremgår af bilag 4 i (Fyns Amt, 2003), samt af bilag 2 i denne rapport. Forureningen med PCE i det sekundære grundvand har en udbredelse på ca. 300 meter nedstrøms kildegrunden. Bredden af fanen vurderes at være ca m. Det højeste indhold før etablering af de nyeste boringer (B300-B303) var µg/l (PCE) i boring FB4 umiddelbart nedstrøms kildegrunden. Efter etablering af de nye boringer er der konstateret µg/l i B300, der er beliggende umiddelbart nedstrøms kildeområdet i baghaven på den tidligere renserigrund. Samtidig har moniteringsrunderne vist, at koncentrationen af PCE er faldende i stort set samtlige boringer over tid. Indholdet indikerer, at der er fri fase (evt. residual) i dette område. Figur 3.3 viser PCE udbredelsen i sekundært grundvand i 2002/2003. Bys tævn ev ej 1 µg/l FB101 i.p. FB100 4* B µg/l FB5 56 Hauges Plads Mi d d el fa rtve j FB2 FB3 20 B5 5,9 FB103 i.p. 1 µg/l L un d gå rd sv e j 100 µg/l 1 µg/l FB µg/l 730* B300 FB µg/l B301 17* FB10 10 µg/l FB6 i.p. Ka n c e ll i ve j 1 µg/l Sta d io n ve j FB104 i.p. Kl ø ve rmo sev ej FB9 FB7 0,5 FB102 i.p. B302 88* FB8 60 GP27 10 µg/l 1 µg/l GP26 GP25 GP24 6,8 GP23 FB11 0,11 GP22 GP21 GP17 i.p. GP31 0,23 GP19 GP11 GP13 GP m FB/B, boringer B300-B303, boringer hvor der er udtaget sedimentprøver GP-boringer 14,3 PCE konc. i µg/l * maj øvrige værdier er fra µg/l isolinie PCE konc. Figur 3.3: PCE udbredelse i sekundært grundvand 2002/2003 i µg/l. Gotersvej Renserigrund TCE indholdet er generelt også faldende over tiden, om end billedet ikke er helt så entydigt som ved PCE. Højeste indhold af TCE på µg/l er målt i 1997/1998 i boring B10 (ikke vist på figur 3.3). Generelt ændres forholdet mellem PCE og TCE jo længere nedstrøms i fanen prøverne udtages. For at kunne sammenligne forholdet mellem PCE og TCE forskellige steder i fanen, kan koncentrationerne med Hedeselskabet: Sag nr

14 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense fordel omregnes til molære koncentrationer, for derved at korrigere for den forskellige molvægt af PCE og TCE. Herved fås et billede af omdannelsen af et molekyle PCE til et molekyle TCE. De molære fraktioner for en række boringer er vist i tabel 3.2. Heraf ses at PCE indholdet udgør ca. dobbelt så stor en andel som TCE i de fleste boringer i kildeområdet. Denne tendens er ikke så tydelig i spidsen af fanen nedstrøms kildeområdet, hvor TCE indholdet i f.eks. GP31 udgør ca. 91% af de klorerede opløsningsmidler i forhold til PCE der kun udgør ca. 5 %. Generelt bør sammenligningen tages med et vist forbehold når der er tale om meget lave koncentrationer (som man typisk ser i spidsen af fanen). Selv meget små variationer i koncentrationer vil få meget stor effekt i forholdene mellem moderstof og nedbrydningsprodukter. Tabel 3.2: Molarkoncentrationer og andele i forskellige dele af fanen. Indholdet i FB4 er sat til 100%. Baseret på prøvetagning i Stof PCE TCE cis-dce VC SUM Andel ift. Molvægt (g/mol) Molar/andel af sum * Prøverne er udtaget i maj 2003 hvorfor andel i % i forhold til FB4 ikke er foretaget da tidspunktet for prøvetagning ikke er sammenligneligt , ,5 (µmol/l) % (µmol/l) % (µmol/l) % (µmol/l) % Opstrøms B303* 0, , ,02 sum FB4 FB5 0,34 4,7 0,18 2,2 7,06 90,7 0,19 2,4 7, Kilde FB1 0,16 3,1 2,42 46,3 2,61 50,0 0,03 0,6 5, FB2 0,42 23,6 0,51 28,7 0,70 39,3 0,15 8,4 1,78 44 FB4 3,19 78,4 0,84 20,6 0,04 1, , B300* 319,00 97,5 1,21 0,4 7,01 2,1 0, ,23 B301* 0,10 58,8 0,06 35,3 0,01 5, ,17 Nedstrøms FB8 0,36 38,3 0,31 33,0 0,25 26,6 0,02 0,1 0,94 23 FB9 0,003 1,0 0,02 6,5 0,28 91,2 0,004 1,3 0,307 8 B302* 0,53 77,8 0,15 22,0 0,001 0, ,681 GP31 0,001 4,6 0,02 90,8 0,001 4,6 0 0,022 0,5 (%) Med indholdet af cis-dce forholder det sig noget anderledes. Cis-DCE udgør en meget varierende andel af de klorede ethener fra få % til over 90% i alle områder af fanen også opstrøms kildeområdet. De høje andele af cis-dce er observeret ved lave til moderate koncentrationer af klorerede ethener. Indholdet er dog lavest længst nedstrøms kildeområdet. De højeste koncentrationer af cis-dce, der er de- Hedeselskabet: Sag nr

15 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense tekteret gennem tiden, er µg/l i boring B10 (1997/1998). Ellers er der konstateret indhold på knap µg/l i de andre boringer. I kildeområdet og opstrøms kildeområdet er koncentrationerne af cis-dce stigende over tid, mens billedet er mindre entydigt i området nedstrøms kildeområdet. Den varierende andel af cis- DCE kunne tyde på, at der foregår reduktiv deklorering fra TCE til cis-dce i mindre, lokale områder af fanen. Der er primært truffet VC i kildeområdet. Højeste koncentration på 18 µg/l blev konstateret i boring B5 i 1997/1998. Der er kun gennemført begrænsede analyser af VC, hvorfor det er svært at påpege en tendens i udviklingen. Dog er der en tendens til, at indholdet er stigende over tiden. Der er ikke konstateret indhold af VC over detektionsgrænsen nedstrøms boring FB8/B302. Af tabel 3.2 ses, at VC typisk kun udgør et par procent af summen af de klorerede opløsningsmidler. Højeste andel ses i FB2 med 8,4 %. Processerne i spidsen af fanen er generelt dårligt belyst og det er derfor vanskeligt at vurdere hvilke processer, der nedbringer de klorerede ethener til værdier under detektionsgrænsen i dette område. Isotopforhold for klorerede ethener Der er foretaget måling af isotopforholdet for 12 C og 13 C for klorerede ethener på grundvandsprøver fra Middelfartvej. Analysens princip, prøvetagning, målemetode og resultater er beskrevet i bilag 3. Der blev i alt udtaget 12 vandprøver fra Middelfartvej i april og august Efter en vurdering af den tidslige variation i resultaterne blev det besluttet at inddrage alle data, så der fremkommer et større samlet datasæt. Resultaterne opgives i en delta notation (δ 13 C) i forhold til VPDB (Vienna Pedee Belemnite). Med denne notation betyder en ændring af δ 13 C fra fx 30 0/00 til 20 0/00, at der er sket en relativ stigning i indholdet af 13 C i forhold til 12 C. Det vil typisk være tegn på nedbrydning af fx PCE, da der vil ske en præferentiel nedbrydning af PCE molekyler med 12 C frem for PCE molekyler med 13 C. Isotopfraktionering er mest udtalt for anaerob deklorering af cis-dce og VC (Hunkeler et al., 1999; Lollar et al., 2001). Resultaterne for målinger af isotopforholdet for 13 C-isotopen for de klorerede ethener og indholdet af klorerede ethener i vandprøverne er vist i figur 3.4. På grund af detektionsgrænsen på ca. 50 µg/l er der ingen data for VC, og der er kun målinger af cis-dce for ca. halvdelen af vandprøverne. Af samme årsag er der ingen resultater for FB11 og FB100. Boring B300 repræsenterer formentlig kildens sammensætning med hensyn til isotopindhold. Der er stort set ingen nedbrydning af PCE i B300, som det også fremgår af tabel 3.2. δ 13 C forholdet i B300 er 30 0/00, hvilket er typisk for PCE (Hunkeler et al., 1999). Hedeselskabet: Sag nr

16 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense PCE i FB4, B301, FB8 og B302 har en isotopsammensætning, som er lidt mindre negativ med hensyn δ 13 C indholdet end B300, hvilket indikerer en lille nedbrydning af PCE i disse boringer. Til sammenligning er der i FB1 og FB2 sket en betydelig nedbrydning illustreret ved et mindre negativt δ 13 C indhold for PCE. Der er her sket en opkoncentrering af δ 13 C i forhold til δ 12 C i vandprøverne fra disse boringer. Dette stemmer meget fint med, at molfraktionen er klart større for cis-dce i FB1 og FB2 sammenlignet med boringerne FB4, B301, FB8 og B302 (tabel 3.2 og bilag 3). Boringerne FB1 og især FB2 udviser ud fra isotopsammensætningen på TCE stærke tegn på dannelse af cis-dce. Der er på grund af isotopfordelingen i cis-dce også indikationer for en videre nedbrydning til VC i FB2 og ikke mindst i FB5. Det sidste kan dog ikke bekræftes af målingen af VC. -50 Delta 13C PCE TCE cis-dce B300 FB4 FB4 B302 B301 FB8 FB1 FB2 FB1 FB5 Boringer Figur 3.4: Isotopfordelingen af δ 13 C for klorerede ethener på Middelfartvej. Der er ikke angivet nogle data for VC, da alle koncentrationer var under metodens detektionsgrænse. Der kan under forudsætning af, at isotopfraktioneringen i laboratorieforsøg er repræsentativ for feltforholdene på Middelfartvej foretages en vurdering af den relative nedbrydning af PCE i de forskellige områder. Der er kun få data i litteraturen for den såkaldte fraktioneringsfaktor, men Lollar et al. (2001) rapporterer en fraktioneringsfaktor på Det antages, at B300 repræsenterer det initielle isotopforhold for 13 C. Med disse forudsætninger kan det ved hjælp af beregningsmetoden i Lollar et al. (2001) vurderes, i hvilken grad PCE nedbrydes. Overslagsberegningerne viser, at mere end 80% af den oprindelige PCE er blevet nedbrudt i boringerne FB1 og FB2, mens kun ca. 30% af den oprindelige PCE er nedbrudt til TCE i området nedstrøms B300. Sammenfatning Spredning og nedbrydning af klorere de ethener Forureningen i det sekundære grundvandsmagasin dækker over betydelig variationer i koncentrationer. Efter etablering af den nye boring B300 er der identificeret et kraftigt hotspot sydligst på den tidligere renserigrund med koncentrationer af PCE Hedeselskabet: Sag nr

17 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense på µg/l. Det vurderes, at boringen er placeret således, at der er tale om kildestyrken af forureningen. 300 meters nedstrøms dette sted er koncentrationerne af de klorerede opløsningsmidler under detektionsgrænsen. I løbet af moniteringsperioden fra 1999 til i dag, er der generelt konstateret fald i koncentrationerne af klorerede opløsningsmidler i grundvandet, hvilket kunne tyde på, at fanen indskrænkes. Det er dog uklart hvilken effekt det har på udvaskningen fra kildeområdet, at de oprindelige bygninger i dag er revet ned. Generelt er forholdene omkring kildeområdet og centralt i fanen bedre belyst end forholdene i den nedre del af fanen, da der er lavet flere analyser, målinger og forsøg centralt i fanen. Det er derfor vanskeligt at vurdere, hvilke processer der har betydning for at koncentrationerne af klorerede ethener falder til under detektionsgrænsen i den nedre del af fanen. Der er konstateret høje indhold af klorerede opløsningsmidler i boring FB5 og lave indhold i boring FB100. Fælles for de to boringer er imidlertid, at de er beliggende opstrøms kildeområdet. Da strømningsbilledet i det sekundære grundvandsmagasin vurderes at være entydigt (sydøstlig strømningsretning), må der være tale om en anden kilde til indholdet af særligt cis-dce i boring FB5. Det er ikke sikkert, at boring FB101 er placeret optimalt opstrøms boring FB5 til at udelukke, at der kunne være en sekundær forureningskilde opstrøms boring FB5. Sammenfattende viser fordelingen af klorerede ethener og målinger af isotopforholdene for PCE, TCE og cis-dce, at forureningsfanen kan opdeles i 3 områder med hensyn til anaerob deklorering. Der er et aktivt område med hensyn til flere af trinene i den anaerobe deklorering omkring boring FB5 og FB2. Der er på grund af isotopfordelingen i cis-dce og forekomst af VC også indikationer for en vis videre nedbrydning til VC i dette område. Den anaerobe deklorering klinger tilsyneladende af tættere på FB1, og ved B300 domineres forholdene af den stærke PCE-kilde nær skellet af Middelfartvej 124 og Lundsgårdsvej 4. I et område nedstrøms B300 udviser B301, B302 og FB8 tegn på en tydelig nedbrydning af PCE til TCE, men kun en mindre nedbrydning videre til cis-dce. I spidsen af fanen er der tegn på, at der sker en fjernelse af alle de klorerede ethener, men de gennemførte undersøgelser har ikke haft til formål at undersøge dette forhold nærmere Redoxsituationen Vandkemi I det følgende henvises til bilag i (Fyns Amt (2003)). Analysedata fremgår af bilag 4 i (Fyns Amt (2003)), samt af bilag 2 i denne rapport. Ilt og nitrat Generelt er der tale om en naturlig reduceret grundvandskvalitet. Der er således ikke konstateret indhold af ilt over 1 mg/l. Nitratindholdet er ligeledes meget lavt. Højeste indhold af nitrat er konstateret omkrin g FB8/B302 mellem 3,3 og 8,0 mg/l. Hedeselskabet: Sag nr

18 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Der er tale om en meget lokal forekomst af nitrat, da indholdet i stort set samtlige andre boringer er mindre end detektionsgrænsen på 1 mg/l. Jern (opløst) Der er konstateret indhold af opløst jern i og opstrøms kildeområdet mellem 2,5 og 15 mg/l, som viser, at foregår jernreduktion i disse områder. Nedstrøms kildeområdet er indholdet generelt noget under 1 mg/l. Det er vanskeligt at udtale sig om det naturlige baggrundsniveau af opløst jern, da de højeste indhold faktisk er truffet opstrøms/vest for kildeområdet (FB103). Figur 3.5 viser indholdet af opløst jern i det sekundære grundvandsmagasin i 2002/2003. B ys tæ vneve j FB101 FB100 2,7* B303 FB5 6,7 1 mg/l Hauges Plads M id de lf a rt vej FB2 2,5 B5 FB3 0,56 10 mg/l FB mg/l FB104 L un d g ård sve j FB1 5,0* B300 4,7* 1 mg/l FB7 FB4 2,5 B301 0,07* FB9 FB10 FB6 K an c e lli ve j B302 0,03* FB8 0,22 GP27 GP25 GP24 S tad io nve j K l øve rm ose vej FB102 GP26 GP23 FB11 GP22 GP21 GP17 0,76 GP31 0,62 GP19 GP11 GP13 GP m Gotersvej FB/B, boringer GP-boringer B300-B303, 3,3 FE (II) konc. i mg/l boringer hvor der er * maj øvrige udtaget sedimentprøver værdier er fra 2002 Renserigrund Figur 3.5: Udbredelse af opløst jern i sekundært grundvand 2002/2003 i µg/l. Hedeselskabet: Sag nr

19 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Sulfat og sulfid Figur 3.6 viser sulfatkoncentration i det sekundære grundvandsmagasin i 2002/2003. Indholdet af sulfat er generelt højt ca mg/l. Der er observeret koncentrationer fra 80 til 156 mg/l i et område umiddelbart opstrøms og omkring kilden. Specielt indholdet i B300 er meget lavt (80 mg/l) i forhold til boringer længere nedstrøms (>200 mg/l). Der er målt lave indhold af sulfid i en række boringer. De lave sulfatkoncentrationer indikerer, at der sker sulfatreduktion i kildeområdet. B ys tæ vneve j FB101 FB * B303 FB mg/l Hauges Plads M id de lf a rt vej FB2 137 B5 FB mg/l FB FB1 143* B300 80* FB4 187 FB6 200 mg/l FB104 K lø verm o seve j Lu nd gå rd svej 100 mg/l FB9 FB7 FB102 B * FB10 K a nc e ll iv ej B * FB8 175 GP27 GP mg/l GP25 GP24 GP23 FB GP22 GP21 GP S ta di on vej GP GP19 GP11 GP13 GP m Gotersvej FB/B, boringer B300-B303, boringer hvor der er udtaget sedimentprøver GP-boringer 182 Sulfatkonc. i mg/l * maj øvrige værdier er fra 2002 Figur 3.6: Sulfatkoncentration i sekundært grundvand 2002/2003 i µg/l. Methan Methanindholdet er generelt meget lavt < 0,1 mg/l. Renserigrund NVOC Indholdet af ikke-flygtigt kulstof (NVOC) er rimelig ensartet og varierer typisk mellem 1,5 og 3,3 mg/l, hvilket svarer godt til det typiske indhold i for sekundære grundvandsmagasiner. Der er dog målt forhøjede koncentrationer i boringer B300 og boring FB103 vest for kildeområdet. Det kan heller ikke udelukkes, at der lokalt kan være andre organiske belastninger i området (utætte kloakker, olie - benzinforureninger eller højt indhold af organisk stof i den umættede zone, der påvirker det infiltrerende regnvand lokalt og dermed grundvandet). Hedeselskabet: Sag nr

20 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Oxidationskapacitet Oxidationskapaciteten er målt ved en titrering med et stærkt reduktionsmiddel på 5 sedimenter på Middelfartvej (tabel 1). Analysens princip, metode og resultater er beskrevet i bilag 4. De fem prøver svarer til de 5 sedimenter, der parallelt indgår i det udførte treatability studie således, at resultaterne direkte kan sammenholdes med disse. Oxidationskapaciteten varierer mellem 38,7 µeq/g og 49,3 µeq/g for de 5 sedimenter, hvilket er en ganske begrænset variation. Størstedelen af oxidationskapaciteten (80-86%) kan for B300-III, B301A og B302 forklares ved hjælp af indholdet af jern og mangan. I B300-II og B303 er det kun ca. 50% som kan tilskrives jern og mangan. Mangan udgør i alle prøver kun få procent. Resultaterne viser, at der i alle prøver er et potentiale for jernreduktion og i mindre omfang manganreduktion. På baggrund af disse resultater kan der foretages en vurdering af donorforbruget for at omsætte den samlede oxidationskapacitet eller dele af oxidationskapaciteten Brintmålinger Der er målt for brintkoncentrationer (H 2 ) i en række boringer på Middelfartvej (tabel 3.3). Analysens princip, prøvetagning, målemetode og resultater er beskrevet i bilag 5. De H 2 koncentrationer der findes i grundvandet er meget små, i størrelsesordenen nanomol/l. For at måle de lave koncentrationer benytter man sig af, at H 2 er ret uopløseligt i vand. Ved at lade vandet passere gennem en luftboble (bubble-stripping), som efter ca min vil være i ligevægt med vandet, opnår man en koncentration i gasfasen der er ca. 50 gange højere. De meget små koncentrationer betyder, at der ikke skal meget til, for at de værdier, der måles, slet ikke afspejler forholdene i grundvandsmagasinet. Det viste sig at være forbundet med en del vanskeligheder at prøvetage de eksisterende boringer for H 2 (se bilag 5). De meget benyttede whalepumper er ikke er egnede til prøvetagning for brint, og tidligere prøvetagning med en sådan pumpe kan også påvirke brintmålinger efterfølgende. De resultater, som det har været muligt at opnå, og som skønnes med rimelighed at afspejle det reelle H 2 niveau, er gengivet i tabel 3.3. Tabel 3.3: H 2 koncentrationer fra Middelfartvej Boring Prøvetagningspumpe H 2 nm FB100 MP1+peristaltisk 0.17 FB2-2 MP1+peristaltisk 0.08 FB300-III* Peristaltisk 2.26 FB01-2 MP1+peristaltisk 0.21 FB4-2 MP1+perist FB302 Peristaltisk 0.06 FB301 MP1+perist FB5 MP1+perist *denne boring giver meget lidt vand og tidligere brug af Whale pumpe i boringen kan have efterladt H 2. Hedeselskabet: Sag nr

21 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Koncentrationerne er generelt ret lave, og lavere end det niveau, ca. 0,4-2nM, der normalt angives som værende karakteristisk, når der observeres deklorering (Yang og McCarty, 1998; Mazur og Jones, 2001). Antallet af gode feltdatasæt er imidle r- tid meget begrænsede og intervallet er baseret på laboratorieforsøg. Beregning af den tilgængelige Gibbs energi for redoxprocesser viser markante forskelle i mellem prøverne (bilag 5). Potentialet for jernreduktion ser ud til at være størst i FB100-1, B301 og B302, men dette skyldes for boring B301 og B302 de meget lave Fe 2+ koncentrationer. Der foregår derfor nok kun meget begrænset jern-reduktion i disse områder. Der er derfor nok snarere tale om, at forholdene er mere oxiderede omkring disse boringer, hvad indholdet af nitrat i B302 også peger på. Gibbs energierne for sulfatreduktion ligger i FB100-1 på en værdi, der godt kunne være den tærskelværdi, som er nødvendig for sulfatreduktionen. Det antyder, at sulfatreduktion har betydning her. For FB2-2, FB5-1 og B300-II er der ikke angivet en værdi, fordi sulfid koncentrationen var under detektionsgrænsen, men det er sandsynligt, at der også her sker sulfatreduktion. De beregnede Gibbsenergier for methandannelse tyder på, at energigevinsten ved methandannelse er for lille, bortset fra ved B300. Sammenfatning - redoxsituationen Grundvandet er generelt reduceret, da der ikke ses betydende indhold af hverken ilt eller nitrat. Opstrøms og i kildeområdet ses en betydelig jernreduktion, som resulterer i dannelse af opløst jern i moderate til høje koncentrationer. Sedimentet indeholder på baggrund af oxidationskapacitetsmålingerne reducerbart jern i betydelige koncentrationer. Sulfatindholdet er højt i hele området, men der er indikationer på sulfatreduktion i og opstrøms kildeområdet. Der er ikke konstateret methan af betydning, men der forekommer sporadisk methandannelse. Redoxforholdene belyst ud fra brintkoncentrationerne og beregninger af Gibbs frie energi for redoxprocesser bekræfter disse forhold. Der er ikke rapporteret om forekomst af NVOC eller miljøfremmede stoffer (benzinforbindelser), som kan indgå som vandopløste elektrondonorer i redoxprocesserne. En undtagelse er dog boring B300, hvor der er et forhøjet indhold af NVOC. Redoxprocesserne er formentlig drevet af det sedimentbundne organiske stof, og der er sandsynligvis tale om, at elektrondonoren er den begrænsende faktor for jern- og sulfatreduktion. De mest betydende elektronacceptorer er jernhydroxider (sedimentbundne) og sulfat. Det er uafklaret, hvor stor en del af det kemisk-reducerbare jern, som er biologisk tilgængeligt. Hedeselskabet: Sag nr

22 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Mikrobiologi Det mikrobiologiske miljø Antallet af bakterier er målt ved AODC metoden på 5 sedimenter på Middelfartvej (tabel 3.1). Analysens princip, metode og resultater er beskrevet i bilag 6. De fem prøver svarer til de 5 sedimenter, der parallelt indgår i det udførte treatability studie, således at resultaterne direkte kan sammenholdes med disse. Bakterietælling med AODC metoden giver et mål for indholdet af bakterier (levende og døde) pr. g sediment. Antallet af bakterier varierer mellem 0,2-1, , hvilket svarer til typiske antal for uforurenede grundvandsedimenter (Kjeldsen et al., 1996). Ludvigsen et al. (1999) måler lidt højere bakterieantal med samme metode i lossepladsforurenet grundvandsmiljø ved Grindsted losseplads. Der er som forventet ikke nogen umiddelbar sammenhæng mellem sedimenttype/forureningsniveau og antallet af bakterier i prøverne på Middelfartvej. Identifikation af Dehalococcoides Der er foretaget en udvikling af en PCR-metode til at kvantificere DNA et fra Dehalococcoides. Analysens princip, metode og resultater er beskrevet i bilag 7. Formålet har været at anvende metoden på de sedimenter, der parallelt indgår i det udførte treatability studie. Der er en række mikroorganismer, som kan medvirke til anaerob deklorering. Blandt de PCE-deklorerende bakterier er der i dag kun isoleret én renkultur Dehalococcoides ethenogens 195, hvor det er dokumenteret, at der ved dehalorespiration kan foregå en fuldstændig nedbrydning af PCE eller TCE til ethen (sammenfattende diskussion i Major et al., 2003). Det sidste trin i dekloreringsfølgen fra vinylklorid til ethen foregår formentlig ved cometabolsk transformation og er ikke kædet sammen med dehalorespiration. Dehalococcoides ethenogens 195 tilhører bakteriestammen Dehalococcoides, som har den egenskab, at den kan foretage reduktiv deklorering fra cis-dce til VC. Det er derfor overordentlig vigtigt at belyse, om der findes Dehalococcoides på en forurenet lokalitet i forhold til stimuleret anaerob deklorering. Dehalococcoides sp. er beslægtede, hvis de bærer nogle særlige gensekvenser i det DNA, der koder for bakteriernes ribosomer. I artiklen Hendrickson (2002) er der nævnt 5 forskellige primersæt, som alle angives at være gode for detektion af Dehalococcoides sp. i naturlige prøver. I den gennemførte metodeudvikling er der gennemført test af de foreslåede primersæt, og mindst et primersæt giver ophav til DNA, der ikke stammer fra Dehalococcoides sp. Det bedst egnede ( ) blev udvalgt til det videre arbejde. For dette primersæt blev der ved hjælp af indhentet DNA fragment fundet en følsomhed for metoden på 700 celler pr. gram sediment. Der blev for det valgte primersæt udviklet en kompetitiv PCR metode til kvantif i- cering af DNA for Dehalococcoides sp.. Hedeselskabet: Sag nr

23 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Der er gennemført undersøgelser af DNA ekstraheret fra prøverne B301A, B300III, B300II, B302 samt B303 (eksempel på figur 3.7) med primersættet Ved screeningen for anvendelsen af primersættene brugtes duplikate prøver fra sedimenterne B300II, B302 og B Signatur: Bane 1: størrelsesmarkør. Bane 2 og 3: replikate prøver fra B300II Bane 4 og 5 replikate prøver fra B302 Bane 6 og 7: replikate prøver fra B303 Bane 8 og 9: negativ kontrol. Annealing temperatur 55C Figur 3.7: Screening for signal med primersæt Det ses først og fremmest, at der er tale om meget svage signaler (båndene ses kun ganske svagt på figur 3.7). Dernæst ses det, at der er problemer med reproducerbarheden mellem de to replikate prøver (sammenlign signal i bane 4 og 5). Ved sekventering af bånd blev det eftervist, at DNA-sekvensen svarer til Dehalococcoides sp.. Imidlertid var det bedst opnåelige signal med dette primersæt fra sedimenterne omkring detektionsgrænsen (700 celler pr. gram sediment) for den competitive PCR assay. Der kunne ikke gennemføres kvantitative analyser af sedimentprøverne på grund af det lave antal Dehalococcoides sp gensekvenser, der er tilstede i sedimenterne fra Middelfartvej. Efterfølgende har GEUS på baggrund af et nyt apparatur (og for egne midler) udviklet en realtime PCR-metode. Metoden er anvendt på prøverne fra Middelfartvej og bekræfter resultaterne fra den kompetitive PCR-metode. Metoden er hurtigere og billigere, og det anbefales at anvende denne metode ved eventuelt videre arbejde med denne problemstilling. Sammenfatning - mikrobiologi De udførte undersøgelser af den generelle bakteriepopulation på Middelfartvej viser, at antallet af bakterier svarer til grundvandssedimenter fra andre lokaliteter. Der er udviklet to kvantiative PCR metoder til detektion af Dehalococcoides sp.. Anvendelse af disse PCR-analyser på sedimentprøverne viser, at der findes Dehalococcoides sp. i lave niveauer i prøverne. Antallet af bakterier kan ikke kvantific e- res, da det er omkring eller under detektionsgrænsen på 700 celler pr. gram sediment. Hedeselskabet: Sag nr

24 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Sammenfatning af forholdene på lokaliteten Følgende kan konkluderes omkring forholdene på lokaliteten: Der er en rimelig forståelse af geologien baseret på de udførte boringer/sonderinger. I hele det undersøgte område er der truffet et sammenhængende sekundært grundvandsmagasin knyttet til et lag af smeltevandssand, der overlejres af ca. 10 meter moræneler. Strømningsretningen i det sekundære grundvandsmagasin er overordnet rettet mod sydøst, dog med nogen variation. Forureningen med klorerede ethener i grundvandet har en udbredelse på ca. 300 meter i længden og 100 meter i bredden og dækker over meget store variationer i koncentrationer. Der eksisterer muligvis yderligere en kilde til forurening med klorerede opløsningsmidler opstrøms det tidligere renseri, da der er truffet indhold af klorerede ethener i boring FB100 og særligt FB5. Der er indikationer på igangværende naturlig reduktiv deklorering. Det mest aktive område vurderes at være omkring FB1 og FB5, hvor alle trin i dekloreringen foregår. I kildeområdet omkring B300 ses ikke væsentlig nedbrydning, mens der umiddelbart nedstrøms (omkring B301, 302 og FB8) ses tydelig omdannelse af PCE til TCE, men kun mindre omsætning videre til cis-dce. Grundvandet på lokaliteten er generelt reduceret uden synderligt indhold af ilt eller nitrat. Området opstrøms- og selve kildeområdet er domineret af jernreduktion (højt indhold af opløst jern). Oxidationskapaciteten på sedimenterne viser, at der er et indhold af sedimentbundet reducerbart jern. I området opstrøms og selve kildeområdet ses indikationer sulfatreduktion. Brintmålingerne understøtter generelt vurderingen af redoxforholdene. Det vurderes, at redoxforholdene er drevet af det naturlige organiske indhold i sedimentet. Der ses ikke forhøjede NVOC indhold, undtagen i boring B300, hvilket kan være en årsag til at de mest reducerede forhold ses i denne boring. Antallet af bakterier svarer til grundvandssedimenter fra andre lokaliteter. PCR-analyser på sedimentprøverne viser, at der findes Dehalococcoides sp. i lave niveauer i prøverne. Antallet af bakterier kan ikke kvantificeres, da det er omkring eller under detektionsgrænsen på 700 celler pr. gram sediment. Dehalococcoider er således påvist i meget lave niveauer, hvilket svarer godt overens med indikationer af igangværende reduktiv deklorering. I kildeområdet og de centrale dele af fanen er den naturlige reduktive deklorering ikke i stand til at sikre en effektiv nedbrydning af de klorerede ethener, da der ses en betydelig spredning af klorerede ethener i grundvandet. Forholdene i den nedre del af fanen er meget dårlig belyst, og det er derfor vanskeligt at vurdere hvilke processer, der medfører at fanen kun har en udbredelse på ca. 300 meter nedstrøms kilden. Det kan være en kombination af reduktiv deklorering, direkte oxidation og fortynding. Hedeselskabet: Sag nr

25 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 4 Stimuleret Reduktiv Deklorering (SRD) 4.1 Treatability studier Til vurdering af potentialet for anvendelse af anaerob reduktiv deklorering som afværgeteknologi på Middelfartvej 126, er der udført en række nedbrydningsforsøg (såkaldte treatability forsøg) i laboratoriet, hvor forskellige elektrondonorer er afprøvet i sammenhæng med tilsætning af mikroorganismer. For nærmere beskrivelse af opsætning af laboratorieforsøg, valg af elektrondonorer og mikroorganismer, analyseparametre og metode henvises til bilag 8. Formål Laboratorieforsøgene skal belyse følgende: Potentialet for at de naturligt tilstedeværende bakterier kan nedbryde PCE ved reduktiv deklorering samt, hvilke nedbrydningsprodukter der dannes. Potentialet for at stimulere de naturligt tilstedeværende bakterier til anaerob deklorering af PCE ved tilsætning af elektrondonorer (ethanol og laktat). Potentialet for om tilsætning af bakterier af typen Dehalococcoides kan fremme anaerob deklorering af PCE til ethen. Er der andre elektronacceptorer til stede, der vil bidrage til forbruget af elektrondonor og i så fald, hvor stort er forbruget af elektrondonor? Opsætning af forsøg Laboratorieforsøgene er udført som batchforsøg med sediment og grundvand fra lokaliteten. Sediment og grundvand blev udtaget fra boringer placeret dels i kildeområdet og dels i forureningsfanen. Endvidere blev der udtaget materiale fra en boring placeret opstrøms det forurenede område. Stimulering af anaerob deklorering er afprøvet ved tilsætning af to typer elektrondonorer; laktat og ethanol. Ele k- trondonor blev tilsat nedbrydningsforsøgene i overskud (3mM) således, at det naturlige donorforbrug, som skyldes tilstedeværelse af andre oxiderede stoffer som NO 3 - og SO 4 2- (vandopløselige), samt Fe 3+ og Mn 4+ (sedimentbundne), kunne dækkes. For at undersøge om nedbrydningen af PCE kunne stimuleres ved tilsætning af mikroorganismer, blev der til nogle af forsøgene tilsat en blandingskultur (KB1 TM ) indeholdende bakterier af typen Dehalococcoides, da disse anses for at kunne fuldføre den totale deklorering af PCE og TCE til ethen. KB1 TM kultur blev tilsat efter ca. 67 dage. For at undersøge potentialet for den naturlige deklorering opsattes forsøg, hvor der hverken blev tilsat elektrondonor eller mikroorganismer. Forsøgsopstillingen bestod endvidere af en række kontrolforsøg tilsat kviksølvklorid for at hæmme den mikrobielle aktivitet med formålet at undersøge, om der var abiotiske processer (sorption, tab gennem propper, abiotisk omsætning), der kunne påvirke koncentrationen af klorerede opløsningsmidler gennem forsøget. Alle forsøg blev udført i duplikater og ved en temperatur på 10 C. Hedeselskabet: Sag nr

26 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Redoxforhold i laboratorie forsøg I forsøg tilsat elektrondonor ses generelt jern(iii)reduktion efterfulgt af sulfatreduktion. I forsøg tilsat ethanol, ses dog jern(iii)reduktion i større omfang sammenlignet med forsøg tilsat laktat og ligeledes ses sulfatreduktion at forløbe hurtigere. Således er sulfat opbrugt i samtlige forsøg efter 100 dage (figur 4.1.). I alle flasker tilsat ethanol ses efter endt sulfatreduktion begyndende methandannelse omkring dag 100, hvorimod der ikke ses methanproduktion i flaskerne tilsat laktat. Tilsætning af bakteriekultur KB1 TM ses at stimulere forbruget af sulfat og produktionen af methan. I flasker tilsat ethanol og bakteriekultur KB1 TM ses en højere methanproduktion end i flasker, hvor der kun er tilsat ethanol. Dette skyldes sandsynligvis, at KB1 TM kulturen ud over deklorerende bakterier også indeholder methandannende bakterier samt rester af elektrondonor sandsynligvis i form af methanol og gærekstrakt, som kan omdannes til methan. Tilsætning af KB1-kultur og ekstra elektrondonor til forsøg med laktat ses at stimulere sulfat-reduktionen i nogle af flaskerne, hvilket sandsynligvis skyldes tilstedeværelse af sulfatreducerende bakterier i KB1-blandingskulturen i kombination med elektrondonorbegrænsning i systemet. Der ses dog ikke methandannelse i nogen af forsøgsflaskerne tilsat laktat. I flaskerne tilsat ethanol kan det beregnes, at ca. 25% af den tilsatte mængde ethanol er brugt til methandannelse, såfremt det antages, at ethanol omsættes til acetat og brint. I forsøg, hvor der ikke er tilsat elektrondonor eller bakteriekultur, ses generelt ret konstante redox-forhold der ses således ikke jern(iii)reduktion eller sulfatreduktion. Overordnet tyder de udførte forsøg på, at forholdene på Middelfartvej naturligt er jernreducerende og at systemet generelt er relativt trægt. Tilsætning af ele k- trondonor vil dog føre til mere reducerede forhold og det i højere grad ved tilsætning af ethanol frem for laktat, hvilket kan skyldes at laktat omsættes langsommere end ethanol. Figur 4.1. Udvikling af redoxparametre i nedbrydningsforsøg forsøg tilsat ethanol og bakteriekultur KB1 udført med sediment fra boring B300III og vand fra boring FB1. Hedeselskabet: Sag nr

27 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Nedbrydning af klorerede ethener i laboratorieforsøg Generelt ses ikke nedbrydning af PCE i kontrolforsøg tilsat kviksølvklorid. I flere af kontrolforsøgene ses dog et fald i PCE-koncentrationen i starten af forsøgene, hvilket sandsynligvis skyldes sorption af PCE til sedimentet, da der ikke observeres dannelse af nedbrydningsprodukter. Generelt ses ikke nedbrydning af PCE i flasker, hvortil der ikke er tilsat elektrondonor eller mikroorganismer (figur 4.2.). Dette er i overensstemmelse med redoxforholdene i flaskerne, der viser, at der er nitrat til jernreducerende forhold, som energimæssigt ikke er optimalt for deklorering ved halorespiration. Tilsætning af elektrondonor i form af laktat eller ethanol ses i nogle af forsøgene at kunne stimulere nedbrydningen af PCE til TCE og videre til cis-dce. Nedbrydningen af PCE går først i gang efter en tilvænningsperiode på mellem dage. Der ses dog ikke videre deklorering af cis-dce til vinylklorid eller ethen indenfor forsøgsperioden (210 dage), uafhængig af hvilken donor der tilsættes. Dette kan enten skyldes, at de rette bakterier ikke er tilstede, eller at nedbrydningen forløber for langsomt til, at der kunne observeres nedbrydning af cis-dce indenfor forsøgsperiodens længde. Generelt tyder forsøgene på, at potentialet for at kunne stimulere anaerob reduktiv deklorering ved tilsætning af elektrondonor alene er begrænset, da nedbrydningen formentlig vil forløbe langsomt, og det endvidere er uvist, om nedbrydningen vil føre til fuldstændig deklorering af PCE til ethen. I alle forsøg tilsat elektrondonor og bakteriekultur KB1 TM ses nedbrydning af PCE til VC, hvor der kun i nogle forsøg ses dannelse af ethen. Nedbrydningen starter umiddelbart efter tilsætning af bakterier og forløber ved reduktiv deklorering, hvor PCE nedbrydes til cis-dce, formentlig via TCE, der nedbrydes til vinylklorid, som nedbrydes til ethen. Af de udførte forsøg fremgår det, at nedbrydningen af TCE forløber hurtigere end nedbrydningen af PCE og cis-dce, hvilket medfører, at der ikke ses akkumulering af TCE, men derimod af cis-dce. Endvidere ses, at vinylklorid nedbrydes relativt hurtigt sammenlignet med cis-dce, da der ses dannelse af vinylklorid og ethen samtidig med, at der foregår nedbrydning af cis-dce (figur 4.2.). Nedbrydningen forløber generelt hurtigere ved tilsætning af ethanol end ved tilsætning af laktat, hvilket formentlig skyldes, at ethanol omsættes hurtigere end laktat. Ved sammenligning med de målte redoxparametre ses en sammenhæng mellem flasker, hvor der ses langsom sulfatreduktion og flasker med langsom nedbrydning af PCE, hvilket kunne tyde på at tilstedeværelse af sulfat er hæmmende for reduktiv deklorering. Ved tilsætning af ekstra elektrondonor efter dag 150 sås i enkelte tilfælde en øget nedbrydning af cis-dce til vinylklorid og ethen, hvilket tyder på, at systemet i slutningen af forsøget er elektrondonorbegrænset. Hedeselskabet: Sag nr

28 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Figur 4.2. Nedbrydning af TCE i forsøg tilsat ethanol og bakteriekultur KB1 udført med sediment fra boring B300 III og vand fra boring FB Sammenfatning af laboratorieforsøg På baggrund af de udførte nedbrydningsforsøg kan følgende konklusioner drages: Potentialet for at opnå nedbrydning af PCE til ethen under naturlige forhold er meget begrænset. Potentialet for at stimulere nedbrydning af PCE til ethen ved tilsætning af elektron donor i form af enten ethanol eller laktat er begrænset, da nedbrydningen formentligt ikke vil føre til fuldstændig deklorering men mere sandsynligt dannelse af cis-dce. På baggrund af de udførte laboratorieforsøg vil det være muligt at opnå nedbrydning af PCE til ethen ved tilsætning af bakteriekulturen KB1 TM samt elektrondonor Både ethanol og laktat vil kunne stimulere nedbrydning af PCE til ethen ved samtidig tilsætning af bakteriekulturen KB1 TM, men tilsætning af ethanol vil medføre en hurtigere nedbrydning til ethen. Ved anvendelse af ethanol vil der dog være et tab af donor til methandannelse. På lokaliteten er der naturligt jernreducerende forhold og et højt indhold af sulfat, hvilket betyder, at der ved tilsætning af elektrondonor skal tages højde for et ekstra forbrug til reduktion af jern og sulfat. Hedeselskabet: Sag nr

29 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 4.2 Samlet vurdering af SRD i forhold til lokaliteten På Middelfartvej 126 er der konstateret tegn på naturlig reduktiv deklorering af de klorerede ethener i det sekundære grundvand. Samtidig er der påvist tilstedeværelse af bakterierne Dehalococcoides, der kan forestå en fuldstændig omsætning af PCE til ethen. At der foregår reduktiv deklorering i grundvandet understøttes af redoxforholdene. Det er imidlertid også tydeligt, at den reduktive deklorering ikke nær har et omfang, der kan eliminere risikoen for en uacceptabel spredning af klorerede ethener i grundvandet. Treatabilityforsøgene har vist, at det er muligt at stimulere den naturlige reduktive deklorering ved tilsætning af substrater (laktat og ethanol). Processen ser ud til at stoppe ved cis-dce, med en ophobning af denne forbindelse til følge. Om denne ophobning skyldes, at de naturlige Dehalococcoider kun er tilstede i ringe omfang, eller at den specifikke type af dehalococcoider ikke kan fuldføre sidste del af dekloreringen er uvist. Såfremt førstnævnte forklaring er rigtig, kan det ikke udelukkes at den fulde deklorering vil kunne forløbe efter en længere lagfase (hvor bakterierne opformeres) ved tilsætning af substrat alene. I forbindelse med treatabilityforsøgene sås en meget entydig effekt af tilsætning af bakteriekulturen KB1 TM. Dels skete omsætningen af de klorerede ethener meget hurtigere og dels kunne der observeres en fuldstændig omsætning til ethen i enkelte af prøverne. Overordnet må det konkluderes, at der er et godt potentiale for anvendelse af stimuleret reduktiv deklorering som afværgemetode i forhold til forureningen med klorerede ethener i det sekundære grundvand på Middelfartvej 126. Med den erkendelse in mente, melder der sig en række naturlige problemstillinger omkring, hvordan denne metode lader sig anvende i praksis: Valg af område, der skal oprenses (entrepriseområde). Fysiske forhold logistik. Valg af substrat i forhold til eks. permeabilitet, pris etc. Valg af evt. mikroorganismer. Substratmængde og doseringsmetode. Moniteringsplan med stopkriterier og alarmværdier. Disse forhold vil i det følgende blive diskuteret med afsæt i den gennemførte undersøgelse og konklusionerne på disse Valg af entrepriseområde SRD er tidligere blevet opfattet som en lav-intensiv oprensningsmetode, der er særlig velegnet til oprensning af forureningsfaner. Fjernelse af den frie fase anbefales stadig altid forud for en oprensning med stimuleret in situ reduktiv deklorering. De nyere erfaringer fra laboratorieforsøg viser imidlertid, at potentialet for at sti- Hedeselskabet: Sag nr

30 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense mulere nedbrydning af frie faser eller på grænsefladen mellem frie faser og forureningsfanen tilsyneladende til stede. Dette forhold er et væsentligt forskningsområde og undersøges i øjeblikket i felten i Nordamerika i pilotforsøg. Forholdene på Middelfartve j 126 viser, at den største naturlige aktivitet sker forholdsvis tæt på forureningskilden. Samtidig er substratbehovet overordnet styret af indholdet af konkurrerende elektronacceptorer (der skal reduceres) og dermed stort set uafhængig af indholdet af klorerede opløsningsmidler. Beregninger af substratbehov (afsnit 4.2.4) viser at det er langt under 1% af substratet, der anvendes direkte til den reduktive deklorering, mens langt hovedparten anvendes til reduktion af det (uorganiske) kemiske miljø. Der er således absolut mest miljø for pengene ved at vælge et entrepriseområde, hvor der dels foregår naturlig reduktiv deklorering og dels forefindes høje koncentrationer af klorerede opløsningsmidler. Figur 4.3 viser et forslag til entrepriseområde på lokaliteten. Bys tævn ev ej FB101 FB100 B303 FB5 Hauges Plads Mi d d el fa rtve j FB2 B5 FB3 FB1 FB6 FB103 B300 FB4 Kl ø ve rmo sev ej L un d gå rd sv e j B301 FB10 Ka n c e ll i ve j Sta d io n ve j FB104 FB7 FB9 B302 FB8 GP27 GP25 GP24 FB102 GP26 GP23 FB11 GP22 GP21 GP17 GP31 GP19 GP11 GP13 GP m Gotersvej FB/B, boringer B300-B303, boringer hvor der er udtaget sedimentprøver GP-boringer Forslag til entrepriseområde Figur 4.3. Forslag til entrepriseområde på Middelfartvej 126. Renserigrund Arealet af det foreslåede entrepriseområde er ca m 2. Det behandlede område vil omfatte grundvandsmagasinet, hvilket i dette tilfælde vil være laget af smeltevandssand. Sandlaget har meget varierende tykkelse, men vurderes indenfor entrepriseområdet at have en gennemsnitlig mægtighed på ca. 5 meter. Det samlede behandlingsvolumen i grundvandet er derfor ca m 3. Centralt i kildeområdet Hedeselskabet: Sag nr

31 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense kan det overvejes også at behandle den umættede zone for at sikre, at den reduktive deklorering allerede stimuleres i selve kilden Fysiske forhold logistik - doseringsmetode Det valgte entrepriseområde er beliggende under Middelfartvej og Lundgårdsvej, under eksisterende bygninger og tilhørende befæstede og ubefæstede arealer. Det er forbundet med forholdsvis store vanskeligheder at anlægge et effektivt doseringssystem, særligt pga. den stærkt trafikerede Middelfartvej. Det anses for urealistisk at foretage en dosering direkte under veja realer og bygninger. Valget af substrat bør derfor være af en type, der kan spredes naturligt med grundvandsstrømningen og evt. ikke omsættes for hurtigt. Mht. doseringsmetode er der i udlandet opnået bedst erfaringer med cirkulationsceller, hvor grundvand recirkuleres under tilsætning af substrat og evt. mikroorganismer. Systemet er robust, da der løbende kan foretages justeringer i injektionspunkter (dybde og placering) injektionsmængder og koncentrationer. Ulemperne hæfter sig primært ved, at det kræver løbende vedligeholdelse og anlæg af faste installationer (injektions/ekstraktionsboringer, rør, pumper, doserings- og vandbehandlingsanlæg etc.). Umiddelbart vurderes det dog mest hensigtsmæssigt at have et robust/fleksibelt system (cirkulationsceller), der netop kan tage højde for de vanskelige adgangsforhold på Middelfartvej 126. Det endelige setup må bero på udenlandske erfaringer samt beregninger i forhold til de konkrete forhold på lokaliteten Valg af substrat Baseret på de udførte treatabilityforsøg ville det umiddelbare substratvalg være ethanol, da der sås den hurtigste stimulering af reduktiv deklorering. Imidlertid vil de fysiske forhold og doseringsmetode kræve at substratet ikke nedbrydes for hurtigt, hvorfor laktat muligvis er bedre egnet. Ethanol har desuden vist sig at udvikle større mængder af methan, hvilket kan være et problem hvis donoren tilsættes i større mængder (eksplosionfare samt mulig hæmning af den reduktive deklorering). Når et endeligt doseringssystem er planlagt, bør der foretages beregninger/simuleringer af substratspredningen og dermed opholdstiden. Dette skal så sammenholdes med de reaktionstider, der er observeret i treatabilityforsøgene for at sikre at substratet stadig er aktivt når det spredes ind under veje og bygninger. Markedsprisen på ethanol og laktat i Danmark kendes ikke når der er tale om betydelige mængder (tons). I forbindelse med en prisberegning Hedeselskabet foretog for Københavns Amt i 2002 er der dog indhentet en pris for laktat på ca. 10 kr./kg. Prisen for ethanol forventes at være i samme størrelsesorden. Hedeselskabet: Sag nr

32 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Valg af evt. mikroorganismer På Middelfartvej 126 bør der tilsættes KB1 TM sammen med substratet for at opnå en fuldstændig deklorering inden for en rimelig tidshorisont. Prisen på KB1 TM kendes ikke og vil sandsynligvis afhænge af mængderne Substratmængde I følgende beregningseksempel er det antaget at det samlede entrepriseområde/- volumen behandles på én gang, dvs. at hele områdets indhold af konkurrerende elektronacceptorer skal reduceres. Dette er en overslagsberegning, som skal forfines, når doseringsmetode og entrepriseområde er endelig fastlagt. Det samlede volumen af grundvand, der skal behandles er (8.000 m 3 0,3) = m 3, hvis porøsiteten sættes til 0,3 (svarende til mellemkornet sand). Den samlede masse af sediment, der skal reduceres er: (8.000 m 3 1,8 ton/m 3 ) = tons, hvis massefylden af sand sættes til 1,8 ton/m 3. I det følgende (tabel 4.1) er lavet en beregning af det samlede substratbehov baseret på laktat som substrat (donor) Tabel 4.1 Beregning af substratbehov i entrepriseområdet Konkurrerende elektronacceptor Enhed Gns. Konc. Masse i entreprisevolumen Laktatforbrug (g/g) Substratbehov (kg) (kg) Ilt mg/l 0 0 0,93 0 Nitrat mg/l 0 0 0,61 0 Jern (sediment) g/g 0, , Sulfat mg/l , I alt * Det er antaget, at hele oxidationskapaciteten svarer til reducerbart jern(iii) med en gennemsnitskoncentration på 45 µeqv/g sediment, hvilket giver µg/g sediment. Som det fremgår af tabel 4.1 er det samlede forbrug til laktat til reduktion af de konkurrerende elektronacceptorer ca kg. Langt størstedelen (ca. 97%) anvendes til at reducere sedimentet. Det skal i den forbindelse pointeres, at det er usikkert hvor stor en del af de oxiderede forbindelser i sedimentet der er biologisk tilgængelige. Substratmængden er derfor muligvis overestimeret. Prisen alene for substratet vil beløbe sig til ca kr. Efter behandlingen af det samlede behandlingsvolumen, skal der kontinuerligt tilsættes substrat for at få forbrugt in-fluxen af elektronacceptorer (primært opløst sulfat). Det er dog beskedne mængder substrat der skal tilsættes. Hedeselskabet: Sag nr

33 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense Monitering Forud for en oprensning baseret på SRD, vil det være påkrævet at finde ud af kildestyrken massen og koncentration af PCE. På baggrund af dette kan det vurderes, hvor meget af massen der er i umættet zone, og hvor meget der er i mættet zone, samt hvad udvaskningshorisonten er. Uanset hvad, er det sandsynligt, at der skal foretages et specifikt indgreb overfor kilden, for at reducere den samlede masse og dermed udvaskningshorisonten (og dermed løbetiden for en afværgeløsning baseret på SRD). Valg af metode til oprensning af kilden (umættet zone) skal dog tilpasses oprensningen i den mættede zone, hvis denne baseres på SRD. Eksempelvis vil oxidation af kildeområdet virke direkte modsat SRD, der kræver stærkt reducerede forhold. Mht. analyseparametre i forbindelse med et moniteringsprogram bør det som minimum indeholde analyser af klorerede ethener og nedbrydningsprodukter af disse (inkl. ethen og ethan), analyse af donoren og nedbrydningsprodukter af denne samt indikative redoxkomponenter som f.eks. nitrat, opløst jern og sulfat. Methan bør ligeledes overvåges, da der sandsynligvis vil dannes methan ved tilsætning at ethanol, jf. treatabilityforsøgene. Ved tilsætning af store mængder ethanol vil methandannelsen kunne udgøre en potentiel risiko overfor beboelser mv. i området (eksplosionsfare). Dette forhold skal undersøges i forbindelse med udarbejdelse af et projektforslag. I tilfælde af, at der også tilsættes mikroorganismer, skal der som minimum foretages simple tællinger af bakteriepopulationen ved AODC tællinger, gerne suppleret med analyse for indhold af Dehalococcoides, der tilsættes via KB1 TM kulturen. Der bør inddrages boringer nedstrøms entrepriseområdet, for at følge de tilsatte bakteriers mulige transport og overlevelse nedstrøms entrepriseområdet. Kravene til monitering ved valg af recirkulationsceller vil være større end ved tilsætning af substrat i et passivt system, som f.eks. engangstilsætning af HRC TM. Dette skyldes at recirkulationscellerne vil kræve en løbende tilpasning/justering der skal således dels udføres analyser af grundvand fra moniteringsboringer, dels analyser af recirkulationsvandet. Omvendt skulle recirkulationsceller sandsynligvis forkorte afværgeperioden og være mere effektiv i forhold til en passiv metode. Et moniteringsprogram bør være i drift så længe SRD anvendes som teknik og gerne en årrække efter ophør af SRD (dvs. tilsætning af substrat og evt. mikroorganismer). Der bør opstilles stopkriterier for moniteringsprogrammet og dermed SRD samt alarmniveauer i tilfælde af, at teknikken ikke har den ønskede effekt eller der sker utilsigtet spredning af eksempelvis mikroorganismer. Hedeselskabet: Sag nr

34 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense 5 Referenceliste Fyns Amt (2003). Forureningsundersøgelser Delprojekt 1. Tidligere renseri, Middelfartvej 126, Odense. Udarbejdet af NIRAS 19. marts Fyns Amt (1999). Forureningsundersøgelse. Affaldsdepot nr Tidligere renseri, Middelfartvej 126. Odense Kommune. Hoved + bilagsrapport. Udarbejdet af NIRAS februar Fyns Amt (2001). Affaldsdepot nr Middelfartvej 126, Odense. Monitering nr. 1 af forureningsfane i grundvand. Modellering af forureningsspredning. Udarbejdet af NIRAS august Kjeldsen, P. & Christensen,T.H.(eds.) (1996): Kemiske stoffers opførsel i jord og grundvand. Vol (Behaviour of pollutants in soil and groundwater, in Danish). Miljøstyrelsen, København. Projekt om jord og grundvand fra Miljøstyrelsen, 20. pp Ludvigsen,L., Albrechtsen,H.-J., Ringelberg,D., Ekelund,F. & Christensen,T.H. (1999): Distribution and composition of microbial populations in a landfill leachate contaminated aquifer (Grindsted, Denmark). Microbial Ecology, 37, (3), Yang Y., McCarty P.L. (1998) Competition for Hydrogen within a Chlorinated Solvent Dehalogenating Anaerobic Mixed Culture. Environ. Sci. Technol, 30, Mazur C.S. and Jones W.J. (2001) Hydrogen Concentrations in Sulfate-Reducing Estuarine Sediments during PCE Dehalogenation. Environ. Sci. Technol, 35, Hunkeler, D.; Aravena, R.; Butler, B.J. (1999). Monitoring Microbial dechlorination of tetrachloroethene (PCE) in groundwater using compound-specific stable carbon isotopes ratios: microcosm and field studies. Environmental Science and Technology, 33, Lollar, B.S.; Slater, G.F.; Sleep, B.; Witt, M.; Klecka; Harkness, M.; Spivack, J. (2001): Stable carbon isotope evidence for intrinsic bioremediation of tetrachloroethene and trichloroethene at area 6, Dover Air Force Base. Environmental Science and Technology, 35, Hendrickson ER, Payne JA, Young RM, Starr MG, Perry MP, Fahnestock S, Ellis DE, Ebersole RC Molecular analysis of Dehalococcoides 16S ribosomal DNA from chloroethene-contaminated sites throughout North America and Europe. Appl. Environ. Microbiol. 68: Major, D.; Edwards, E.; McCarty, P., Gossett, J.; Hendrickson, E. Frank Loeffler, Zinder, S., Ellis, D., Vidumsky, J., Harkness, M., Klecka, G., Cox, E. "Discussion Hedeselskabet: Sag nr

35 Fyns Amt: Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering ved oprensning af grundvandsforurening, Middelfartvej 126, Odense of Environment vs. Bacteria or Let s Play Name that Bacteria " Ground Water Monitoring & Remediation, 23(2): Hedeselskabet: Sag nr

36 Bilag 1

37

38

39

40

41

42

43

44

45

46

47 Bilag 2

48 Middelfartvej Boring FB1-2 FB100-1 B300 B301 B302 Enhed Filterinterval, m u. t. 11,4-13,4 14,5-17,5 10,0 8,4-9,4 11,5-12,5 Prøvetagningstidspunkt Ilt, feltmåling mg/l 3,22 1,72 ph, feltmåling 6,9 6,53 ph, laboratorie 7,2 7,2 7,6 7,1 7,2 Ledningsevne ms/m , Calcium mg/l Magnesium mg/l Kalium mg/l 5,6 5,1 7,3 3,0 5,0 Natrium mg/l Jern mg/l 5,0 2,7 4,7 0,072 0,025 Mangan mg/l 0,37 0,34 0,36 0,51 0,41 Ammonium mg/l 0,21 0,29 0,48 0,067 0,016 Nitrit mg/l <0,010 <0,010 <0,010 0,078 0,012 Nitrat mg/l <1,0 <1,0 <1,0 <1,0 8,0 Total-P mg/l 0,063 0,053 0,037 0,026 0,044 Klorid mg/l 77,9 71,6 28,9 31,9 66,3 Flourid mg/l 0,27 0,31 <0,050 0,14 0,17 Sulfat mg/l Aggressiv kuldioxid mg/l <2 <2 <2 <2 <2 Hydrogencarbonat mg/l Inddampningsrest mg/l Iltindhold, laboratorie mg/l 0,4 0,2 0,3 0,5 1,0 NVOC mg/l 2,1 1,4 13 2,2 1,8 Sulfid-S mg/l 0,010 0,015 <0,010 0,011 0,012 Methan mg/l 0,025 <0,010 0,084 <0,010 <0,010 Arsen µg/l 2,5 10 1,1 0,82 0,54 Barium µg/l Bor µg/l Nikkel µg/l 1,7 1,8 10 6,1 18 Triklormethan µg/l <2,0 <0,02 <20 <0,05 <0,2 1,1,1-triklorethan µg/l <2,0 <0,02 38 <0,05 <0,2 Tetraklormethan µg/l <2,0 <0,02 <20 <0,05 <0,2 Triklorethylen µg/l , ,5 20 Tetraklorethylen µg/l Vinylklorid µg/l <0,10 <0,10 0,66 <0,10 <0,10 1,1-diklorethylen µg/l 4,5 <0,02 <20 0,19 <0,2 trans-1,2-diklorethylen µg/l <2,0 <0,02 <20 <0,05 <0,2 cis-1,2-diklorethylen µg/l 260 <0, ,8 6,8 1,1-diklorethan µg/l 27 <0,02 <20 0,11 <0,2 Ifølge analyserapporten er prøve B301 og FB100-1 dekanteret inden analyse, undtagen ilt, ph og lednin

49 Bilag 3

50 Miljø & Ressourcer DTU Februar 2004 Dette notat er en afrapportering af måling af isotopforholdet for 12 C og 13 C for klorerede ethener på grundvandsprøver fra Middelfartvej Materialer og metoder Der er udtaget i alt 12 vandprøver fra Middelfartvej. Der blev udtaget 6 vandprøver i maj og 6 vandprøver i august. For at vurdere den tidslige variation indgik to boringer (FB1, FB4) i begge datasæt. Alle prøverne er efter udtagning blevet konserveret og sendt til University of Neuchatel for analyse for specifikke stabile isotoper for de specifikke klorerede ethener (PCE, TCE, cis-dce og VC). Der er parallelt foretaget en analyse på Miljø & Ressourcer DTU for indholdet af klorerede ethener. De udvalgte boringer svarer til de boringer, hvor der er udtaget sedimentkerner til treatabilityforsøg. Der er suppleret med ekstra vandprøver fra andre boringer for at opnå et mere nuanceret billede af forholdene. Analysemetode: 13 C/ 12 C-isotopforholdene blev målt vha. en gaschromatograf med en HP-5 kolonne koblet til et Thermo Finnigan DeltaPlus XP isotope-ratio massespektrometer via et interface, hvor de eluerende organiske forbindelser forbrændes til CO 2. Vandprøver blev ekstraheret ved fastfasemikroekstraktion (SPME) fra headspace i 40 ml VOC vials, hvor 5 ml vandfase var blevet udskiftet med luft. Der anvendtes polydimethylsiloxanecarboxen fibre, en ekstraktionstid på 15 min under magnetomrøring med 1100 rpm, og desorption i 5 min ved 300 C. Isotopforholdene blev beregnet i forhold til en ekstern CO 2 reference gas og korrigeret for den lille isotopfraktionering ved ekstraktionen vha. reference TCE og PCE, som blev analyseret analogt til prøverne og i tilsvarende koncentrationer. Standardafvigelsen ved metoden er 0.5. Resultaterne opgives i en delta notation (δ 13 C) i forhold til VPDB (Vienna Pedee Belemnite). δ 13 C værdien er defineret som δ 13 C = (R s /R r -1)*1000, hvor R s og R r er δ 13 C/δ 12 C forholdet i henholdsvis vandprøven og standarden (Hunkeler et al., 1999). Med denne notation betyder en ændring af δ 13 C fra fx 30 0/00 til 20 0/00, at der er sket en relativ stigning i indholdet af 13 C i forhold til 12 C. Det vil typisk være tegn på nedbrydning af fx PCE, da der vil ske en præferentiel nedbrydning af PCE molekyler med 12 C frem for PCE molekyler med 13 C. Isotopfraktionering er mest udtalt for anaerob deklorering af cis-dce og VC (Hunkeler et al., 1999; Lollar et al., 2001). Resultater Resultaterne for målinger af isotopforholdet for 13 C-isotopen for de klorerede ethener og indholdet af klorerede ethener i vandprøverne er angivet i tabel 1. På grund af detektionsgrænsen på ca. 50 µg/l er der ingen data for VC, og der er kun målinger af cis-dce for ca. halvdelen af vandprøverne. Af samme årsag er der ingen resultater for FB11 og FB100. 1

51 Miljø & Ressourcer DTU Februar 2004 De to vandprøver, hvor der er foretaget gentagne målinger, viser en god overensstemmelse for isotopforholdet for 13 C-isotopen. Der er til gengæld en del variation i koncentrationen af de klorerede ethener. For FB4 s vedkommende er molforholdet mellem de dominerende klorerede ethener dog stort set uændret, mens vandprøven for FB1 i april indeholder forholdsvist mere TCE i forhold til prøven fra august. På trods af disse variationer er det valgt at kombinere resultaterne fra de to prøvetagninger, så der fremkommer et større samlet datasæt. Boring B300 repræsenterer formentlig kildens sammensætning med hensyn til isotopindhold. Der er stort set ingen nedbrydning af PCE i B300, som det fremgår af figur 1, hvor molfraktionen for de forskellige boringer er vist. δ 13 C forholdet i B300 er 30 0/00, hvilket er typisk for PCE (Hunkeler et al., 1999). PCE i FB4, B301, FB8 og B302 har en isotopsammensætning, som er lidt mindre negativ med hensyn δ 13 C indholdet end B300, hvilket indikerer en lille nedbrydning af PCE i disse boringer. Til sammenligning er der i FB1 og FB2 sket en betydelig nedbrydning illustreret ved et mindre negativt δ 13 C indhold for PCE. Der er her sket en berigning af δ 13 C i forhold til δ 12 C i vandprøverne fra disse boringer. Dette stemmer meget fint med, at molfraktionen er klart større for cis-dce i FB1 og FB2 sammenlignet med boringerne FB4, B301, FB8 og B302. For FB4 bliver 13 C forholdet mere negativt (forøget 12 C) for TCE samtidig med at 13 C for PCE bliver mindre negativt (formindsket 12 C). Dette tyder på en ophobning af TCE, hvilket stemmer med, at molfraktionen af cis-dce er meget lav i vandprøven fra FB4 i forhold til alle andre vandprøver. Boringerne FB1 og især FB2 udviser ud fra isotopsammensætningen på TCE stærke tegn på dannelse af cis-dce. Der er på grund af isotopfordelingen i cis-dce også indikationer for en videre nedbrydning til VC i FB2 og ikke mindst FB5. Det sidste kan dog ikke bekræftes af målingen af VC. Der kan under forudsætning af, at isotopfraktioneringen i laboratorieforsøg er repræsentativ for feltforholdene på Middelfartvej foretages en vurdering af den relative nedbrydning af PCE i de forskellige områder. Der er kun få data i litteraturen for den såkaldte fraktioneringsfaktor, men Lollar et al. (2001) rapporterer en fraktioneringsfaktor for PCE på Det antages, at B300 repræsenterer det initielle isotopforhold for 13 C. Med disse forudsætninger kan graden af PCE nedbrydning vurderes ved hjælp af beregningsmetoden i Lollar et al. (2001). Overslagsberegningerne viser, at mere end 80% af den oprindelige PCE er blevet nedbrudt i boringerne FB1 og FB2, mens kun ca. 30% af den oprindelige PCE er nedbrudt til TCE i området nedstrøms B300. Sammenfattende viser isotopfordelingen i forureningsfanen på Middelfartvej, at der er et aktivt område med hensyn til flere af trinene i den anaerobe deklorering omkring boring FB5 og FB2. Aktiviteten klinger tilsyneladende af tættere på FB1 og ved B300 domineres forholdene af PCE-kilden nær skellet af Middelfartvej 124 og Lundsgårdsvej 4. Nedstrøms B300 udviser B301, B302 og FB8 tegn på en tydelig nedbrydning af PCE til TCE, men kun en mindre nedbrydning til cis-dce. 2

52 Miljø & Ressourcer DTU Februar 2004 Isotopforhold giver som metode en uafhængig vurdering af den anaerobe deklorering på forurenede lokaliteter. Hvis detektionsgrænsen i fremtiden reduceres med en faktor 10, vil metoden være et meget stærkt værktøj for at vurdere omfanget af anaerob deklorering. Tabel 1: Koncentration (µg/l) og δ 13 C isotopforholdet for PCE, TCE og cis-dce for vandprøver på Middelfartvej. Boring Prøve- Koncentration Isotopforhold Tagning PCE TCE cis-dce VC PCE TCE cis-dce FB100 August 4 u.d. 1 u.d. B300 August B301 August B302 August u.d FB1 August FB1 April FB2 April FB4 August u.d FB4 April u.d FB5 April u.d FB8 April u.d FB11 April u.d. u.d. u.d. u.d. u.d. under detektionsgrænsen Referencer Hunkeler, D.; Aravena, R.; Butler, B.J. (1999). Monitoring Microbial dechlorination of tetrachloroethene (PCE) in groundwater using compound-specific stable carbon isotopes ratios: microcosm and field studies. Environmental Science and Technology, 33, Lollar, B.S.; Slater, G.F.; Sleep, B.; Witt, M.; Klecka; Harkness, M.; Spivack, J. (2001): Stable carbon isotope evidence for intrinsic bioremediation of tetrachloroethene and trichloroethene at area 6, Dover Air Force Base. Environmental Science and Technology, 35,

53 Miljø & Ressourcer DTU Februar % 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% B300 FB4 FB4 B302 B301 FB8 FB1 FB2 FB1 FB5 PCE TCE cis-dce Vc Figur 1: Molfraktion af de klorerede ethener for vandprøver ved Middelfartvej, hvor der målt isotopforhold for klorerede ethener. B300 FB4 FB4 B302 B301 FB8 FB1 FB2 FB1 FB C isotopforhold PCE TCE cis-dce Figur 2: Isotopforhold (δ 13 C) for klorerede ethener i vandprøver for Middelfartvej. 4

54 Bilag 4

55 Miljø & Ressourcer DTU Januar 2004 Dette notat er en afrapportering af bestemmelse af oxidationskapacitet på 5 grundvandssedimenter fra Middelfartvej Materialer og metoder Der er udtaget 5 kerner i maj 2003 på Middelfartvej. Prøverne er i laboratoriet håndteret anaerobt i en anaerob box. De fem prøver svarer til de 5 sedimenter, der parallelt indgår i det udførte treatability studie, således at resultaterne direkte kan sammenholdes med disse. Prøvetagningssteder er angivet i tabel 1. Oxidationskapaciteten giver et mål for den mængde oxiderede stoffer der kan reduceres ved titrering med Ti(III)-50mM EDTA. Metoder er oprindelig udviklet af Heron et al. (1994). Princippet i metoden er, at ca. 1g våd sedimentprøve udrystes i 24 timer med Ti(III)-50mM EDTA. Den forbrugte mængde Ti(II) kvantificeres ved en dichromat titrering, som et mål for prøvens oxidationskapacitet. Tørstofindholdet i sedimentet bestemmes, og oxidationskapaciteten angives i µeq/g tørvægt (dw). Efterfølgende bestemmes indholdet af Fe(II) og Mn i opløsningen, således at den reducerede mængde jern(iii) og Mn(IV) kan beregnes. Indholdet af jern og mangan blev analyseret på Atom Absorption Spektrofotometri (AAS). Resultater Resultaterne for oxidationskapaciteten er givet i tabel 1. Oxidationskapaciteten varierer mellem 38,7 µeq/g og 49,3 µeq/g for de 5 sedimenter, hvilket er en ganske begrænset variation. Størstedelen af oxidationskapaciteten (80-86%) kan for B300-III, B301A og B302 forklares ved hjælp af indholdet af jern og mangan. I B300-II og B303 er det kun ca. 50% som kan tilskrives jern og mangan. Mangan udgør kan i alle prøver kun forklare få procent. De højeste oxidationskapacitet er observeret i boring 302, hvilken er i overensstemmelse med, at farven her er brun i modsætning til alle andre prøver, hvor farven er angivet som grå. Indholdet af jernhydroxider er også højere i denne prøve end i de øvrige. At oxidationskapaciteten ikke er endnu højere i denne prøve, kan skyldes, at materialet har en grovere karakter (mere gruset) i forhold til de øvrige prøver. Resultaterne viser, at der i alle prøver er et potentiale for jernreduktion og i mindre omfang manganreduktion. På baggrund af disse resultater kan der foretages en vurdering af substratforbruget for at omsætte den samlede oxidationskapacitet eller dele af oxidationskapaciteten. 1

56 Miljø & Ressourcer DTU Januar 2004 Tabel 1: Prøvetagningssteder, geologi, oxidationskapacitet, Fe, Mn i sedimenter fra Middelfartvej Placering Opstrøms Kilde Kilde Fane Fane Boring Nummer B303 B300-III B300-II B301A B302 Dybde (m.u.t.) m.u.t. 12,0-12,5 7,5-8,0 9,5-10,0 8,8-9, ,5 Geologisk beskrivelse Oxidations kapacitet Fe Mn Baseret på boreprofiler fra NIRAS µeq/g dw % % Sand, fint mellem, grå Moræneler, sandet, stenet, gråt Sand, Fint/mellem, lerklumper, enk. sten, gråt Sand, Fint/mellem, gråt Grus, fint, sand, svagt leret, brun* 42,3 39,8 43,5 38,7 49,3 50,9 74,5 42,5 76,0 80,3 4,3 5,2 2,9 6,6 5,2 * Der er ikke angivet specifik farve for prøven i NIRAS s beskrivelse, men prøverne over og under er angivet som rødbrune og brune. Referencer Heron,G., Christensen,T.H. & Tjell,J.C. (1994): Oxidation capacity of aquifer sediments. Environmental Science and Technology, 28,

57 Bilag 5

58 Miljø & Ressourcer DTU Januar 2004 Dette notat er en afrapportering af målinger af indholdet af opløst H 2 i grundvandet fra Middelfartvej lokaliteten Materialer og metoder Der er målt for H 2 ved Middelfartvej lokaliteten i september 2003, ved de beregninger der er lavet herudfra er eksisterende målinger der ligger tættest herpå i tid anvendt. Det drejer for de fleste boringer og parametres vedkommende om nogle måneder. De H 2 koncentrationer der findes i grundvandet er meget små, i størrelsesordenen nanomol/l. For at måle de lave koncentrationer benytter man sig af at H 2 er ret uopløseligt i vand. Ved at lade vandet passere gennem en luftbobbel (bubble-stripping), som efter ca min vil være i ligevægt med vandet, opnår man en koncentration i gasfasen der er ca. 50 gange højere. De små koncentrationer gør at der ikke skal meget til for at de værdier der måles slet ikke afspejler forholdene i grundvandsmagasinet. Det viste sig at være forbundet med en del vanskeligheder at prøvetage de eksisterende boringer for H 2. Som bekendt indeholder vand store mængder H 2, ca. 110 mol/liter, så hvis bare lidt af vandet spaltes i H 2 og O 2 vil det påvirke H 2 koncentrationen. Vandet kan spaltes ved elektrolyse, og det har vist sig at jævnstrømspumper som f.eks. de såkaldte Whale pumper kan frigøre enorme mængder H 2 ved elektrolyse. Derudover kan mange metaller, jern, zink, aluminium, kobber mfl. medføre en reduktion og frigørelse af H 2 fra vandet. Derfor er den mest anvendte pumpe ved prøvetagning af eksisterende boringer en peristaltisk pumpe, fordi vandet her ikke kommer i kontakt med metaldele. Dette var imidlertid ikke umiddelbart farbart på lokaliteten ved Middelfartsvej. Flere af boringerne er af relativ stor diameter, så selv om afstanden til vandspejlet ikke var større end at det kunne lade sig gøre at pumpe med en peristaltisk pumpe, så krævede boringsdimensionerne en større pumpekapacitet end den der kan opnås med en almindelig peristaltisk pumpe. Tidligere undersøgelser har vist at en MP1 pumpe kan anvendes, men en prøvetagningsrunde ved Middelfartsvej viste at dette alligevel ikke var tilfældet. Om det skyldes vandkemien på lokaliteten, eller at der var tale om en anden MP1 pumpe end den der i sin tid blev testet er ikke forsøgt afklaret. Den endelige løsning ved Middelfartsvej blev en kombination af en MP1 pumpe øverst i boringen og indtaget fra en peristaltisk pumpe ca. 1,5 m under denne. Enkelte boringer gav så lidt vand, og havde så relativt lille diameter så der udelukkende blev anvendt en peristaltisk pumpe. Der blev på trods af at der blev brugt en peristaltisk pumpe enkelte steder målt urealistisk høje værdier. Dette tolkes som værende enten et resultat af at der har siddet en Whale pumpe i boringen inden prøvetagningen og at metaldelene i sig selv har været nok til at danne H 2, eller at det er H 2 der sidder tilbage fra tidligere prøvetagninger.

59 Miljø & Ressourcer DTU Januar 2004 Resultater De resultater som det alt i alt har været muligt at opnå, og som skønnes med rimelighed at afspejle det reelle H 2 niveau er gengivet i tabel H2.1. Tabel H2.1 : H 2 Koncentrationer fra Middelfartvej Boring prøvetagningspumpe H2 nm FB100 MP1+peristaltisk 0.17 FB2-2 MP1+peristaltisk 0.08 FB300-III* Peristaltisk 2.26 FB01-2 MP1+peristaltisk 0.21 FB4-2 MP1+perist FB302 Peristaltisk 0.06 FB301 MP1+perist FB5 MP1+perist *denne boring giver meget lidt vand og der har været brugt en Whale pumpe der kan have efterladt H2 Koncentrationerne er generelt ret lave, og lavere end det niveau, ca. 0,4-2nM, der normalt angives som værende karakteristisk når der observeres dechlorering (Yang og McCarty, 1998; Mazur og Jones, 2001). Antallet af gode feltdatasæt er imidlertid meget begrænset og intervallet er baseret på laboratorieforsøg. Udfra målingerne af H 2 koncentrationerne samt koncentrationerne af de reaktanter og produkter som indgår i mikrobielt medierede redox reaktioner med H 2 kan man beregne den energi der er til rådighed for reaktionen. En given reaktion kræver en vis ekstra energi for at kunne foregå, og det ser ud til at der er en tendens til at des mere energi processen kan frigive des mere ødselhed er der plads til. Således ser det ud til at den ekstra energi der er til rådighed når der foregår nitratreduktion er >150 kj/mol H 2, mens når der sker methandannelse er den ekstra energi kun ca kj/mol. Hvormeget af den ekstra energi bakterierne kan udnytte er vanskeligt at sige for de processer med en stor ekstra energi, men for methandannelse er den ekstra energi der er til rådighed meget tæt på den teoretiske minimumsværdi for hvormeget energi der skal være til rådighed for at mikroorganismerne kan oplagre den energi de opnår ved reaktionen. Gibbs energierne (som er negative når der er tale om en energigevinst) for de dechloreringstrin der er relevante for Middelfartvej er gengivet i tabel H2.2.

60 Miljø & Ressourcer DTU Januar 2004 TABEL H2.2: Beregnede Gibbs energier for de tre relevante dehalogeneringstrin for prøver fra Middelfartvej. Her er udelukkende medtaget de prøver hvor H 2 koncentrationen ikke ser ud til at være påvirket af brugen eller tilstedeværelsen af DC Whale pumperne. Boring PCE->TCE TCE->cDCE cdce->vc kj/mol kj/mol kj/mol FB FB2-2* FB4-2* FB5-1* FB B300-III** B B angiver at en af parametrene mangler * der er her 12 måneder mellem målingen af de chlorerede forbindelser og H 2 Energigevinsterne ligger lidt spredt for de enkelte dehalogeneringstrin og antyder at der ikke er en markant termodynamisk styring af nedbrydningen, som den man ofte ser det for sulfat reduktion og methandanelse i mange naturlige systemer. Sammenligner man med søsterlokaliteten Sortebrovej er der langt lavere energigevinster for processerne, bortset fra B300 hvor der er målt et højere H 2 niveau og højere koncentrationer af de chlorerede ethener. I de tilfælde hvor der foreligger målinger af reaktanter og produkter er energigevinsten for de naturlige redox processer på lokaliteten beregnet, værdierne er gengivet i tabel H2.3. Tabel H2.3.: Beregnede Gibbs energier forrelevante naturlige elektron accepterende processer for prøver fra Middelfartsvej. Energierne for Mn- og Fe-oxid reduktion kan kun bruges relativt da det ikke vides hvilke mineralfaser der reelt reduceres. Nitrat red. Mn-oxid red. Fe-oxid red. Sulfatred Methandan. kj/mol kj/mol kj/mol kj/mol kj/mol FB FB FB FB FB B300-II* B B * H2 målingen stammer fra det overliggende filter III Gibbs energierne for Mn- og Fe-oxid reduktion kan ikke bruges absolut, men viser dog at forudsat er de samme mineraler findes alle steder så er der markante forskelle i prøverne imellem, og potentialet for Fe-oxid reduktion ser ud til at være størst i FB100-1, B301 og B302, men dette skyldes for boring B301 og B302 de meget lave Fe 2+ koncentrationer. Der foregår derfor nok kun meget begrænset jern-reduktion i disse områder. Der er

61 Miljø & Ressourcer DTU Januar 2004 derfor nok snarere tale om, at forholdene er mere oxiderede omkring disse boringer, hvad indholdet af nitrat i B302 også peger på. Gibbs energierne for sulfatreduktion ligger i FB100-1 på en værdi der godt kunne være den tærskelværdi der er nødvendig for sulfatreduktionen. Det antyder, at sulfatreduktion havde betydning her. For FB2-2, FB5-1 og B300-II er der ikke angivet en værdi, fordi sulfid koncentrationen var under detektionsgrænsen, men det er sandsynligt, at der også her sker sulfatreduktion. De beregnede Gibbsenergier for methandannelse tyder på, at energigevinsten ved methandannelse er for lille, bortset fra i B300 hvor H 2 koncentration måske er forhøjet. Der er imidlertid målt methan, alle de steder, hvor der er beregnet en værdi, og den mest nærliggende forklaring er, at der lokalt findes mere reducerede forhold og højere H 2 niveauer som gør methandannelse mulig. Referencer Yang Y., McCarty P.L. (1998) Competition for Hydrogen within a Chlorinated Solvent Dehalogenating Anaerobic Mixed Culture. Environ. Sci. Technol, 30, Mazur C.S. and Jones W.J. (2001) Hydrogen Concentrations in Sulfate-Reducing Estuarine Sediments during PCE Dehalogenation. Environ. Sci. Technol, 35,

62 Bilag 6

63 Miljø & Ressourcer DTU Januar 2004 Dette notat er en afrapportering af tælling af bakterier ved epifluorescensmetoden (AODC) på 5 grundvandssedimenter fra Middelfartvej Materialer og metoder Der er udtaget 5 kerner i maj 2003 på Middelfartvej. Prøverne er i laboratoriet håndteret anaerobt i en anaerob box, og der er udtaget en delprøve til bakterietælling som er konserveret med formalin. De fem prøver svarer til de 5 sedimenter, der parallelt indgår i det udførte treatability studie, således at resultaterne direkte kan sammenholdes med disse. Prøvetagningssteder er angivet i tabel 1. Bakterietælling med AODC metoden giver et mål for indholdet af bakterier (levende og døde) pr. g sediment. Princip for analysen er følgende: Prøven filtreres på et carbonfilter således bakterier tilbageholdes på filteret. Filteret farves med flourochromet acredinorange et farvestof der farver cellers DNA og RNA. Både levende og døde celler farves. Der tilsættes tween-80 for at nedsætte overfladespændingen og derved forbedre fasthæftelsen på filteret. Efter farvning tilsættes Dapco for at forlænge flourescensen. Filteret mikroskopieres på UVmikroskop, hvor acredinorange danner flourescens. Bakterier i vækst har et højere RNA-indhold end DNA og flourescerer mest orange. Bakterier der ikke er i vækst med dominerende DNA-indhold viser grønlig flourescens. Bakterierne tælles ved hjælp af tællenet og hvert filter tælles forskellige steder og testes for den indbyrdes spredning for at sikre at materialet er jævnt fordelt Resultater Resultaterne for bakterietællingen er angivet i tabel 1. Antallet af bakterier varierer mellem 0, , celler/g tørvægt, hvilket er i det øvre interval for uforurenede grundvandssedimenter (Kjeldsen et al., 1996). Ludvigsen et al. (1999) måler tilsvarende bakterieantal med samme metode i lossepladsforurenet grundvandsmiljø ved Grindsted losseplads. Der er ikke nogen umiddelbar sammenhæng mellem sedimenttype/forureningsniveau og antallet af bakterier. Referencer Kjeldsen,P. & Christensen,T.H.(eds.) (1996): Kemiske stoffers opførsel i jord og grundvand. Vol (Behaviour of pollutants in soil and groundwater, in Danish). Miljøstyrelsen, København. Projekt om jord og grundvand fra Miljøstyrelsen, 20. pp Ludvigsen,L., Albrechtsen,H.-J., Ringelberg,D., Ekelund,F. & Christensen,T.H. (1999): Distribution and composition of microbial populations in a landfill leachate contaminated aquifer (Grindsted, Denmark). Microbial Ecology, 37, (3),

64 Miljø & Ressourcer DTU Januar 2004 Tabel 1: Prøvetagningssteder, geologi, og antal bakterier bestemt ved AODC-metoden på sedimenter fra Middelfartvej. Placering Opstrøms Kilde Kilde Fane Fane Boring Nummer B303 B300-III B300-II B301A B302 Dybde (m.u.t.) m.u.t. 12,0-12,5 7,5-8,0 9,5-10,0 8,8-9, ,5 Geologisk beskrivelse Baseret på boreprofiler fra NIRAS Sand, fint mellem, grå Moræneler, sandet, stenet, gråt Sand, Fint/mellem, lerklumper, enk. sten, gråt Sand, Fint/mellem, gråt Grus, fint, sand, svagt leret, brun* Bakterieantal Døde og levende celler pr. g tørvægt 1, , , , , * Der er ikke angivet specifik farve for prøven i NIRAS s beskrivelse, men prøverne over og under er angivet som rødbrune og brune. 2

65 Bilag 7

66 Molekylærbiologisk detektion af bakterier involveret i nedbrydning af PCE/TCE i sedimentprøver fra Middelfartvej. Indledning: Detektion af bakterier tilhørende slægten Dehalococcoides sp. Det er generelt meget vanskeligt at dyrke bakterier tilhørende slægten Dehalococcoides sp. Derimod er det muligt at detektere bestemte stykker af DNA, der findes i Dehalococcoides sp., men det har hidtil ikke været muligt at kvantificere antallet af DNAstykker eller omregne dette til antal celler. Dette projekt har haft til formål at udvikle en metode til at kvantificere DNA et fra Dehalococcoides sp. i sediment, samt undersøge om det er muligt at kvantificere DNAét i sediment fra Middelfartvej. Detektion af bakterier ved hjælp af kendskab til konserverede 16SrDNA molekyler Alle bakterier bærer genetisk information som DNA og bakteriers genomer varierer generelt meget, da der hele tiden sker mutationer herunder indbygning af fremmed DNA, som organismerne skal bruge til forskellige processer. F.eks. findes en række gener for nedbrydning af fremmedstoffer på mobile genetiske elementer, der kan spredes mellem organismer. Der kan være en betydelig variation mellem funktionelle gener, der koder for den samme nedbrydnings proces, f.eks. findes der flere forskellige typer af enzymer, der kan nedbryde fremmedstoffet 2,4-D, og med de forskellige enzymer findes der også forskellige DNA sekvenser. Arbejde med fremskaffelse af gensekvenser for enzymer, der nedbryder fremmedstoffer, er endnu meget forskningstungt og i den internationale litteratur har der i gennem de seneste år ikke været arbejdet meget med sekventering af de gener, der er vist at være ansvarlige for PCE nedbrydning. Derimod har det været vist, at under nogle bestemt redoxforhold er nedbrydningen af PCE oftest knyttet til tilstedeværelse af bakterier, der tilhøre slægten Dehalococcoides sp. Man anvender altså en slags indirekte approach, hvor man i stedet for at detektere nedbrydningsgenerne detektere den gruppe af organismer, der almindeligvis menes at være dækkende for nedbrydning af PCE. Dehalococcoides sp. er beslægtede, hvis de bærer nogle særlige gensekvenser i det DNA der koder for bakteriernes ribosomer. Det er vist, at især 16SrDNA er velegnet til at sortere bakterier i familier (bl.a. Thirup et al. 2000). I artiklen Hendrikson (2002) er der nævnt 5 forskellige primersæt, som alle angives at være gode for detektion af Dehalococcoides sp. i naturlige prøver. I en senere artikel anvender Cupples et al et andet primersæt, men de anvender alene PCR i en renkultur af en Dehalococcoides lignende mikroorganisme.

67 Test af egnet primersæt Baseret på Hendrickson et al blev der gennemført en test af de forskellige primersæt: Testen blev udover den positive kontrol udført på jorde, dels sediment fra Middelfartvej, dels en landbrugsjord, der ikke forventes at have en mikrobiel sammensætning, der vil omfatte Dehalococcoides sp. Alle numre i det følgende refererer til primernes baseplacering i genet. Ikke alle primersæt fungerer lige godt. Det viste sig at sættene: 1-692; samt i ingen tilfælde gav signal med prøverne fra Middelfartvej. Primersættene og var placeret for langt fra hinanden og gav derfor ikke reproducerbart signal, selv ikke med den positive kontrol. Primersættet gav signal med alle jorde fra Middelfartvej. Dette primersæt var derfor umiddelbart det primersæt, der virkede bedst, men desværre viste to test vi yderligere lavede, at primersættet var uegnet. Den første test var en kørsel med primersættet på DNA ekstraheret fra en landbrugsjord, og denne test gav et positivt signal. Det er usandsynligt, at signalet kunne hidrører fra en Dehalococcoides sp. og vi igangsatte derfor en partiel sekventering af flere af de bånd, der fremkom også fra prøver fra Middelbrovej. Det viste sig, at de bånd der fremkom, hidrørte fra andre organismer end Dehalloccoides sp., hvorfor vi på grund af en for lav specificitet måtte opgive at arbejde med dette primersæt. Primersættet blev også testet grundigt. Primersættet viste sig at være det bedste valg, da det dels gav signal med DNA ekstraheret fra prøver på Middelfartvej og ikke viste signal med landbrugsjorden. Vi har tilfældigt udvalgt tre fragmenter, som vi har sekventeret med godt signal.

68 1212 CTAATCGAGG TCAAGTGTGA CAACGTTGGA TAACAAGACA GGTAACATCG CACACACATC GGGTTCTATA TTTCCGGTAC GACTGAACTG CAGTAGGGGT GGAAGGAGGG TATA TTTCCGGTAC GACTGAACTG CAGTAGGGGT GGAAGGAGGG GCAAAGCGCC CCGTCAGAGC GATCTTTTAA ATTGATCGTT GTTCCAACGC GAGCAACGTC GCAAAGCGCC CCGTCAGAGC GATCTTTTAA ATTGATCGTT GTTCCCAACGCGAGCAACGTC CTGAATTGGG TTGTGGAGTG CCGTGCTCGA CTGCTGTCGG TACGTCGTGG ACACGTTTGA CTGAATTGGT TTGTGGAGTG CCGTGCTCGA CTGCTGTCGG TACGTCGTGG ACACGTTTGA GGACTGAATT GTCCAGCAAA GGGAAAGCCA AGTGATGAAG TACGTACAGT TTAGAACCAT GGACTGAATT GTCCAGCAAA GGGAAAGCCA AGTGATGAAG TACGTACAGT TTAGAACCAT TCAAGAAGCA CATCGTAGCT TAATTTGGTG TGCGAGGCGA CGAACACGCC CGGGGGCAGT TCCAAGAAGCACATCGTAGCT TAATTTGGTG TGCGAGGCGA CGAACACGCC CGGGGGCAGT TAAGGAAACT CAAAATCGGA ACGCTGGCAT GAGGGGTCCG CCCTGTGAAT TTCGCAATCG TAAGGAAACT CAAAATCGGA ACGCTGGCAT GAGGGGTCCG CCCTGTGAAT TTCGCAATCG AAGCCGTGTC TCTCCCAGCTATGA GGG 774 AAGCCGTGTC TCTCCCAGCTATGA Figur 1 Sekvens af amplificeret DNA fra søsterprojektet på Sortebrovej prøve B308, de blå bogstaver (nederste række) er DNA baser fundet i jordprøven, mens de sorte bogstaver er den kendte sekvens. De to fejl der ses, kan også findes ved tilfældige opståede fejl under sekventeringen. På baggrund af disse resultater har vi valgt at gå videre med primersættet for amplificering af Dehalococcoides sp. DNA fra Middelfartvej. Bestemmelse af detektionsniveau med primersættet Ved hjælp af den positive kontrol, DNA fragment modtaget fra Dr. S.H. Zinder, (Cornell University), gennemførte vi en analyse af følsomheden af vores assay. Vi fandt, at vi kunne finde signal fra det DNA der svarer til 700 celler pr. gram jord (under antagelsen af der kun findes én kopi af DNA et i hver celle hvilket er en normal antagelse).

69 Figur 2 Detektions grænse for PCR på fragmentet med anvendelse af primersættet Bestemmelsen af detektionsgrænsen er i første forsøg udført med en grovere inddeling og den viste gel er en mere præcis bestemmelse. Banerne 1, 12 og 15 er kontrol DNA, Bane 2: 12,5 DNA-kopier, bane 3 tom; bane 4: 10 DNAkopier; bane 5: 9 DNA-kopier; bane 6: 8,2 DNA-kopier; bane 7: 7,7 DNA-kopier; bane 8: 7,2 DNA-kopier; bane 9: 7,1 DNA-kopier; bane 10: 6,6 DNA kopier; bane 11: 6,2 DNA-kopier. Banerne 13 og 14 indeholder jord DNA fra boring 302. Bane 16 indeholder den interne standard (se nedenfor).

70 Udvikling af competitiv PCR til kvantificering af DNA Den competitive PCR blev udviklet til primersættet Ved udviklingen af competitiv PCR skal der bruges et stykke DNA, der er kortere, end det DNA man ønsker at genfinde. Det korte stykke DNA skal starte og begynde med samme sekvens, sådan at det amplificeres med samme primersæt som selve DNA stykket Figur 3. Eksempel på competitiv PCR. Den øvre række bånd er prøve DNA der er tilsat i konstant mængde. Den nedre (eller mellemste) række er intern standard DNA. Nederst ses en mere diffus række bånd, der er primer-dimer (en artifakt der opstår bl.a. med dette primersæt). Bane 1 og 9: størrelsesmarkør DNA. Bane 8: prøve DNA alene; bane 7: intern standard; bane 6: negativ kontrol; bane 2: 4 dele prøve og 1 del standard; bane 3: 2 dele prøve og 3 dele standard; bane 4: 2 dele prøve og 3 dele standard; bane 5 1 del prøve og 4 dele standard. Ved hjælp af kendskab til den tilsatte mængde kontrol DNA kan koncentrationen af prøve DNA beregnes ved hjælp af billedbehandling og non-linear regression. Cupples et al. (2003) har anvendt competitiv PCR til tælling af én bestemt Dehalococcoides lignede bakterie i vækstforsøg i laboratoriekulturer med vækst på vinylklorid og cis-dichlorethen. De har anvendt et andet primersæt, men de har ikke haft behov for at kunne differentiere mellem denne stamme og andre stammer. Vi har gennemført en BLAST søgning (Altschul et al 1997) på deres foreslåede sekvenser og finder disse sekvenser i lighed med de af Hendrickson et al (2002) at være overvejende specifikke for Dehalococcoides sp, men vi har som tidligere omtalt fundet andet DNA i jorden end det, der ligger publicerede sekvenser for i internationale databaser.

71 Resultater for undersøgelse af jord prøver fra Middelfartvej Vi har gennemført undersøgelser af DNA ekstraheret fra prøverne B301A, B300III, B 300 II B 302 samt B303. Ved screeningen for anvendelsen af primersættene brugte vi duplikate prøver fra jordene B 300II, B302 og B Figur 4. Screening for signal med primersæt Bane 1 og 11: størrelsesmarkør. Bane 2 og 3: replikate prøver fra B300II; bane 4 og 5 replikate prøver fra B302; bane 6 og 7: replikate prøver fra B303; bane 8 og 9: negativ kontrol, bane 10: tom. Der blev gennemført PCR kørsler med primersættet (figur 4), som gav et pænt reproducerbart signal med prøverne. Desværre viste det sig som omtalt ovenfor, at en efterfølgende sekvensanalyse viste, at dette primersæt fandt andet DNA, end det der kommer fra Dehalococcoides sp.

72 Figur 5 Screening for signal med primersæt Annealing temperatur 55C Bane 1: størrelsesmarkør. Bane 2 og 3: replikate prøver fra B300II; bane 4 og 5 replikate prøver fra B302; bane 6 og 7: replikate prøver fra B303; bane 8 og 9: negativ kontrol. Der blev gennemført en række undersøgelser med primersættet og et eksempel på disse kørsler er vist i figur 5. Det ses først og fremmest, at der er tale om meget svage signaler. Dernæst ses det, at der er problemer med reproducerbarheden mellem de to replikate prøver, sammenlign signal i bane 4 og 5. Ved sekventering af bånd, der kommer fra prøver fra Middelfart vej blev det eftervist, at DNA-sekvensen svarer til Dehalococcoides sp.. Imidlertid var det bedst opnåelige signal med dette primersæt fra jordene på detektionsgrænsen for den competitive PCR assay. Vi har ikke kunnet gennemføre kvantitative analyser af jordprøverne på grund af det lave antal Dehalococcoides sp gensekvenser der er tilstede i jorden. Realtime PCR på prøver fra Middelfartvej GEUS modtog i sommeren 2003 en bevilling fra Statens Naturvidenskabelige Forskningsråd, der muliggjorde indkøb af en avanceret PCR maskine, der er istand til at måle det dannede PCR produkt online. Hovedparten af aktiviteterne om Realtime PCR, er ikke finansieret af bevillingen fra Fyns Amt, men alligevel lavet med primersæt og prøver relevante for undersøgelser af Dehalococcoides sp. Ved at måle på dannelsen af PCR produkt online kan man udføre kvantitative analyser på samme niveau som ved den tidligere omtalte competitive PCR. Fordelen ved det nye system er at udviklingsomkostningerne til fremstilling af intern standard ikke er til stede, samt at man kan køre langt flere prøver af gangen med følgende lavere omkostninger. Ved den competitive PCR er vi typisk nødt til at køre 3 gang 10 PCR reaktioner per prøve for at fastslå koncentrationen i en

73 jordprøve, med det nye system kan vi bestemme mindst 15 jordprøver i en kørsel med 96 brønde. Figur 6 Eksempel på REAL time PCR med anvendelse af primersættet på en fortyndningsrække af rent DNA fra Dehalococcoides sp. Vi har gennemført analyser af jordprøverne fra Middelfartvej Real Time PCR. I figur 7 vises resultaterne fra B301A. Ved hjælp af en enkelt kørsel i Real Time PCR kan vi altså vise, at der Dehalococcoides sp. DNA, der findes i prøven findes i lave niveauer. Ved hjælp af en klassisk gelkørsel efterfølgende kan vi se, at DNA et har den rigtige størrelse, og det er også muligt at foretage en sekventering af fragmenterne, og at sikre sig, at vi stadig detektere det rigtige DNA i prøven.

74 Figur 7 REAL TIME PCR med prøve DNA fra boring B301A. Der er kørt duplikate PCR analyser af DNA ekstraheret fra to forskellige klumper jord fra samme prøve. Øverste panel: De fire farvede kurver passere den angivne kvantificerings line mellem 33. og 34. cykel. Dette er svarende til et meget lavt niveau af celler. Nederste panel: En efterfølgende smeltekurve analyse af det dannede DNA viser at alt det dannede produkt først smelter ved temperature over 85 o C Dette viser, at alle de fire reaktioner danner et produkt af flere hundrede basepar (kan også verificeres med en gammeldags gel).

75 Kvantificerings metoden ved hjælp af Real Time PCR er følsom på samme niveau som den competitive PCR, og i figur 8 viser vi hvordan resultaterne kan blive problematiske, hvis der er endnu lavere antal DNA kopier i prøven. Figur 8. REAL TIME PCR på jord DNA fra boringen B303 (baggrundslokalitet). Der er kørt duplikate PCR kørsler på dublikate jordprøver. Øverste panel: De fire kurver passerer den angivne kvantificerings på forskellige tidspunkter. Nederste panel: Den blå kurve har alene smeltetemperatur over 85 C, men den lyserøde kurve har smeltetemperatur mellem 72 og 80 C. De to øvrige har to toppe.

på 3 danske lokaliteter

på 3 danske lokaliteter Stimuleret nedbrydning af 1,1,1-TCA i moræneler på 3 danske lokaliteter Mette M. Broholm 1, Charlotte Scheutz 1, Poul L. Bjerg 1, Henriette Kerrn-Jespersen 2 og Carsten Bagge Jensen 2 1 DTU Miljø, 2 Region

Læs mere

Statusnotat April 2010

Statusnotat April 2010 Nedbrydning af,,-t ved stimuleret reduktiv dechlorering Treatability-forsøg for lokaliteterne Baldersbækvej, Høje Taastrup Vej og Vasbyvej. Statusnotat April Mette M. Broholm og Charlotte Scheutz DTU Miljø

Læs mere

Indledning og formål

Indledning og formål Anvendelse af isotopfraktionering til vurdering af nedbrydning af chlorerede opløsningsmidler og andre organiske stoffer Mette M. Broholm og Poul L. Bjerg 1 Indledning og formål Isotopfraktionering er

Læs mere

Hvorfor biologisk metode til DNAPL afværge?

Hvorfor biologisk metode til DNAPL afværge? Temadag om fri fase forurening. 5. marts 2012 Succesfuldt pilotforsøg med oprensning af residual fri fase PCE ved hjælp af stimuleret reduktiv deklorering i Kærgård Plantage Civilingeniør Torben Højbjerg

Læs mere

Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering og kemisk oxidation ved oprensning af grundvandsforurening

Undersøgelser til vurdering af stimuleret in-situ reduktiv deklorering og kemisk oxidation ved oprensning af grundvandsforurening Undersøgelser til vurdering af stimuleret insitu reduktiv deklorering og kemisk oxidation ved oprensning af grundvandsforurening Forurenet lokalitet nr. 48520 Tidligere maskinfabrik Sortebrovej 26, 5690

Læs mere

Nedbrydning af 1,1,1-TCA ved stimuleret reduktiv dechlorering

Nedbrydning af 1,1,1-TCA ved stimuleret reduktiv dechlorering Nedbrydning af 1,1,1-TCA ved stimuleret reduktiv dechlorering Treatability-forsøg for lokaliteterne: Baldersbækvej, Høje Taastrup Vej og Vasbyvej Mette M. Broholm, Charlotte Scheutz og Poul L. Bjerg DTU

Læs mere

Erfaringsopsamling på udbredelsen af forureningsfaner i grundvand på villatanksager

Erfaringsopsamling på udbredelsen af forureningsfaner i grundvand på villatanksager Erfaringsopsamling på udbredelsen af forureningsfaner i grundvand på villatanksager Udført for: Miljøstyrelsen & Oliebranchens Miljøpulje Udført af: Poul Larsen, Per Loll Claus Larsen og Maria Grøn fra

Læs mere

VURDERING AF NATURLIG NEDBRYDNING AF PCE I GRUNDVANDSMAGASIN VED ISOTOPFRAKTIONERING

VURDERING AF NATURLIG NEDBRYDNING AF PCE I GRUNDVANDSMAGASIN VED ISOTOPFRAKTIONERING VURDERING AF NATURLIG NEDBRYDNING AF PCE I GRUNDVANDSMAGASIN VED ISOTOPFRAKTIONERING Lektor Mette M. Broholm Institut for Miljø & Ressourcer, DTU/Orbicon A/S Associate Professor Daniel Hunkeler Ph.d.studerende

Læs mere

Redoxforhold mættet zone

Redoxforhold mættet zone Redoxforhold mættet zone Definition af redoxforhold mættet zone Redoxforhold er en samlet betegnelse for en række parametre der beskriver hvilke redoxprocesser der er dominerende i den pågældende mættede

Læs mere

Primære re aktiviteter i REMTEC

Primære re aktiviteter i REMTEC Primære re aktiviteter i REMTEC Valg af lokalitet Forureningskarakterinsering Injektion af elektrondonor og bakterier Effekt af oprensning i gundvand and matrix Forureningskarakterisering Formål: Detaljeret

Læs mere

IN SITU BIOLOGISK OPRENSNING AF GRUNDVANDSFORURENINGEN

IN SITU BIOLOGISK OPRENSNING AF GRUNDVANDSFORURENINGEN KRAFTIG FORURENING MED ATYPISKE FORURENINGSSTOFFER PÅ STOR INDUSTRILOKALITET IN SITU BIOLOGISK OPRENSNING AF GRUNDVANDSFORURENINGEN Ekspertisechef Charlotte Riis, NIRAS Projektleder Lisbeth Walsted, Seniorspecialist

Læs mere

Oprensning af klorerede opløsningsmidler i moræneler med stimuleret reduktiv deklorering

Oprensning af klorerede opløsningsmidler i moræneler med stimuleret reduktiv deklorering Lok. nr. 461-169, Rugårdsvej 234-238, 5210 Odense NV Oprensning af klorerede opløsningsmidler i moræneler med stimuleret reduktiv deklorering Pilotforsøg - Hovedrapport 2007, november Oprensning af klorerede

Læs mere

ATV JORD OG GRUNDVAND VINTERMØDE OM JORD- OG GRUNDVANDSFORURENING

ATV JORD OG GRUNDVAND VINTERMØDE OM JORD- OG GRUNDVANDSFORURENING ERFARINGER MED ETABLERING OG DRIFT AF FULD SKALA AFVÆRGE VED STIMULERET REDUKTIV DEKLORERING I MORÆNELER. DIRECT PUSH INJEKTION AF DONOR OG BIOMASSE PÅ VESTERBROGADE OG GL. KONGEVEJ, KØBENHAVN Civilingeniør

Læs mere

Reduktiv dechlorering som afværgemetode

Reduktiv dechlorering som afværgemetode Reduktiv dechlorering som afværgemetode Kirsten Rügge, COWI 1 Reduktiv dechlorering Biologisk: Naturlig nedbrydning (MNA) Stimuleret reduktiv dechlorering (ERD) EK-BIO 2 Stimuleret Reduktiv dechlorering,

Læs mere

Der er på figur 6-17 optegnet et profilsnit i indvindingsoplandet til Dejret Vandværk. 76 Redegørelse for indvindingsoplande uden for OSD Syddjurs

Der er på figur 6-17 optegnet et profilsnit i indvindingsoplandet til Dejret Vandværk. 76 Redegørelse for indvindingsoplande uden for OSD Syddjurs Sammenfattende beskrivelse ved Dejret Vandværk Dejret Vandværk har 2 aktive indvindingsboringer, DGU-nr. 90.130 og DGU-nr. 90.142, der begge indvinder fra KS1 i 20-26 meters dybde. Magasinet er frit og

Læs mere

Low Level MIP/MiHPT. Et nyt dynamisk værktøj til kortlægning af forureningsfaner

Low Level MIP/MiHPT. Et nyt dynamisk værktøj til kortlægning af forureningsfaner Low Level MIP/MiHPT Et nyt dynamisk værktøj til kortlægning af forureningsfaner Malene Tørnqvist Front, NIRAS ATV Vintermøde Workshop om dynamiske undersøgelser 10. marts 2015 KORTLÆGNING AF FORURENINGSFANER

Læs mere

ELEKTROKINETISK STIMULERET BIOLOGISK NEDBRYDNING AF FRI FASE PCE

ELEKTROKINETISK STIMULERET BIOLOGISK NEDBRYDNING AF FRI FASE PCE PILOTFORSØG MED ELEKTROKINETISK STIMULERET BIOLOGISK NEDBRYDNING AF FRI FASE PCE 2012 Charlotte Riis, NIRAS ATV møde, 28. november TEAM EK BIO NIRAS A/S Charlotte Riis Martin Bymose Geosyntec Consultants,

Læs mere

Nationalt netværk af testgrunde

Nationalt netværk af testgrunde Til udvikling og demonstration af undersøgelses- og oprensningsmetoder på jord- og grundvandsområdet Nationalt netværk af testgrunde Danish Soil Partnership INTRO Én indgang Nationalt netværk af testgrunde

Læs mere

Sammenfatning af undersøgelserne på Grindsted Gl. Losseplads. Peter Kjeldsen og Poul L. Bjerg

Sammenfatning af undersøgelserne på Grindsted Gl. Losseplads. Peter Kjeldsen og Poul L. Bjerg Sammenfatning af undersøgelserne på Grindsted Gl. Losseplads Peter Kjeldsen og Poul L. Bjerg Baggrund Mange forureningskilder i Grindsted by der potentielt kan true drikkevandskvaliteten og Grindsted Å

Læs mere

VENTILERING I UMÆTTET ZONE

VENTILERING I UMÆTTET ZONE VENTILERING I UMÆTTET ZONE Fagchef, civilingeniør Anders G. Christensen Civilingeniør Nanna Muchitsch Divisionsdirektør, hydrogeolog Tom Heron NIRAS A/S ATV Jord og Grundvand Afværgeteknologier State of

Læs mere

Rårup Vandværk er beliggende i Rårup by, mens de to indvindingsboringer er beliggende i det åbne land nord for byen.

Rårup Vandværk er beliggende i Rårup by, mens de to indvindingsboringer er beliggende i det åbne land nord for byen. er beliggende i Rårup by, mens de to indvindingsboringer er beliggende i det åbne land nord for byen. Vandværket har en indvindingstilladelse på 77.000 m 3 og indvandt i 2013 58.000 m 3. Indvindingen har

Læs mere

Naturlig og stimuleret nedbrydning af 1,1,1-TCA. Charlotte Scheutz, Maria H. Hansen & Poul L. Bjerg

Naturlig og stimuleret nedbrydning af 1,1,1-TCA. Charlotte Scheutz, Maria H. Hansen & Poul L. Bjerg Naturlig og stimuleret nedbrydning af 1,1,1-TCA Charlotte Scheutz, Maria H. Hansen & Poul L. Bjerg Naturlig og stimuleret nedbrydning af 1,1,1-TCA Forfattere: Charlotte Scheutz, Maria Heisterberg Hansen

Læs mere

HVORDAN VÆLGES DEN OPTIMALE METODE TIL KILDEFJERNELSE?

HVORDAN VÆLGES DEN OPTIMALE METODE TIL KILDEFJERNELSE? HVORDAN VÆLGES DEN OPTIMALE METODE TIL KILDEFJERNELSE? Fagleder, civilingeniør Torben Højbjerg Jørgensen COWI A/S ATV MØDE VALG AF AFVÆRGEMETODER HVORDAN FINDES DEN TEKNISK, ØKONOMISK OG MILJØMÆSSIGT MEST

Læs mere

Oprensning af olie- og benzinforurening: Naturlig nedbrydning og biologisk afværge

Oprensning af olie- og benzinforurening: Naturlig nedbrydning og biologisk afværge Oprensning af olie- og benzinforurening: Naturlig nedbrydning og biologisk afværge Per Loll - DMR A/S ATV, Afværgeteknologier - State of the Art, 22. oktober 2008 Dias nr. 1 Indledning Oplægget lød på,

Læs mere

Regionernes hovedpine - undersøgelse og afværge i moræneler. Henriette Kerrn-Jespersen

Regionernes hovedpine - undersøgelse og afværge i moræneler. Henriette Kerrn-Jespersen Regionernes hovedpine - undersøgelse og afværge i moræneler Henriette Kerrn-Jespersen Disposition 1. Hvorfor beskæftiger vi os med moræneler? 2. Udfordringer for ca. 5 år siden! - ift undersøgelser og

Læs mere

Rekvirent. Silkeborg Kommune Teknik- og Miljøafdelingen att. Åge Ebbesen Søvej Silkeborg. Telefon

Rekvirent. Silkeborg Kommune Teknik- og Miljøafdelingen att. Åge Ebbesen Søvej Silkeborg. Telefon SILKEBORG KOMMUNE 2011 NOTAT NR. 2011-4 SCREENING AF SEDIMENTET I TANGE SØ NEDSTRØMS INDLØBET AF GUDENÅEN FOR INDHOLD AF TUNGMETALLER OG MILJØ- FREMMEDE STOFFER. Rekvirent Silkeborg Kommune Teknik- og

Læs mere

Oprensning i moræneler Hvad kan vi i dag?

Oprensning i moræneler Hvad kan vi i dag? Oprensning i moræneler Hvad kan vi i dag? Kirsten Rügge, COWI 1 VJ s digitale screeningsværktøj Umættet zone Fysiske forhold for forureningen Afværge overfor: Grundvand Geologi: Ler/silt Mættet/Umættet:

Læs mere

Hvis du vil teste en idé

Hvis du vil teste en idé KONTAKT Til udvikling og demonstration af undersøgelses- og oprensningsmetoder på jord- og grundvandsområdet Hvis du vil teste en idé - så hjælper Danish Soil Partnership dig videre i processen... Nationalt

Læs mere

Pesticidsager: Undersøgelser- Risikoafklaring- Perspektiver for afværge ved stimuleret biologisk nedbrydning

Pesticidsager: Undersøgelser- Risikoafklaring- Perspektiver for afværge ved stimuleret biologisk nedbrydning Pesticidsager: Undersøgelser- Risikoafklaring- Perspektiver for afværge ved stimuleret biologisk nedbrydning Vintermøde 2017, civilingeniør, ph.d. Katerina Tsitonaki kats@orbicon.dk Og mange andre fra

Læs mere

3.5 Private vandværker i Århus Kommune

3.5 Private vandværker i Århus Kommune 3.5 Private vandværker i Århus Kommune Kvottrup Vandværk (751.2.24) Vandværket har en indvindingstilladelse på 6. m 3 /år. Tilladelsen er gebyrnedsat fra oprindelig 18. m 3 / år den 16. februar 2. Vandværkets

Læs mere

6.3 Redox- og nitratforhold

6.3 Redox- og nitratforhold Prøvetagningsstrategien i ellogboringerne er udformet ud fra behovet for at kende redoxfrontens beliggenhed. I den oxiderede zone udtages der prøver med ca. m afstand, nær redoxfronten kan prøverne ligge

Læs mere

Oprensning af klorerede opløsningsmidler ved stimuleret reduktiv deklorering

Oprensning af klorerede opløsningsmidler ved stimuleret reduktiv deklorering Miljøprojekt Nr. 833 2003 Teknologiudviklingsprogrammet for jord- og grundvandsforurening. Oprensning af klorerede opløsningsmidler ved stimuleret reduktiv deklorering Jægersborg Allé, Gentofte Christian

Læs mere

Titel: Anaerob deklorering og oprensning af lavpermeable aflejringer Forfattere: Poul L. Bjerg, Maria H. Hansen, Camilla Christiansen, Charlotte

Titel: Anaerob deklorering og oprensning af lavpermeable aflejringer Forfattere: Poul L. Bjerg, Maria H. Hansen, Camilla Christiansen, Charlotte Titel: Anaerob deklorering og oprensning af lavpermeable aflejringer Forfattere: Poul L. Bjerg, Maria. ansen, amilla hristiansen, harlotte Scheutz og Mette M. Broholm Udgivelsesår: 2006 Tryk: Vester Kopi,

Læs mere

Carbonatsystemet og geokemi

Carbonatsystemet og geokemi Carbonatsystemet og geokemi Definition af carbonatsystemet og geokemi Carbonatsystemet udgøres af følgende ligevægte: CO 2 (aq) + H 2 O H 2 CO 3 (aq) H 2 CO 3 H + + HCO3 - HCO 3 - H + + CO 3 2- Kuldioxid

Læs mere

Notat UDKAST. 2. august 2005. Ringkjøbing Amt HØFDE 42. Estimering af udsivning til Vesterhavet. 2. august 2005. Indholdsfortegnelse:

Notat UDKAST. 2. august 2005. Ringkjøbing Amt HØFDE 42. Estimering af udsivning til Vesterhavet. 2. august 2005. Indholdsfortegnelse: Notat Rådgivende ingeniører og planlæggere A/S Ringkjøbing Amt HØFDE 42 UDKAST 2. august 2005 NIRAS Banegårdspladsen 6 B DK-7400 Herning Telefon 9626 6226 Fax 9626 6225 E-mail niras@niras.dk CVR-nr. 37295728

Læs mere

OPRENSNING I MORÆNELER - HVAD KAN VI I DAG?

OPRENSNING I MORÆNELER - HVAD KAN VI I DAG? OPRENSNING I MORÆNELER - HVAD KAN VI I DAG? Civilingeniør, kemi, Ph.D Kirsten Rügge, COWI Risikovurdering af forurenede grunde i lavpermeable aflejringer - udfordringer og metoder Møde 18. januar 2012

Læs mere

GrundRisk Screeningsværktøj til grundvandstruende forureninger

GrundRisk Screeningsværktøj til grundvandstruende forureninger GrundRisk Screeningsværktøj til grundvandstruende forureninger DEL 2: RESULTATER AF SCREENING Gitte L. Søndergaard, Luca Locatelli, Louise Rosenberg, Philip J. Binning, Jens Aabling, Poul L. Bjerg ATV

Læs mere

Sammenstilling og vurdering af eksisterende data i Randers N kortlægningsområde

Sammenstilling og vurdering af eksisterende data i Randers N kortlægningsområde Sammenstilling og vurdering af eksisterende data i Randers N kortlægningsområde Udført Arbejde Indsamling af eksisterende viden: Geologi, geofysik, hydrogeologi, vandkemi og vandforsyning 5 indsatsområder

Læs mere

Julie Chambon, Gitte Lemming, Gabriele Manoli, Mette Broholm Philip J. Binning and Poul L. Bjerg DTU Miljø. Mette Christophersen Region Syddanmark

Julie Chambon, Gitte Lemming, Gabriele Manoli, Mette Broholm Philip J. Binning and Poul L. Bjerg DTU Miljø. Mette Christophersen Region Syddanmark Julie Chambon, Gitte Lemming, Gabriele Manoli, Mette Broholm Philip J. Binning and Poul L. Bjerg DTU Miljø Mette Christophersen Region Syddanmark 2 In-Situ Chemical Oxidation (ISCO) Stærk oxidant (e.g.

Læs mere

Kommunen har PLIGT til at meddele påbud til forurener

Kommunen har PLIGT til at meddele påbud til forurener Indledende teknisk vurdering af en jord-forureningssag. skal vi afslutte sagen eller forsætte med påbud? Jævnfør jordforureningsloven: Kommunen har PLIGT til at meddele påbud til forurener 21/05/2013 PRESENTATION

Læs mere

Pilotprojekt med stimuleret in situ reduktiv deklorering - Hovedrapport

Pilotprojekt med stimuleret in situ reduktiv deklorering - Hovedrapport Pilotprojekt med stimuleret in situ reduktiv deklorering - Hovedrapport Torben Højbjerg Jørgensen, Lars Nissen, Laila Nielsen og Peter Alfred Petersen COWI A/S Maria Heisterberg Hansen, Charlotte Scheutz,

Læs mere

Region Sjælland. Juni 2015 RÅSTOFKORTLÆGNING FASE 1- GUNDSØMAGLE KORTLÆGNINGSOMRÅDE

Region Sjælland. Juni 2015 RÅSTOFKORTLÆGNING FASE 1- GUNDSØMAGLE KORTLÆGNINGSOMRÅDE Region Sjælland Juni RÅSTOFKORTLÆGNING FASE - GUNDSØMAGLE KORTLÆGNINGSOMRÅDE PROJEKT Region Sjælland Råstofkortlægning, sand grus og sten, Fase Gundsømagle Projekt nr. Dokument nr. Version Udarbejdet af

Læs mere

Bioaugmentering til oprensning af pesticidpunktkilder

Bioaugmentering til oprensning af pesticidpunktkilder Bioaugmentering til oprensning af pesticidpunktkilder MCPP Anders Johansen, Aarhus Universitet, Institut for Miljøvidenskab. Miljøingeniør Katrine Smith, Miljøstyrelsen. Hydrogeolog Hasse Milter, Region

Læs mere

Konceptuelle modeller

Konceptuelle modeller Konceptuelle modeller Konceptuelle modeller fra indledende undersøgelser til videregående undersøgelser, inddragelse af geologi, hydrogeologi, transportprocesser, forureningsspredning og indeklima. ATV-Vest

Læs mere

DNAPL-udviklingsprojekt på Naverland 26. Henriette Kerrn-Jespersen

DNAPL-udviklingsprojekt på Naverland 26. Henriette Kerrn-Jespersen DNAPL-udviklingsprojekt på Naverland 26 Henriette Kerrn-Jespersen Baggrund for et DNAPL projekt Regionerne identificerer og prioriterer forurenede grunde til yderligere offentlig indsats ift sundhed og

Læs mere

Vurdering af naturlig nedbrydning af PCE i grundvandsmagasin ved isotopfraktionering

Vurdering af naturlig nedbrydning af PCE i grundvandsmagasin ved isotopfraktionering Vurdering af naturlig nedbrydning af PCE i grundvandsmagasin ved isotopfraktionering Mette M. Broholm 1,2, Daniel Hunkeler 3, Yumiko Abe 3, Simon Jeannotat 3, Ramon Aravena 4, Claus Westergaard 2, Carsten

Læs mere

Retardation i mættet zone

Retardation i mættet zone Retardation i mættet zone Definition af retardation Når opløste forureningskomponenter transporteres igennem en jordmatrice vil der ske en sorption til jordens partikler. Resultatet bliver, at stoffronten

Læs mere

Kortlægningen af grundvandsforholdene på Als

Kortlægningen af grundvandsforholdene på Als Kortlægningen af grundvandsforholdene på Als Resultater Peter Erfurt Geolog, By- og Landskabsstyrelsen, 4.5.2010 Hvad vil jeg fortælle? - Om grundvandet på Als med fokus på Nordals De store linjer - Om

Læs mere

UNDERSØGELSE AF FYRINGSOLIES TRANSPORT OG NEDBRYDNING I DEN UMÆTTEDE ZONE

UNDERSØGELSE AF FYRINGSOLIES TRANSPORT OG NEDBRYDNING I DEN UMÆTTEDE ZONE UNDERSØGELSE AF FYRINGSOLIES TRANSPORT OG NEDBRYDNING I DEN UMÆTTEDE ZONE Civilingeniør Anders G. Christensen NIRAS A/S Lektor, civilingeniør, ph.d. Peter Kjeldsen Institut for Miljø & Ressourcer, DTU

Læs mere

6.6 Arsen. I 4 af boringerne, som indvinder grundvand fra de dybere magasiner, er der fundet pesticider under grænseværdien.

6.6 Arsen. I 4 af boringerne, som indvinder grundvand fra de dybere magasiner, er der fundet pesticider under grænseværdien. I af boringerne, som indvinder grundvand fra de dybere magasiner, er der fundet pesticider under grænseværdien. I Kasted ose boringerne K (DGU nr. 9.977) er der fundet Bentazon og echlorprop og K (DGU

Læs mere

Vadsbyvej 16A Historisk perspektiv og feltmetoder. Thomas Hauerberg Larsen

Vadsbyvej 16A Historisk perspektiv og feltmetoder. Thomas Hauerberg Larsen Vadsbyvej 16A Historisk perspektiv og feltmetoder Thomas Hauerberg Larsen Forskellige andre overskrifter jeg kunne have valgt Historien om en succesoprensning hvordan vi fjernede 400 kg klorerede opløsningsmidler

Læs mere

GRØNT TEMA. Fra nedbør til råvand

GRØNT TEMA. Fra nedbør til råvand GRØNT TEMA Fra nedbør til råvand Her findes temaer om grundvand, kildeplads, indsatsplanlægning (grundvandsbeskyttelse), boringer, undersøgelser og oversigt over støtteordninger, landbrugets indsats m.m.

Læs mere

KÆRGÅRD PLANTAGE UNDERSØGELSE AF GRUBE 3-6

KÆRGÅRD PLANTAGE UNDERSØGELSE AF GRUBE 3-6 Region Syddanmark Marts 211 KÆRGÅRD PLANTAGE UNDERSØGELSE AF GRUBE 3-6 INDLEDNING OG BAGGRUND Dette notat beskriver resultaterne af undersøgelser af grube 3-6 i Kærgård Plantage. Undersøgelserne er udført

Læs mere

Fjernelse af grundvandsforurening med mikroorganismer fremtidens løsning på fortidens synder?

Fjernelse af grundvandsforurening med mikroorganismer fremtidens løsning på fortidens synder? Fjernelse af grundvandsforurening med mikroorganismer fremtidens løsning på fortidens synder? Christian Nyrop Albers De Nationale Geologiske Undersøgelser for Danmark og Grønland Klima- Energi- og Bygningsministeriet

Læs mere

Vandforsyningsplan 2013 Randers Kommune

Vandforsyningsplan 2013 Randers Kommune Kommunens vurdering af tilstanden af Verdo s vandværker Vandværk Bunkedal Vandværk Oust Mølle Vandværk Vilstrup Vandværk Østrup Skov Vandværk Beliggenhed Mellem Tjærby og Albæk Ved Oust Møllevej i Randers

Læs mere

As Vandværk og Palsgård Industri

As Vandværk og Palsgård Industri og Palsgård Industri ligger i det åbne land i den østlige del af Overby. Vandværket har 2 indvindingsboringer beliggende tæt ved hinanden, ca. 10 meter fra vandværket, se figur 2. Vandværket har en indvindingstilladelse

Læs mere

Indholdsfortegnelse. Tabel 1: Oversigt over lokaliteter med grundvandssænkning. Lokalitetsnr. Lokalitetsnavn Boring

Indholdsfortegnelse. Tabel 1: Oversigt over lokaliteter med grundvandssænkning. Lokalitetsnr. Lokalitetsnavn Boring Vejdirektoratet Udbygning af Brande Omfartsvej Okkerundersøgelser ved grundvandssænkninger COWI A/S Jens Chr. Skous Vej 9 8000 Århus C Telefon 87 39 66 00 Telefax 87 39 66 60 www.cowi.dk Teknisk Notat

Læs mere

Naturstyrelsens Referencelaboratorium for Kemiske og Mikrobiologiske Miljømålinger NOTAT

Naturstyrelsens Referencelaboratorium for Kemiske og Mikrobiologiske Miljømålinger NOTAT Naturstyrelsens Referencelaboratorium for Kemiske og Mikrobiologiske Miljømålinger NOTAT Til: Følgegruppen for Naturstyrelsens Referencelaboratorium cc: Fra: Maj-Britt Fruekilde Dato: 26. november 2014

Læs mere

Monitering, modellering og miljøvurdering af fuldskala afværge af TCE fourening ved stimuleret reduktiv deklorering

Monitering, modellering og miljøvurdering af fuldskala afværge af TCE fourening ved stimuleret reduktiv deklorering Downloaded from orbit.dtu.dk on: Oct 24, 2017 Monitering, modellering og miljøvurdering af fuldskala afværge af TCE fourening ved stimuleret reduktiv deklorering Westergaard, Claus; Søndergaard, Gitte

Læs mere

Vandværket har en indvindingstilladelse på m 3 og indvandt i 2013 omkring m 3.

Vandværket har en indvindingstilladelse på m 3 og indvandt i 2013 omkring m 3. Vandværket er beliggende i det åbne land. Vandværket har 3 indvindingsboringer, som er beliggende tæt ved hinanden i en mindre skov ca. 100 m fra vandværket. Vandværket har en indvindingstilladelse på

Læs mere

Jord & Affald Journalnr. bedes anført ved besvarelse. J.nr.M 335/ Ref.: BEJ/ Den 9. september 2005

Jord & Affald Journalnr. bedes anført ved besvarelse. J.nr.M 335/ Ref.: BEJ/ Den 9. september 2005 [ ] Jord & Affald Journalnr. bedes anført ved besvarelse. J.nr.M 335/04-0010 Ref.: BEJ/ Den 9. september 2005 Miljøstyrelsens afgørelse om påbud om forureningsundersøgelse på [ ], matr. nr. [ ] De har

Læs mere

GrundRisk beregningseksempel ATV møde om GrundRisk 29. november 2016

GrundRisk beregningseksempel ATV møde om GrundRisk 29. november 2016 GrundRisk beregningseksempel ATV møde om GrundRisk 29. november 2016 Baggrund I får en lynudgave af baggrunden til Temadagen, så spring endelig over til spørgsmålene på side 4! På Rugårdsvej 234-238 i

Læs mere

ROCKWOOL'S DEPONERINGSPLADS TIPPEN, HEDEHUSENE Sammenfatning af monitering 2007 2011 og revurdering af risikoen for grundvandet.

ROCKWOOL'S DEPONERINGSPLADS TIPPEN, HEDEHUSENE Sammenfatning af monitering 2007 2011 og revurdering af risikoen for grundvandet. Rockwool A/S April 2012 ROCKWOOL'S DEPONERINGSPLADS TIPPEN, HEDEHUSENE Sammenfatning af monitering 2007 2011 og revurdering af risikoen for grundvandet PROJEKT Rockwool 's deponeringsplads Tippen, Hedehusene.

Læs mere

Praktisk anvendelse af koblet mættet og umættet strømnings modeller til risikovurdering

Praktisk anvendelse af koblet mættet og umættet strømnings modeller til risikovurdering Praktisk anvendelse af koblet mættet og umættet strømnings modeller til risikovurdering Udarbejdet for : Thomas D. Krom Jacob Skødt Jensen Outline Problemstilling Metode Modelopstilling Risikovurdering

Læs mere

OM Hovedgaden 62-64 V.

OM Hovedgaden 62-64 V. OM Hovedgaden 62-64 V. Hornum Side 1 Oliebranchens Miljøpulje OM Hovedgaden 62-64 V. Hornum OM sag 9600-51-037. Supplerende undersøgelser Maj 2010 (revideret december 2010 og oktober 2011) Udgivelsesdato

Læs mere

GOI I VÆREBRO INDSATSOMRÅDE

GOI I VÆREBRO INDSATSOMRÅDE GOI I VÆREBRO INDSATSOMRÅDE Sektionsleder Anne Steensen Blicher Orbicon A/S Geofysiker Charlotte Beiter Bomme Geolog Kurt Møller Miljøcenter Roskilde ATV MØDE VINTERMØDE OM JORD- OG GRUNDVANDSFORURENING

Læs mere

Nitrat i grundvand og umættet zone

Nitrat i grundvand og umættet zone Nitrat i grundvand og umættet zone Forekomst og nitratreduktion. Cand. Scient Lærke Thorling Side 1 1. februar 2008 Århus Amt Side 2 1. februar 2008 Århus Amt Nitratfrontens beliggenhed på typelokaliteter

Læs mere

Baggrund. Nærværende rapport er rekvireret af Ejendomsmæglerfirmaet Home i Rønne på vegne af ejeren, Kuhre Autodele, Sandemandsvej 8, 3700 Rønne.

Baggrund. Nærværende rapport er rekvireret af Ejendomsmæglerfirmaet Home i Rønne på vegne af ejeren, Kuhre Autodele, Sandemandsvej 8, 3700 Rønne. Baggrund I forbindelse med overvejelse om salg af bygninger på grunden Sandemandsvej 8 i Rønne er der foretaget en undersøgelse af eventuelle forureninger på grunden. Formålet med nærværende rapport er

Læs mere

VÆRKTØJSKASSEN OVERBLIK OG METODEOVERVEJELSER

VÆRKTØJSKASSEN OVERBLIK OG METODEOVERVEJELSER VÆRKTØJSKASSEN OVERBLIK OG METODEOVERVEJELSER Civilingeniør, ph.d. Nina Tuxen, Orbicon Undersøgelser frem for afværge - State of the Art Møde 20. maj 2009 RESUME Indlægget omhandler værktøjskassen til

Læs mere

Hvornår slår effekten af forskellige foranstaltninger igennem i vandmiljøet

Hvornår slår effekten af forskellige foranstaltninger igennem i vandmiljøet Side 1/7 Til: Torben Moth Iversen Fra: Hans Jørgen Henriksen Kopi til: JFR, ALS Fortroligt: Nej Dato: 17. november 2003 GEUS-NOTAT nr.: 06-VA-03-08 J.nr. GEUS: 0130-019 Emne: Hvornår slår effekten af forskellige

Læs mere

Redegørelse for GKO Odsherred. Afgiftsfinansieret grundvandskortlægning 2015

Redegørelse for GKO Odsherred. Afgiftsfinansieret grundvandskortlægning 2015 Redegørelse for GKO Odsherred Afgiftsfinansieret grundvandskortlægning 2015 7.2.7 Sammenfattende beskrivelse ved Bøsserup Vandværk Bøsserup Vandværk indvinder fra 2 boringer, henholdsvis DGU.nr: 191.124

Læs mere

Poul L. Bjerg Gregory Lemaire Ursula McKnight og mange flere. Sandra Roost (Orbicon) Sanne Nielsen (tidl. Orbicon, nu Region Syd)

Poul L. Bjerg Gregory Lemaire Ursula McKnight og mange flere. Sandra Roost (Orbicon) Sanne Nielsen (tidl. Orbicon, nu Region Syd) Kan en model for fortynding i vandløb bidrage til bestemmelse af forureningsflux, kildeopsporing og konceptuel forståelse ved forureningsundersøgelser? Poul L. Bjerg Gregory Lemaire Ursula McKnight og

Læs mere

Mulige feltstudier til vurdering af vandets strømningsveje i relation til nitratreduktion i undergrunden?

Mulige feltstudier til vurdering af vandets strømningsveje i relation til nitratreduktion i undergrunden? Mulige feltstudier til vurdering af vandets strømningsveje i relation til nitratreduktion i undergrunden? Jens Christian Refsgaard, Flemming Larsen og Klaus Hinsby, GEUS Peter Engesgaard, Københavns Universitet

Læs mere

ER VEJSALT EN TRUSSEL MOD GRUNDVANDET?

ER VEJSALT EN TRUSSEL MOD GRUNDVANDET? ER VEJSALT EN TRUSSEL MOD GRUNDVANDET? Seniorforsker Birgitte Hansen, GEUS Lektor Søren Munch Kristiansen, Geologisk Institut, Aarhus Universitet Civilingeningeniør, ph.d. Flemming Damgaard Christensen,

Læs mere

RAPPORT Karakteristik af tangtag nedbrydelighed og kemisk sammensætning

RAPPORT Karakteristik af tangtag nedbrydelighed og kemisk sammensætning RAPPORT Karakteristik af tangtag nedbrydelighed og kemisk sammensætning Forfattere: Lektor Erik Kristensen og Professor Marianne Holmer, Biologisk Institut, Syddansk Universitet, Campusvej 55, 523 Odense

Læs mere

Hjerm Vandværk er beliggende Lindevænget 47b, 7560 Hjerm og har en indvindingstilladelse på m³/år gældende til 14. August 2016.

Hjerm Vandværk er beliggende Lindevænget 47b, 7560 Hjerm og har en indvindingstilladelse på m³/år gældende til 14. August 2016. Hjerm Vandværk Indvindingstilladelse Hjerm Vandværk er beliggende Lindevænget 47b, 7560 Hjerm og har en indvindingstilladelse på 225.000 m³/år gældende til 14. August 2016. Grundvandet ved Hjerm Vandværk

Læs mere

Lake Relief TM. - effekter på trådalger, næringsindhold og dyreliv august 2007

Lake Relief TM. - effekter på trådalger, næringsindhold og dyreliv august 2007 Lake Relief TM - effekter på trådalger, næringsindhold og dyreliv august 2007 Notat udarbejdet af CB Vand & Miljø, august 2007. Konsulent: Carsten Bjørn Indholdsfortegnelse 1. Indledning...3 1.1 Beskrivelse

Læs mere

Undersøgelser ved Selling Vandværk boring 2

Undersøgelser ved Selling Vandværk boring 2 Resultater fra forureningsundersøgelserne omkring boring 2.0 2.0 1.0 0. Dybde i meter 1.0 Udsnit Analyse pesticider og nedbrydningsprodukter i jordprøver*. Anført som µg/kg tørstof. 2.0 Dichlorbenzamid

Læs mere

Erfaringsopsamling på udviklingen i poreluftkoncentrationer på villatanksager

Erfaringsopsamling på udviklingen i poreluftkoncentrationer på villatanksager Erfaringsopsamling på udviklingen i poreluftkoncentrationer på villatanksager Udarbejdet af Dansk Miljørådgivning A/S for Miljøstyrelsen & Oliebranchens Miljøpulje Dias nr. 1 Disposition Baggrund og formål

Læs mere

Orientering fra Naturstyrelsen Aalborg

Orientering fra Naturstyrelsen Aalborg Orientering fra Naturstyrelsen Aalborg Naturstyrelsen har afsluttet grundvandskortlægning i kortlægningsområdet 1435 Aalborg SØ Søren Bagger Landinspektør, Naturstyrelsen Aalborg Tlf.: 72 54 37 21 Mail:sorba@nst.dk

Læs mere

Bjerre Vandværk ligger i den vestlige udkant af Bjerre by.

Bjerre Vandværk ligger i den vestlige udkant af Bjerre by. ligger i den vestlige udkant af Bjerre by. Vandværket har en indvindingstilladelse på 75.000 m 3 og indvandt i 2014 godt 47.000 m 3. I 2006 og 2007 har indvindingen været knap 58.000 m 3. Dette hænger

Læs mere

OPI Projekt: Udvikling af en biologisk reaktor til rensning for pesticider. /Foto: Christian Nyrop Albers, GEUS/

OPI Projekt: Udvikling af en biologisk reaktor til rensning for pesticider. /Foto: Christian Nyrop Albers, GEUS/ OPI Projekt: Udvikling af en biologisk reaktor til rensning for pesticider /Foto: Christian Nyrop Albers, GEUS/ OPI: Offentlig privat innovations partnerskab Parterne: Region Sjælland Videncenter for Jordforurening

Læs mere

Baggrund og formål. Formål Bedre procesforståelse Bedre grundlag for risikovurdering og vurdering af afværgetiltag Vurdering af nye metoder

Baggrund og formål. Formål Bedre procesforståelse Bedre grundlag for risikovurdering og vurdering af afværgetiltag Vurdering af nye metoder Konceptuel model for chlorerede opløsningsmidler - fordeling og processer i moræneler. ar vi et samlet overblik? Mette M. Broholm1, Ida Damgaard1, Cong Lu1, Julie Chambon1, Carsten S. Jacobsen2, Daniel

Læs mere

MUSICON, BASGANGEN MV. INDHOLD BILAG. 1 Indledning 2. 2 Projektets omfang 2. 3 Geologi og grundvand 2. 4 Forklassifikation 3

MUSICON, BASGANGEN MV. INDHOLD BILAG. 1 Indledning 2. 2 Projektets omfang 2. 3 Geologi og grundvand 2. 4 Forklassifikation 3 ROSKILDE KOMMUNE, VEJE OG GRØNNE OMRÅDER SAMT ROSKILDE FORSYNING MUSICON, BASGANGEN MV. JORDHÅNDTERINGSPLAN ADRESSE COWI A/S Parallelvej 2 2800 Kongens Lyngby TLF +45 56 40 00 00 FAX +45 56 40 99 99 WWW

Læs mere

GEUS-NOTAT Side 1 af 3

GEUS-NOTAT Side 1 af 3 Side 1 af 3 Til: Energistyrelsen Fra: Claus Ditlefsen Kopi til: Flemming G. Christensen GEUS-NOTAT nr.: 07-VA-12-05 Dato: 29-10-2012 J.nr.: GEUS-320-00002 Emne: Grundvandsforhold omkring planlagt undersøgelsesboring

Læs mere

BILAG. Vandforsyningsplan 2012-2024

BILAG. Vandforsyningsplan 2012-2024 BILAG Vandforsyningsplan 2012-2024 1-1 1. GEOLOGISKE FORHOLD De geologiske forhold i Gladsaxe Kommune kan kort beskrives som kvartære aflejringer af varierende udbredelse underlejret af kalk og kridt.

Læs mere

Naturlig nedbrydning af olie og chlorerede opløsningsmidler i grundvandet på Drejøgade 3-5

Naturlig nedbrydning af olie og chlorerede opløsningsmidler i grundvandet på Drejøgade 3-5 Miljøprojekt Nr. 544 2 Teknologiudviklingsprogrammet for jord- og grundvandsforurening Naturlig nedbrydning af olie og chlorerede opløsningsmidler i grundvandet på Drejøgade 3-5 Anders G. Christensen og

Læs mere

Redoxforhold i umættet zone (Bestemmelse af ilt, kuldioxid, svovlbrinte og metan i poreluft)

Redoxforhold i umættet zone (Bestemmelse af ilt, kuldioxid, svovlbrinte og metan i poreluft) Redoxforhold i umættet zone (Bestemmelse af ilt, kuldioxid, svovlbrinte og metan i poreluft) Definition af redoxforhold i umættet zone De fleste kemiske og biologiske processer i jord og grundvand er styret

Læs mere

Økologiske effekter af forurenet grundvand i Grindsted å

Økologiske effekter af forurenet grundvand i Grindsted å AARHUS UNIVERSITY Marts 2015 Økologiske effekter af forurenet grundvand i Grindsted å Jes J Rasmussen Peter Wiberg-Larsen Poul L. Bjerg Ursula S. McKnight Jørn K. Pedersen Anne T. Sonne AARHUS UNIVERSITY

Læs mere

Rødekro Vurdering af udviklingen i den naturlige nedbrydning i nedstrømsforureningsfane efter kildeoprensning

Rødekro Vurdering af udviklingen i den naturlige nedbrydning i nedstrømsforureningsfane efter kildeoprensning Downloaded from orbit.dtu.dk on: Jan 29, 27 Rødekro 25. Vurdering af udviklingen i den turlige nedbrydning i nedstrømsforureningsfane efter kildeoprensning Broholm, Mette Marti; Badin, Alice; Jacobsen,

Læs mere

Notat. Skørping Vandværk I/S SKØRPING VANDVÆRK. HYDROGEOLOGISK VURDERING VED HANEHØJ KILDEPLADS INDHOLD 1 INDLEDNING...2

Notat. Skørping Vandværk I/S SKØRPING VANDVÆRK. HYDROGEOLOGISK VURDERING VED HANEHØJ KILDEPLADS INDHOLD 1 INDLEDNING...2 Notat Skørping Vandværk I/S SKØRPING VANDVÆRK. HYDROGEOLOGISK VURDERING VED HANEHØJ KILDEPLADS 20. december 2012 Projekt nr. 211702 Dokument nr. 125930520 Version 1 Udarbejdet af NCL Kontrolleret af AWV

Læs mere

Delindsatsplan. Gassum Vandværk. for [1]

Delindsatsplan. Gassum Vandværk. for [1] Delindsatsplan for Gassum Vandværk [1] [2] Indhold Forord... 5 Definitioner/ordforklaring... 5 1 Indledning... 7 2 Områdebeskrivelse... 8 2.1 Vandværket... 8 2.1.1 Boringer... 8 2.1.2 Vandkvalitet i boringerne

Læs mere

Randers Kommune. Orientering til ejere af private enkeltboringer og brønde om kommunens tilsyn med drikkevandskvaliteten

Randers Kommune. Orientering til ejere af private enkeltboringer og brønde om kommunens tilsyn med drikkevandskvaliteten Randers Kommune Orientering til ejere af private enkeltboringer og brønde om kommunens tilsyn med drikkevandskvaliteten Teknisk forvaltning vand og virksomheder Oktober 2001 Tilsyn Randers Kommune fører

Læs mere

GEOFYSISKE METODER TIL DETEKTION AF GRUNDVANDSFORURENING

GEOFYSISKE METODER TIL DETEKTION AF GRUNDVANDSFORURENING GEOFYSISKE METODER TIL DETEKTION AF GRUNDVANDSFORURENING Jesper B. Pedersen HydroGeophysics Group Aarhus University Disposition Induceret polarisation (IP) metoden Casestudy Eskelund losseplads o Lossepladsen

Læs mere

NOTAT. 1. Indledning. Jorden stammer fra diverse kommunale vejprojekter udført i Svendborg Kommune.

NOTAT. 1. Indledning. Jorden stammer fra diverse kommunale vejprojekter udført i Svendborg Kommune. NOTAT Projekt Risikovurdering, jorddepot ved motorvejsafkørsel Svendborg Nord Kunde Svendborg Kommune, Anlæg og ejendomme Til Fra Kim Jensen, Svendborg Kommune Søren Nielsen, Rambøll 1. Indledning Svendborg

Læs mere

ANVENDELSE AF ZVI-CLAY TEKNOLOGIEN TIL OPRENSNING AF DNAPL-FORURENING

ANVENDELSE AF ZVI-CLAY TEKNOLOGIEN TIL OPRENSNING AF DNAPL-FORURENING ANVENDELSE AF ZVI-CLAY TEKNOLOGIEN TIL OPRENSNING AF DNAPL-FORURENING Ph.d. studerende Annika S. Fjordbøge Lektor, ph.d. Peter Kjeldsen DTU Miljø, Institut for Vand og Miljøteknologi Danmarks Tekniske

Læs mere

Oversigt. Introduktion Status Beslutningsprocess/Valg af oxidant Leveringsmetoder Aktiveringsmetoder Trends Treatment Trains Konklusion

Oversigt. Introduktion Status Beslutningsprocess/Valg af oxidant Leveringsmetoder Aktiveringsmetoder Trends Treatment Trains Konklusion Oversigt Introduktion Status Beslutningsprocess/Valg af oxidant Leveringsmetoder Aktiveringsmetoder Trends Treatment Trains Konklusion In situ kemisk oxidation involverer injektion af forskellige oxidationsmidler

Læs mere

Bilag 1 Vandværksskemaer

Bilag 1 Vandværksskemaer Bilag 1 Vandværksskemaer På de følgende sider vises vandværkskemaer for de ti vandværker/kildepladser i Søndersø Indsatsområde. Der er anvendt følgende opbygning: 1) Kort over indvindingsoplandet På første

Læs mere

Guide til indledende undersøgelse af jordforureninger, der udgør en potentiel risiko for overfladevand. Helle Overgaard, Region Hovedstaden

Guide til indledende undersøgelse af jordforureninger, der udgør en potentiel risiko for overfladevand. Helle Overgaard, Region Hovedstaden Guide til indledende undersøgelse af jordforureninger, der udgør en potentiel risiko for overfladevand Helle Overgaard, Region Hovedstaden ATV Vintermøde, 10.-11. marts 2015 Deltagere i følgegruppe Miljøstyrelsen

Læs mere

Notat vedrørende forureningsundersøgelse på Kløvkærvej 8, 6000 Kolding.

Notat vedrørende forureningsundersøgelse på Kløvkærvej 8, 6000 Kolding. Kløvkærvej 8, Kolding Side 1 Notat vedrørende forureningsundersøgelse på Kløvkærvej 8, 6000 Kolding. Indledning Kolding Kommune har anmodet Dansk Miljørådgivning A/S om at udføre en forureningsundersøgelse

Læs mere