Da mennesket blev til 2. del genetiske undersøgelser

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Starte visningen fra side:

Download "Da mennesket blev til 2. del genetiske undersøgelser"

Transkript

1 4 Da mennesket blev til 2. del genetiske undersøgelser Biaka pygmæ Nye molekylær-genetiske undersøgelser har kraftigt forøget vor viden om slægtskabet mellem de nulevende befolkningsgrupper og deres fælles stamform. (første del om det moderne menneskes oprindelse blev bragt i sidste nummer) Mbuti pygmæ Sotho/Tswana Nguni San Tsonga Af Peter K. A. Jensen Figur 1: Et netværk af 15 befolkningsgrupper baseret på variationen i kontrolregionen af mtdna. De afrikanske befolkningsgrupper har langt de største grene i netværket som udtryk for større variation mellem og inden for disse sammenlignet med de ikke-afrikanske befolkningsgrupper. Polakker Nordeuropæere Cambodianere Japanere Franksmænd Kinesere Finner Malayer Vietnamesere n Et af de nyeste forsøg på at besvare spørgsmålet om oprindelsen af det moderne menneske () hidrører fra molekylær-genetiske undersøgelser af nulevende mennesker. Der er i de senere år foretaget meget omfattende undersøgelser af den genetiske variation blandt nulevende mennesker. Grundlaget for denne variation er den tilfældige, men meget hyppige optræden af ændringer i rækkefølgen af nukleotider (baser) i genomet, der er uden væsentlig indflydelse på organismen. Sådanne ændringer kaldes polymorfier. Undersøgelser af polymorfier kan anvendes til at belyse slægtskabsforholdet mellem de i dag eksisterende befolkningsgrupper. Det vil herigennem også være muligt at indkredse den oprindelige stampopulation til alle nulevende mennesker samt at klarlægge udbredelsesmønstret af de forskellige befolkningsgrupper fra denne oprindelige stampopulation. Resultatet af den genetiske analyse kan grafisk fremstilles som et såkaldt fylogenetisk træ, der søger at klarlægge de evolutionære relationer mellem de studerede populationer (figur 1). De molekylær-genetiske undersøgelser har i meget høj grad bidraget til teorien om et afrikansk hjemland for det moderne menneske. De fleste genetiske undersøgelser støtter fortrængningsmodellen, og ingen taler den direkte imod. Mitokondrie-Eva Mitokondrie-DNA (mtdna) er et lille cirkulært DNA molekyle bestående af nukleotidpar, hvis nøjagtige sekvens blev fastlagt allerede i mtdna har to favorable egenskaber, der gør det særligt velegnet til evolutionsstudier: For det første er mutationsraten ca. 10 gange højere end i genomisk DNA (kerne-dna), hvilket giver mtdna tilstrækkelig stor opløselighed til at afklare nylige evolutionære begivenheder såsom oprindelsen af og udbredelsesmønstret af. For det andet er nedarvningen af mtdna enkel og direkte: Modsat genomisk DNA nedarves mtdna kun fra moderen; det er med andre ord ikke en blanding af begge forældres genetiske materiale, og det forandres kun af mutationer. Som en logisk konsekvens heraf må alt humant mtdna i sidste ende nedstamme fra en enkelt kvinde Mitokondrie-Eva (figur 2). Mitokondrie-Eva er fra Afrika Analyse af mtdna har været den mest anvendte genetiske analyse til belysning af det moderne menneskes oprindelse. I 1987 offentliggjorde tidsskriftet Resume Hvornår og hvordan opstod det moderne menneske? I dag mener de fleste forskere, at svaret på dette spørgsmål, skal findes inden for en af to fremherskende teorier. Den ene teori kaldes Fortrængningsmodellen, og den siger, at det moderne menneske opstod i Afrika, hvorfra det spredte sig til den øvrige verden. Hvor det nåede frem fortrængte det de hidtidige populationer af arkaiske mennesker. Den anden teori, Den Multiregionale model siger derimod, at det moderne menneske har udviklet sig fra humane populationer mere eller mindre parallelt i alle regioner af den gamle verden en udvikling, der er forløbet over den sidste million år.

2 5 ÆGCELLE Befrugtet æg med moderens mitokondrier NEDARVNING AF mtdna mitokondrier SÆDCELLE cellekerner Kun moderens mitokondrier går i arv til børnene Kun sædcellens kerne befrugter ægcellen; resten, inklusive mitokondrierne går til grunde TID mtdna hos nulevende mennesker Kvinde Mand UDVIKLINGSSPORET EFTER mtdna Kvinde A Kvinde B ("Eva") Kvinde C Figur 2. Modsat DNA i cellekernen, af hvilket vi arver halvdelen fra vores mor og den anden halvdel fra vores far, nedarver vi kun det mitokondrielle DNA (mtdna) fra moderen. Når sædcellen befrugter ægcellen trænger kun det kerneholdige hoved ind gennem ægcellens membran; resten, inklusive mitokondrierne deltager ikke i selve befrugtningen, men går i stedet tabt. Derfor modtager fosteret kun mtdna fra moderens ægcelle. Nature en opsigtsvækkende artikel, der kædede variationen i mtdna hos nulevende mennesker sammen med en afrikansk oprindelse af det moderne menneske. Forfatter-trioen var en meget kompetent gruppe af molekylær-genetikere og evolutionsforskere ved Californiens Berkeley Universitet: Rebecca Cann, Mark Stoneking og nu afdøde Allan Wilson. Cann og medarbejderes undersøgelse har i årene efter offentliggørelsen givet anledning til en del røre og adskillige kontroverser, men også til en meget frugtbar diskussion af det fremlagte materiale. Der har været mange misforståelser, især i den populære presse, omkring Eva-begrebet. Mitokondrie-Eva er således blevet sammenlignet med den bibelske, hvilket har givet anledning til den udbredte misforståelse, at vi alle nedstammer fra ét og kun ét individ. Som ovenfor anført er det logisk at opfatte vores mtdna som hidrørende fra én oprindelig kvinde, men dette siger intet om bidragene til vores fælles genpulje fra fortidige mænd og kvinder, hvis mtdna ikke har overlevet til i dag. Det store flertal af vore forfædre har bidraget til vore gener i forskelligt omfang. Hvert eneste nulevende menneske bærer i sig genomisk DNA hidrørende fra mange forfædre og repræsenterer i virkeligheden en kombination af gener stammende fra ca. 2 n forfædre, der levede for n generationer siden. Selvom alle nulevende mennesker er fælles om mtdna, der kan spores tilbage til en enkelt kvinde, bærer vi alle genomisk DNA, der hidrører fra talløse andre forfædre, heraf mange der ikke nødvendigvis behøver at have været afrikanere. Udsagnet, at vi alle nedstammer fra et enkelt menneske, giver derfor ingen mening (figur 3). Det mtdna Kerne-DNA år Neandertalere Neandertalere Figur 3. Skematisk fremstilling af den genetiske forskel af Homo neanderthalensis-linien og -linien baseret på henholdsvis mtdna og kerne-dna. bedste bud på størrelsen af den oprindelige population af anatomisk moderne mennesker er ca individer. Det er også klart, at kvinden, der var bærer af vores fælles mtdna, ikke var den første kvinde på Jorden. Som enhver anden havde også hun forfædre, men hun repræsenterer det punkt, hvortil alt moderne mtdna kan føres tilbage.

3 6 Mitokondrie-DNA støtter fortrængningsmodellen Siden Cann og medarbejderes oprindelige arbejde er der publiceret talrige genetiske studier til belysning af det moderne menneskes oprindelse, og mange af disse er baseret på analyse af mtdna. mtdnaanalyserne støtter alle i større eller mindre udstrækning de oprindelige resultater. Det mest omfattende arbejde, hvor man analyserede den globale mtdna variation baseret på analyse af den komplette mtdna-sekvens, blev publiceret i december 2000; resultaterne udgør et vægtigt argument for fortrængningsmodellen. Sammenfattende kan der om mtdna-analyserne siges, at de forholdsvist klart støtterfortrængningsmodellen om oprindelsen af det moderne menneske. Det er et faktum, at den største variation i mtdna findes blandt afrikanere (mere specifikt afrikanere syd for Sahara). Dette har alle undersøgelser klart demonstreret, og det et af de stærkeste enkeltstående indicier for et afrikansk hjemland for det moderne menneske. Hvad angår alderen af den oprindelige stamform af mtdna (dvs. Mitokondrie-Eva) ligger denne mest sandsynligt mellem og år, selvom det må medgives, at der er en betydelig usikkerhed på estimaterne. Hvis vi inkluderer aldersestimaterne beregnet ud fra analyse af genomisk DNA og tager et gennemsnit af dem alle fås en alder på ca år. Der er intet, der taler for, at alderen er så høj som 1-2 millioner år. Det skal nævnes, at man i lighed med mtdna undersøgelserne har forsøgt at følge Y- kromosomets nedarvning bagud til en fælles forfader (Ykromosomet nedarves udelukkende fra faderen). Resultaterne passer i forbavsende grad med resultaterne af mtdna-analyserne. Analyse af fossilt DNA I 1997 lykkedes det for første gang nogensinde at udvinde DNA fra fossile neandertalknogler (tilhørende det oprindelige fund fra 1856). Alderen på knoglerne kan ikke bestem- Sammenligning afmtdna - sekvenser Sammenligning af en mtdnasekvens fra et moderne menneske () med den tilsvarende +mtdna-sekvens udvundet fra en ca år gammel neandertal-knogle. Øverst illustrerer histogramgruppen HS-HS den variation, der findes mellem tilfældige nulevende mennesker med hensyn til den undersøgte sekvens (8 forskelle i gennemsnit). HS-HN: Sammenligning mellem H. sapiens og H. neanderthalensis (27,2 forskelle i gennemsnit). HS-P: Sammenligning mellem H. sapiens og chimpanse (Pan, 55 forskelle i gennemsnit). Det ses, at HS-HS histogrammerne grupperer sig for sig selv uden overlap med HS-HN histogrammerne. I tabellen nederst ses de gennemsnitlige forskelle mellem mtdna-sekvensen fra neandertal-knoglen og fra nulevende, oprindelige befolkningsgrupper. 8,0 (gn.snit) neandertalere 27,2 europa neandertalere 28,2 afrika neandertalere 27,1 asien neandertalere 27,7 amerika neandertalere 27,4 oceanien neandertalere 28,3 chimpanse 55,0 Til højre herfor er vist tidspunktet for den genetiske divergens og for populationsdivergensen. Genetisk divergens Fælles mtdna pulje Populationens divergens BA Herover: Billede af Lagar Velho 1 fossilet fra Portugal. Er det en hybrid mellem en neandertaler og et moderne menneske, eller er skelettet fuldt moderne? Fælles stamfader til Hs og Hn (H. helmei?) Homo neanderthalensis

4 7 Antal genvarianter ( ~antal individer 2) Ikke-afrikanere Afrikanere Gen-variant nr. Figur 4. Analyse af variationen i et bestemt gen på kromosom 16. Der blev observeret over 40 varianter (alleler) af dette gen, og det fremgår, at variationen er langt større blandt afrikanere end blandt ikke-afrikanere (hver top omfatter kun relativt få individer, idet hvert individ har to varianter af hvert gen - et fra moderen og et fra faderen). Endvidere ses det, at variationen blandt ikke-afrikanere omfatter en undergruppe af den afrikanske. mes med sikkerhed, men formodes at være omkring år. Ikke overraskende drejede det sig om mtdna, af hvilket der er langt flere kopier end genomisk DNA i cellen. Det udvundne DNA var stærkt fragmenteret, men det lykkedes alligevel at opformere det til mængder, der muliggjorde sekvensanalyse. Ud af 0,4 g knoglevæv udvandt man fragmenter af mtdna, og det lykkedes at bestemme en samlet sekvens på i alt 379 nukleotider. Man sammenlignede herefter den fastlagte sekvens med den tilsvarende sekvens fra nulevende mennesker og fandt, at de to sekvenser afveg så stærkt fra hinanden, at de måtte hidrøre fra to separate populationer (se boksen). Forskellene var så store, at de ikke kunne rummes inden for den variation, der findes blandt nutidige mennesker. Man nøjedes ikke kun med at sammenligne mtdna-sekvensen fra neandertaleren med mtdna fra nutidige europæere; man sammenlignede også med mtdna, der stammede fra nutidige mennesker fra andre kontinenter og fandt hver gang den samme forskel (se boksen): Nutidigt europæisk mtdna ligner ikke neandertalmtdna mere end f.eks. nutidigt asiatisk eller afrikansk mtdna gør. Ud fra sekvensforskellene kunne det endvidere estimeres, at de udviklingslinier, der førte frem til henholdsvis neandertalerne og adskiltes for mere end år siden (figur 3). Det er siden lykkedes at udvinde mtdna fra yderligere to neandertal-fossiler, stammende fra henholdsvis det nordlige Kaukasus og Kroatien; begge fossiler er ca år gamle. Disse nye undersøgelser bekræfter de oprindelige resultater, og samlet set er resultaterne et godt argument for fortrængningsmodellen. Det er meget usandsynligt, at neandertalerne kan have givet ophav til den moderne europæer. Man kan naturligvis ikke med sikkerhed udelukke en vis opblanding; blot må man så konstatere, at neandertalernes gener atter er forsvundet (f.eks. ved genetisk drift). Men så har de jo heller ikke bidraget til den genetiske udrustning af nulevende europæere. Kunne neandertalere og parre sig? Vanskelighederne ved at afgrænse arter ud fra rene morfologiske karakterer kan ikke understreges nok (tænk blot på hunderacer!). Derfor kan man heller ikke med absolut sikkerhed vide, om neandertalere og moderne mennesker er to forskellige arter. Men de er i hvert tilfælde to forskellige udviklingslinier, hvor den genetiske adskillelse startede for år siden. Hvorvidt hybridisering mellem neandertalere og de tidlige i Europa (Cro-Magnon-menneskerne) har været muligt kan for nærværende ikke afklares. I foråret 1999 annoncerede man fundet af skelettet af et ca. 4- årigt barn, der blev begravet for år siden i Lapedo-dalen ca. 90 km nord for Lissabon, Portugal (Lagar Velho 1 fossilet, figur 4). Efter nogles mening frembyder skelettet en blanding af træk karakteristiske for henholdsvis neandertalere og moderne mennesker. Mange antropologer er dog meget skeptiske overfor denne udlægning. Selv om neandertalere og Cro-Magnon mennesker repræsenterer forskellige arter, har de jo alligevel været nært beslægtede; derfor har de måske kunnet få infertilt eller endog fertilt afkom. Hvis hybridisering vitterligt har fundet sted, er det dog ikke ensbetydende med, at neandertal-dna har overlevet til i dag. I givet fald er det nemlig tænkeligt, at hybriderne ligesom de rene neandertalere er uddøde. Uanset om hybridisering har fundet sted eller ej ændrer det ikke på synet af det moderne menneskes opståen i Afrika, og at dets udvikling frem til i dag i øvrigt intet har med neandertalerne at gøre. Analyse af genomisk DNA Der er efterhånden foretaget talrige undersøgelser af polymorfier baseret på variation i genomisk DNA. Sammenfattende kan man om disse under-

5 8 søgelser sige, at de endnu mere klart end mtdna-undersøgelserne peger på Afrika som oprindelsesstedet for det moderne menneske. I tre undersøgelser er polymorfier i tre forskellige gener på hver sit kromosom blevet analyseret. En fjerde undersøgelse omfatter et bredere udsnit af såkaldte mikrosatelliter (små repeterede DNA-sekvenser) spændende over flere kromosomer. Alle fire undersøgelser viser, at den variation, der findes hos nulevende ikke-afrikanere, er en lille fraktion af den variation, der findes i den nulevende afrikanske befolkning (figur 4). Sammen med de to undersøgelser, der omtales nedenfor, udgør disse undersøgelser det stærkeste genetiske argument for oprindelsen af det moderne menneske i Afrika. To meget omfattende undersøgelser er udgået fra forskergrupper på henholdsvis Stanford Universitetet i Californien, og fra universitetet i Pennsylvania. Begge undersøgelser, der involverer talrige befolkningsgrupper verden over, er baseret på mere end 100 polymorfier i proteiner og DNA, og de viser samstemmende, at den største genetiske variation findes blandt afrikanere, og at europæere og asiater er klart nærmere beslægtede med hinanden end nogen af dem er med afrikanerne. Undersøgelserne peger ydermere på, at opsplitningen af afrikanere og ikke-afrikanere snarere skete for omkring år siden end for én million år siden. Resultaterne er statistisk set meget holdbare. Fortrængningsmodellen vinder terræn Selvom der for nærværende ikke eksisterer nogen model, der på overbevisende måde kan redegøre for alle tilgængelige data vedrørende oprindelsen af det moderne menneske, er det dog et faktum, at fortrængningsmodellen i stigende grad vinder terræn. Den helt overvældende tendens de allerseneste år har været en forøgelse af den empiriske viden til støtte for fortrængningsmodellen; samme evidens har i stigende grad undermineret den teoretiske og empiriske basis for den multiregionale model. Alt bevismateriale peger på Afrika syd for Sahara som oprindelsessted for. Ud fra et genetisk synspunkt er det da også logisk at forestille sig, at de forandringer, der fandt sted i genomet og som slutteligt gav ophav til, kun fandt sted én gang. Det er dog vigtigt at forstå, at selvom den større genetiske variation i den afrikanske befolkning syd for Sahara er forenelig med oprindelsen af det moderne menneske i Afrika, er det ikke nødvendigvis noget bevis herfor. Det er muligt, at det moderne menneske er opstået andetsteds (f.eks. i Asien), men at en efterfølgende genetisk flaskehals har reduceret den asiatiske variation, så den i dag er mindre end den afrikanske. Det er også muligt, at den større variation i Afrika hænger sammen med, at befolkningen dér altid har været større end andre steder. Men supplerende information om fordelingen af den genetiske variation i forskellige befolkninger kan give svaret. Studier, der analyserer fordelingen af variationen, viser næsten uden undtagelse større variation i Afrika end andre steder. Men mere vigtigt er, at variationen i ikke-afrikanske befolkninger er en undergruppe af den, der findes i Afrika. Den eneste logiske forklaring på dette er, at det moderne menneske er opstået i Afrika og ved den efterfølgende udvandring til de øvrige kontinenter, har det taget en del af den afrikanske variation med sig. Hvis det moderne menneske var opstået i f.eks. Asien efterfulgt af en flaskehals på dette kontinent, ville man stadig forvente at finde overlevende genetiske polymorfier af asiatisk oprindelse, der ikke ville udgøre en undergruppe af de afrikanske. Opblanding tvivlsom Hvis den multiregionale model er korrekt, er det nødvendigt at antage, at en meget betydelig udveksling af gener har fundet sted henover kontinenterne i løbet af den sidste million år. Kun derved er det muligt at forestille sig, at de vidt spredte populationer kunne opretholdes som én art. Oven i købet en art, der udviser en bemærkelsesværdig lille genetisk variation. Den multiregionale model forudsætter, at vidtstrakte områder af Europa, Afrika og Asien måske 80 millioner. km 2 i alt til stadighed var beboet siden Homo ergasters udvandring fra afrika. Forskellige beregninger tyder på, at den totale population i hele denne periode sjældent har oversteget individer. Det er derfor mere end tvivlsomt, at der kan være foregået nogen særlig opblanding (og derfor et meget betydeligt gen flow) i en så spredt befolkning. Er en endelig afklaring mulig? Den moderne genteknologi rummer som vi har set heldigvis et potentiale, der giver os et begrundet håb om at nå til en afklaring om oprindelsen af. Såfremt det lykkes at udvinde og analysere DNA fra fossile mennesker i større omfang end hidtil, vil dette sætte os i stand til at konstruere langt bedre stamtræer end de, der er baseret på DNA fra nulevende mennesker. Hvis det bliver muligt at udvinde DNA fra Homo erectus-fossiler fra Kina og Java vil det formentlig være muligt at skelne mellem den multiregionale teori og fortrængningsmodellen her: Hvis Homo erectus-dna ligner moderne - DNA fra samme geografiske område støtter dette teorien om, at er udviklet lokalt; hvis derimod alt Homo erectus-dna er meget forskelligt fra alt -DNA støtter dette teorien om, at kun er udviklet én gang, selvom det ikke kan fortælle os noget om, hvor og hvornår dette skete. Om forfatteren Peter K.A. Jensen er adm. overlæge ved Klinisk genetisk Afdeling, Århus Universitetshospital Universitetsparken, Bartholinbygn Århus C Tlf.: Yderligere læsning Peter K.A. Jensen. Menneskets oprindelse og udvikling. Gads forlag, (Ny opdateret udgave udkommer efteråret 2001.) Johanson D, & Edgar, B. From Lucy to language. Simon & Schuster, 1996.

Ny viden om tamkattens oprindelse

Ny viden om tamkattens oprindelse Ny viden om tamkattens oprindelse Af Tommy Asferg Hvor stammer tamkatten fra? Det ligefremme svar er, at den stammer fra vildkatten. Men det er langtfra et udtømmende svar, for vildkatten findes i et antal

Læs mere

Skruedyrenes evolution

Skruedyrenes evolution Skruedyrenes evolution Materialer: 8 forskellige søm og skruer per hold. Formål: At tegne et slægtskabstræ udfra morfologiske karaktertræk Når arterne er blevet indsamlet og identificeret, skal de systematiseres.

Læs mere

Kromosomtranslokationer

Kromosomtranslokationer 12 Kromosomtranslokationer December 2009 Oversat af Anja Lisbeth Frederiksen, reservelæge, ph.d. Klinisk Genetisk Afdeling, Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet

Læs mere

Dandy Walker Like Malformation

Dandy Walker Like Malformation Dandy Walker Like Malformation Speciale af Hedvig Christiansson and Evelina Kling Vegeby Præsenteret af Helle Friis Proschowsky Dyrlæge, Phd., Specialkonsulent hos DKK DWLM projektet 1. Hvad er DWLM 2.

Læs mere

Hvordan kan den moderne genetik bidrage til belysning af menneskets udvikling?

Hvordan kan den moderne genetik bidrage til belysning af menneskets udvikling? Hvordan kan den moderne genetik bidrage til belysning af menneskets udvikling? Baseret på foredrag afholdt i foreningen d. 13. september 2007 Af Peter K. A. Jensen Venusvej 18 8960 Randers SØ Der er principielt

Læs mere

X bundet arvegang. Information til patienter og familier

X bundet arvegang. Information til patienter og familier X bundet arvegang Information til patienter og familier 2 X bundet arvegang Følgende er en beskrivelse af, hvad X bundet arvegang betyder og hvorledes X bundne sygdomme nedarves. For at forstå den X bundne

Læs mere

Kromosomforandringer. Information til patienter og familier

Kromosomforandringer. Information til patienter og familier 12 Odense: Odense Universitetshospital Sdr.Boulevard 29 5000 Odense C Tlf: 65 41 17 25 Kromosomforandringer Vejle: Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 Århus:

Læs mere

X bundet arvegang. Information til patienter og familier. 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55

X bundet arvegang. Information til patienter og familier. 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 12 Sygehus Lillebælt, Vejle Klinisk Genetik Kabbeltoft 25 7100 Vejle Tlf: 79 40 65 55 X bundet arvegang Århus Sygehus, Bygn. 12 Århus Universitetshospital Nørrebrogade 44 8000 Århus C Tlf: 89 49 43 63

Læs mere

Kjers. sygdom. Nyt fra forskningsfronten. Et studie der søger at påvise årsager til og behandling af denne hidtil uhelbredelige øjensygdom

Kjers. sygdom. Nyt fra forskningsfronten. Et studie der søger at påvise årsager til og behandling af denne hidtil uhelbredelige øjensygdom Kjers Nyt fra forskningsfronten sygdom Gitte Juul Almind Reservelæge, ph.d.-stud. Kennedy Centret Illustrationer: Mediafarm arvelig synsnerveskrumpning (ADOA - Autosomal Dominant Opticus Atrofi) Et studie

Læs mere

De første mennesker. Titel. Forfatter. Hvad forestiller forsidebilledet? Hvad fortæller bagsideteksten om bogen?

De første mennesker. Titel. Forfatter. Hvad forestiller forsidebilledet? Hvad fortæller bagsideteksten om bogen? A FØR JEG LÆSER BOGEN Fakta om bogen Titel _ Forfatter Hvornår er bogen udgivet? _ På hvilken side findes Indholdsfortegnelse? _ Stikordsregister? Bøger og www? Hvor mange kapitler er der i bogen? Hvad

Læs mere

Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Den basale genetik

Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Den basale genetik Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Den genetiske 'gråzone' i Huntington's chorea: hvad betyder det alt sammen? Intermediate alleler

Læs mere

Moesgaards kulturarv. Moesgaard Museum har udover udstillinger også aktiviteter og events for publikum samt møde- og konferencefaciliteter

Moesgaards kulturarv. Moesgaard Museum har udover udstillinger også aktiviteter og events for publikum samt møde- og konferencefaciliteter Moesgaards kulturarv Moesgaard Museum er en kulturhistorisk museumsoplevelse i unikke rammer med enestående arkitektur midt i et skønt naturområde. Museet rummer arkæologiske og etnografiske udstillinger

Læs mere

Kromosomforandringer. Information til patienter og familier

Kromosomforandringer. Information til patienter og familier Kromosomforandringer Information til patienter og familier 2 Kromosomforandringer Den følgende information er en beskrivelse af kromosomforandringer, hvorledes de nedarves og hvornår dette kan medføre

Læs mere

Da mennesket blev til

Da mennesket blev til 12 Da mennesket blev til - oprindelsen af Homo sapiens De sidste par årtiers intensive forskning har kastet nyt lys over spørgsmålet om oprindelsen af det moderne menneske. Peter K. A. Jensen vil i to

Læs mere

Foredragsarrangement på Statens Naturhistoriske Museum d. 30.4.2013 Spørgsmål & svar. Hans Christian Petersen: De tidligste menneskeknogler i Danmark

Foredragsarrangement på Statens Naturhistoriske Museum d. 30.4.2013 Spørgsmål & svar. Hans Christian Petersen: De tidligste menneskeknogler i Danmark DE FØRSTE DANSKERE Foredragsarrangement på Statens Naturhistoriske Museum d. 30.4.2013 Spørgsmål & svar Hans Christian Petersen: De tidligste menneskeknogler i Danmark Ved man, hvorfor mænd havde bredere

Læs mere

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer Eksamensspørgsmål til biobu maj 2013 1. Afrikansk plante med mulig gavnlig virkning på diabetes type II Forklar hvordan insulin er opbygget, dets dannelse og virkemåde. Hvad er årsagen til diabetes type

Læs mere

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet

Genetiske Aspekter af HCM hos Kat. - en introduktion til forskningsprojektet Genetiske Aspekter af HCM hos Kat - en introduktion til forskningsprojektet Cand. scient. Mia Nyberg, ph.d. stud. mnje@life.ku.dk IMHS, Det Biovidenskabelige Fakultet, Københavns Universitet, Klinisk Biokemisk

Læs mere

1. Hvad er kræft, og hvorfor opstår sygdommen?

1. Hvad er kræft, og hvorfor opstår sygdommen? 1. Hvad er kræft, og hvorfor opstår sygdommen? Dette kapitel fortæller om, cellen, kroppens byggesten hvad der sker i cellen, når kræft opstår? årsager til kræft Alle levende organismer består af celler.

Læs mere

Millioner år. H. sapiens. Pt. verus. Pt. vellerosus. Pt. paniscus. Pt. schweinfurthii. Pt. troglodytes

Millioner år. H. sapiens. Pt. verus. Pt. vellerosus. Pt. paniscus. Pt. schweinfurthii. Pt. troglodytes udvekslingsmuligheder, som benytter sig af alle mulige tricks lige fra øgede mutationsfrekvenser i de enkelte aminosyrer over større udskiftninger af DNA-stumper til kæmpe omstruktureringer i hele genomet.

Læs mere

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares

Biologi A. Studentereksamen. Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares Biologi A Studentereksamen Af opgaverne 1, 2, 3 og 4 skal tre og kun tre af opgaverne besvares 2stx131-BIO/A-03062013 Mandag den 3. juni 2013 kl. 9.00-14.00 Side 1 af 8 sider Opgave 1. Pelsfarve hos ulve

Læs mere

Eva Køhler. Cand. scient. i biologi. Medlem af Felis Danicas Avlsråd. Ejer og udstiller af maine coon gennem 10 år

Eva Køhler. Cand. scient. i biologi. Medlem af Felis Danicas Avlsråd. Ejer og udstiller af maine coon gennem 10 år Eva Køhler Cand. scient. i biologi Speciale om indavl hos racekatte Medlem af Felis Danicas Avlsråd Ejer og udstiller af maine coon gennem 10 år Administrerer pawpeds for europé og norsk skovkat De generelle

Læs mere

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres.

Det lyder enkelt, men for at forstå hvilket ærinde forskerne er ude i, er det nødvendigt med et indblik i, hvordan celler udvikles og specialiseres. Epigenetik Men hvad er så epigenetik? Ordet epi er af græsk oprindelse og betyder egentlig ved siden af. Genetik handler om arvelighed, og hvordan vores gener videreføres fra generation til generation.

Læs mere

Du bliver hvad din far spiser Eller, hvordan sædcellerne husker dine dårlige vaner

Du bliver hvad din far spiser Eller, hvordan sædcellerne husker dine dårlige vaner Du bliver hvad din far spiser Eller, hvordan sædcellerne husker dine dårlige vaner Måske er du heldig at have de lange, slanke ben fra din mors side, og måske lidt mindre heldig at have fået de store fortænder

Læs mere

Jordens historie er inddelt i fire æoner: Hadal, Arkæikum, Protozoikum, Phanerozoikum

Jordens historie er inddelt i fire æoner: Hadal, Arkæikum, Protozoikum, Phanerozoikum Livets udvikling Teori: Solsystemet dannedes for 4,6 mia. år siden Ældste sten på jorden: 4 mia. år gamle Livets alder Mikrofossiler - ældste spor af liv - 3,4 mia. år siden Livet kan være opstået for

Læs mere

Planteproduktion i landbruget

Planteproduktion i landbruget 1 Planteproduktion i landbruget Med udgangspunkt i det vedlagte materiale ønskes: Inddrag gerne relevante forsøg: 1 En beskrivelse af faktorer der har betydning for planternes vækst. 2 En forklaring af

Læs mere

Planteproduktion i landbruget

Planteproduktion i landbruget 1 Planteproduktion i landbruget Med udgangspunkt i det vedlagte materiale ønskes: Inddrag gerne relevante forsøg: 1 En beskrivelse af faktorer der har betydning for planternes vækst. 2 En forklaring af

Læs mere

Poul Erik Lindelof. Homo Erectus, den længst eksisterende menneskeart, men den, hvorom vi ved mindst.

Poul Erik Lindelof. Homo Erectus, den længst eksisterende menneskeart, men den, hvorom vi ved mindst. Poul Erik Lindelof Afdelingen for Forhistorisk Arkæologi Saxo Instituttet, Københavns Universitet Homo Erectus, den længst eksisterende menneskeart, men den, hvorom vi ved mindst. I den arkæologiske litteratur

Læs mere

CRO MAGNON- MENNESKET

CRO MAGNON- MENNESKET 1 CRO MAGNON- MENNESKET Hvor kom det fra? Rolf Kenneth Myhre www.visdomsnettet.dk 2 CRO MAGNON-MENNESKET Hvor kom det fra? Af Rolf Kenneth Myhre (Oversættelse Ebba Larsen) Kom Cro Magnon mennesket fra

Læs mere

Orientering fra Københavns Kommune Statistisk Kontor. Levendefødte børn efter statsborgerskab i København

Orientering fra Københavns Kommune Statistisk Kontor. Levendefødte børn efter statsborgerskab i København Orientering fra Københavns Kommune Statistisk Kontor Levendefødte børn efter i København 1992-1998 Nr. 27. 1. september 2 Levendefødte efter Levendefødte børn opgjort efter moderens nationalitet. København

Læs mere

Historien om HS og kræft

Historien om HS og kræft Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Hvad er sammenhængen mellem Huntingtons Sygdom og kræft? HS-patienter har mindre risiko for at

Læs mere

Recessiv (vigende) arvegang

Recessiv (vigende) arvegang 10 Recessiv (vigende) arvegang Anja Lisbeth Frederiksen, reservelæge, ph.d., Aalborg Sygehus, Århus Universitetshospital, Danmark Tilrettet brochure udformet af Guy s and St Thomas Hospital, London, Storbritanien;

Læs mere

O V E R L E V E L S E N S A B C

O V E R L E V E L S E N S A B C Lærervejledning Charles Darwins evolutionsteori om artsdannelse bygger på begreberne variation og selektion og er et fundamentalt emne, da den er teorigrundlaget for hele videnskabsfaget biologi. Det er

Læs mere

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet?

Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab En baglæns besked gemt i HD-genet? Lyn dine gener op! En baglæns besked, gemt i 'backup-dna'et'

Læs mere

Inholdsfortegnelse: 1. Allel-skema

Inholdsfortegnelse: 1. Allel-skema Stamtræsøvelse Inholdsfortegnelse: 1. Allel-skema 2. Hvem er far til Thor? 3. Saml stamtræet 4. Hvilke mænd skal Thor vælge til faderskabstesten? 5. Faderskabstesten 6. Ordforklaringer Du skal nu hjælpe

Læs mere

de illegale indvandrere i danmark, 2016 Jan Rose Skaksen og Troels Mandøe Glæsner

de illegale indvandrere i danmark, 2016 Jan Rose Skaksen og Troels Mandøe Glæsner de illegale indvandrere i danmark, 2016 Jan Rose Skaksen og Troels Mandøe Glæsner arbejdspapir 51 december 2017 ROCKWOOL Fondens Forskningsenhed Arbejdspapir nr. 51 De illegale indvandrere i danmark, 2016

Læs mere

Solidaritet, risikovillighed og partnerskønhed

Solidaritet, risikovillighed og partnerskønhed Rockwool Fondens Forskningsenhed Arbejdspapir 36 Solidaritet, risikovillighed og partnerskønhed Jens Bonke København 1 Solidaritet, risikovillighed og partnerskønhed Arbejdspapir 36 Udgivet af: Rockwool

Læs mere

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner

Generne bestemmer. Baggrundsviden og progression: Niveau: 8. klasse. Varighed: 12 lektioner Generne bestemmer Niveau: 8. klasse Varighed: 12 lektioner Præsentation: Generne bestemmer er et forløb om genernes indflydelse på individet. I forløbet kommer vi omkring den eukaryote celle, celledeling,

Læs mere

Individer er ikke selv ansvarlige for deres livsstilssygdomme

Individer er ikke selv ansvarlige for deres livsstilssygdomme Individer er ikke selv ansvarlige for deres livsstilssygdomme Baggrunden Både i akademisk litteratur og i offentligheden bliver spørgsmål om eget ansvar for sundhed stadig mere diskuteret. I takt med,

Læs mere

Naturlig variation. Hvad er det? Egenskaber. Eksempler. Naturlig variation er forskellen på eks. på to ting som man umiddelbart Opfatter som ens.

Naturlig variation. Hvad er det? Egenskaber. Eksempler. Naturlig variation er forskellen på eks. på to ting som man umiddelbart Opfatter som ens. Naturlig variation er forskellen på eks. på to ting som man umiddelbart Opfatter som ens. ne er de forskellige arvelige egenskaber og evner man får. Naturlig variation Man kan sammenligne det med en gruppe

Læs mere

Hvad er så vigtigt ved målinger?

Hvad er så vigtigt ved målinger? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Spændende opdagelse i blodceller fra patienter med Huntingtons Sygdom Mængden af huntingtinprotein

Læs mere

50 pct. flere ikke-vestlige efterkommere dømmes for kriminalitet sammenlignet med personer med dansk baggrund

50 pct. flere ikke-vestlige efterkommere dømmes for kriminalitet sammenlignet med personer med dansk baggrund Nyt fra April 5 5 pct. flere ikke-vestlige efterkommere dømmes for kriminalitet sammenlignet med personer med dansk baggrund Efterkommere af ikke-vestlige indvandrere er mere kriminelle end danskere. Når

Læs mere

Anvendelse af DNA markører i planteforædlingen

Anvendelse af DNA markører i planteforædlingen Anvendelse af DNA markører i planteforædlingen Forsker Gunter Backes, Afdeling for Planteforskning, Forskningscentret Risø DNA-markører på kontaktfladen mellem molekylær genetik og klassisk planteforædling

Læs mere

Per-Erik Sundgren er videnskabsmand, agronom med doktorgrad i husdyrgenetik, chef for Institut for Smådyr ved Sveriges Landbrugsuniversitet

Per-Erik Sundgren er videnskabsmand, agronom med doktorgrad i husdyrgenetik, chef for Institut for Smådyr ved Sveriges Landbrugsuniversitet Hvad er egentlig fejl ved indavl Per-Erik Sundgren har skrevet nedenstående artikel. Per-Erik Sundgren er videnskabsmand, agronom med doktorgrad i husdyrgenetik, chef for Institut for Smådyr ved Sveriges

Læs mere

Fastlæggelse af indvandringsomfanget i Befolkningsfremskrivning 2016

Fastlæggelse af indvandringsomfanget i Befolkningsfremskrivning 2016 Bilag 3: Notat om metode for indregning af flygtninge i landsfremskrivningen og i den kommunale fremskrivning 26. april 2016 Fastlæggelse af indvandringsomfanget i Befolkningsfremskrivning 2016 De seneste

Læs mere

Hvad ved vi om HC i Kina?

Hvad ved vi om HC i Kina? Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Kinesisk Huntingtons Chorea-netværk lanceret Kinesisk HC-netværk er blevet lanceret. En god nyhed

Læs mere

De Midaldrende Danske Tvillinger

De Midaldrende Danske Tvillinger Det Danske Tvillingregister De Midaldrende Danske Tvillinger - En informationspjece om forskningsresultater fra Det Danske Tvillingregister Det Danske Tvillingregister blev grundlagt ved Københavns Universitet

Læs mere

700.000 ÅR GAMMELT DNA

700.000 ÅR GAMMELT DNA Spørgsmål & svar 700.000 ÅR GAMMELT DNA Foredragsarrangement på Statens Naturhistoriske Museum d. 9.10.2013 Morten Allentoft: Fossilt DNA - et vindue til fortiden Når man sammenligner arters slægtskab

Læs mere

Analyseinstitut for Forskning

Analyseinstitut for Forskning Analyseinstitut for Forskning Bioteknologi Opfattelser og holdninger blandt danskere, 1989-2000 Notat 2001/3 ISSN: 1399-8897 Analyseinstitut for Forskning/ The Danish Institute for Studies in Research

Læs mere

EUROBAROMETER 71 NATIONAL RAPPORT HOVEDKONKLUSIONER DANMARK. Undersøgelsen er bestilt og koordineret af Generaldirektoratet for Kommunikation.

EUROBAROMETER 71 NATIONAL RAPPORT HOVEDKONKLUSIONER DANMARK. Undersøgelsen er bestilt og koordineret af Generaldirektoratet for Kommunikation. Standard Eurobarometer Europa Kommissionen EUROBAROMETER 71 MENINGSMÅLING I EU SOMMER 2009 Standard Eurobarometer 71 / Sommer 2009 TNS Opinion & Social NATIONAL RAPPORT HOVEDKONKLUSIONER DANMARK Undersøgelsen

Læs mere

Danskerne, islam og muslimer Af professor Peter Nannestad, Institut for Statskundskab, Aarhus Universitet

Danskerne, islam og muslimer Af professor Peter Nannestad, Institut for Statskundskab, Aarhus Universitet Danskerne, islam og muslimer Af professor Peter Nannestad, Institut for Statskundskab, Aarhus Universitet Siden terrorangrebet den 11. september 2001 og Muhammed-krisen i 2005 er spørgsmålet om danskernes

Læs mere

survey, december 1999

survey, december 1999 www.folketinget.dk survey, december 1999 Indhold Indledning...3 Demografisk profil...5 Brug af www.folketinget.dk...7 Generel internetbrug...10 Hvad søger brugerne af www.folketinget.dk efter?...12 Folketinget.dk's

Læs mere

Oprindelsen af HOMO SAPIENS

Oprindelsen af HOMO SAPIENS Oprindelsen af HOMO SAPIENS (MOLEKYLÆR ANTROPOLOGI) 1 MONOGENESE MENNESKEHEDENS ENHED 2 3 ACCGTAAAGTTTGACCCAGATAGAGATTTTTTAAACGGGCCATAGCACACACACAGTCAGATAGAGATCAAAATGGGCCGTGGAAACCCGGGTTAAAAAAGTGCGT GTGTAAACACACACACACACACACAGTGTTGFACCAAAGTACAGATAGGATACACAGATAGCAGTAGACAGTAGATTTAGACAAAGTTTGCAGTTTGACCCAGATAG

Læs mere

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein

Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' DNA, RNA og protein Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Klip-og-kopier DNA: reparér mutationer med 'genom-redigering' Forskere kan lave præcise ændringer

Læs mere

FORDELING AF ARV. 28. juni 2004/PS. Af Peter Spliid

FORDELING AF ARV. 28. juni 2004/PS. Af Peter Spliid 28. juni 2004/PS Af Peter Spliid FORDELING AF ARV Arv kan udgøre et ikke ubetydeligt bidrag til forbrugsmulighederne. Det er formentlig ikke tilfældigt, hvem der arver meget, og hvem der arver lidt. For

Læs mere

Reciprok translokation

Reciprok translokation Patientinformation Reciprok translokation Ægsortering Præimplantationsdiagnostik (PGD) Fertilitetsklinikken Gynækologisk Obstetrisk Afdeling D Ægsortering Hvad er præimplantationsdiagnostik? Ved præimplantationsdiagnostik,

Læs mere

Genetisk drift og naturlig selektion

Genetisk drift og naturlig selektion Genetisk drift og naturlig selektion Denne vejledning indeholder en gennemgang af simulationsværktøjer tilgængeligt online. Værktøjerne kan bruges til at undersøge effekten af populationsstørrelse på genetisk

Læs mere

Bananfluer og nedarvning

Bananfluer og nedarvning Bananfluer og nedarvning Teori: Bananflue-genetik Bananfluens livscyklus Bananfluen, Drosophila melanogaster, har været brugt til at studere genetik i mere end 100 år. Denne diploide organisme har fuldstændig

Læs mere

MODELSÆT 2; MATEMATIK TIL LÆREREKSAMEN

MODELSÆT 2; MATEMATIK TIL LÆREREKSAMEN MODELSÆT ; MATEMATIK TIL LÆREREKSAMEN Forberedende materiale Den individuelle skriftlige røve i matematik vil tage udgangsunkt i følgende materiale:. En diskette med to regnearks-filer og en MathCad-fil..

Læs mere

Avlsarbejde. Dansk Landbrugsrådgivning Landscentret 4.1

Avlsarbejde. Dansk Landbrugsrådgivning Landscentret 4.1 Avlsarbejde 4. Avlsteori Arveanlæggene (gener) ligger på kromosomer Kromosomer befinder sig i alle celler Arveanlæggene optræder altid parvis, to og to De to gener i hvert par adskilles, når dyret senere

Læs mere

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2001 kl

BIOLOGI HØJT NIVEAU. Mandag den 13. august 2001 kl STUDENTEREKSAMEN AUGUST 2001 2001-6-2 BIOLOGI HØJT NIVEAU Mandag den 13. august 2001 kl. 9.00-14.00 Af de store opgaver 1 og 2 må kun den ene besvares. Af de små opgaver 3, 4, 5 og 6 må kun to besvares.

Læs mere

Epigenetik Arv er andet end gener

Epigenetik Arv er andet end gener Epigenetik Arv er andet end gener Indhold Indledning Afsnit1: Epigenetik og DNA Afsnit 2: DNA, nukleosomer og kromatin Afsnit 3: Epigenetik og celledifferentiering Afsnit 4: Genetisk ens individer kan

Læs mere

Brugerundersøgelse 2014

Brugerundersøgelse 2014 19. december 214 Brugerundersøgelse 214 I efteråret 214 er en større gruppe af Danmarks Statistiks (DST) brugere blevet bedt om at svare på 11 spørgsmål om deres vurdering og brug af DST. Formålet var

Læs mere

Funktionsterminologi

Funktionsterminologi Funktionsterminologi Frank Nasser 12. april 2011 c 2008-2011. Dette dokument må kun anvendes til undervisning i klasser som abonnerer på MatBog.dk. Se yderligere betingelser for brug her. Bemærk: Dette

Læs mere

Karrierekvinder og -mænd

Karrierekvinder og -mænd Rockwool Fondens Forskningsenhed Arbejdspapir 35 Karrierekvinder og -mænd Hvem er de? Og hvor travlt har de? Jens Bonke København 2015 Karrierekvinder og -mænd Hvem er de? Og hvor travlt har de? Arbejdspapir

Læs mere

27611 Eksamen Sommer 2008

27611 Eksamen Sommer 2008 27611 Eksamen Sommer 2008 Dette sæt indeholder 10 opgaver. En online version af opgavesættet vil være tilgængeligt fra kursets lektionsplan under selve eksamen ( juni 2008 klokken 15:00-19:00). DNA/Protein

Læs mere

Performance i danske aktiefonde de seneste tre år

Performance i danske aktiefonde de seneste tre år 18. maj 2015 Performance i danske aktiefonde de seneste tre år Denne analyse ser på performance i danske aktiefonde over de seneste tre år. Vi har undersøgt afkast og performance på i alt 172 danske aktiebaserede

Læs mere

FORÆLDRENES SKOLEVALG

FORÆLDRENES SKOLEVALG 24. november 2005 FORÆLDRENES SKOLEVALG Af Niels Glavind Resumé: Det er en udbredt antagelse, at de bedste skoler er dem, hvor eleverne opnår den højeste gennemsnitskarakter. Som en service over for forældre,

Læs mere

Danskernes e-julehandel i 2013 Gang i e-julegavehandlen

Danskernes e-julehandel i 2013 Gang i e-julegavehandlen Notat Danskernes e-julehandel i 2013 Traditionen tro er julehandlen gået i gang, og danskerne bruger meget tid og mange penge på at købe julegaver til familie og venner. Dansk Erhverv har, på baggrund

Læs mere

KORONARARTERIOGRAFI OG CT-SCANNING AF HJERTET 2008. 1. halvår 2011. Tal og analyse

KORONARARTERIOGRAFI OG CT-SCANNING AF HJERTET 2008. 1. halvår 2011. Tal og analyse KORONARARTERIOGRAFI OG CT-SCANNING AF HJERTET 2008 1. halvår 2011 2012 Tal og analyse Koronararteriografi og CT-scanning af hjertet 2008-1. halvår 2011 Statens Serum Institut og Sundhedsstyrelsen, 2012.

Læs mere

Naboens søn arver dig

Naboens søn arver dig Socialudvalget 2013-14 B 90 Bilag 1 Offentligt Til Socialudvalget I frustration over min magtesløse situation, og aktualiseret af den diskussion der i i foråret blev ført i pressen, tillader jeg mig hermed

Læs mere

Mennesket. Den genetiske arv

Mennesket. Den genetiske arv Mennesket Den genetiske arv Mennesket Den genetiske arv Af Peter K.A. Jensen unı vers Mennesket. Den genetiske arv Forfatteren og Aarhus Universitetsforlag 2006 Tilrettelægning: Jørgen Sparre Omslag: Jørgen

Læs mere

Påstand: Et foster er ikke et menneske

Påstand: Et foster er ikke et menneske Påstand: Et foster er ikke et menneske Hvad svarer vi, når vi møder denne påstand? Af Agnete Maltha Winther, studerende på The Animation Workshop, Viborg Som abortmodstandere hører vi ofte dette udsagn.

Læs mere

1. HVOR MANGE SKOLER, FORÆLDRE OG ELEVER DÆKKER UNDERSØGELSEN?

1. HVOR MANGE SKOLER, FORÆLDRE OG ELEVER DÆKKER UNDERSØGELSEN? Skole og Samfunds undersøgelse af Skolebestyrelsesvalget 2006 Indsamlingen af data er afsluttet pr. 4. april 2006. 1. HVOR MANGE SKOLER, FORÆLDRE OG ELEVER DÆKKER UNDERSØGELSEN? Antallet af skoleledere,

Læs mere

Spørgsmål nr.1. Evolutionsteorien fra Lamarck til Darwin. Spørgsmål nr.2. Menneskets evolution. Spørgsmål 3. Diabetes

Spørgsmål nr.1. Evolutionsteorien fra Lamarck til Darwin. Spørgsmål nr.2. Menneskets evolution. Spørgsmål 3. Diabetes Spørgsmål nr.1 Evolutionsteorien fra Lamarck til Darwin I din fremlæggelse skal du redegøre for Lamarck s og Darwins teori om livets udvikling. Fremhæv væsentlige forskelle imellem teorierne, nævn gerne

Læs mere

Lagervisning. Dina Friis, og Niels Boldt,

Lagervisning. Dina Friis, og Niels Boldt, Lagervisning Dina Friis, dina@diku.dk og Niels Boldt, boldt@diku.dk 6. april 2001 Kapitel 1 Sammenfatning Dette dokument er et eksempel på en delvis besvarelse af G-opgaven stillet på Datalogi 0 2000-2001.

Læs mere

DNA og stamtræer. Fra DNA-sekvens til stamtræ. 50 Brug Botanisk Have i undervisningen

DNA og stamtræer. Fra DNA-sekvens til stamtræ. 50 Brug Botanisk Have i undervisningen DN og stamtræer Kan vi se skoven for bar træer? 11 Ole Seberg, professor*, oles@snm.ku.dk Gitte Petersen, professor*, gittep@snm.ku.dk * otanisk Have og Museum, Statens Naturhistoriske Museum Københavns

Læs mere

for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af den menneskelige arvemasse

for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af den menneskelige arvemasse Version 3 RETNINGSLINJER for Komitésystemets behandling af sundhedsvidenskabelige forskningsprojekter med omfattende kortlægning af den menneskelige arvemasse Holbergsgade 6 DK-1057 København K Tel +45

Læs mere

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk

Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande. Foto Finn Sivebæk Fisk og gener: Anvendelse af den nyeste genetiske viden i forvaltning af fiskebestande Foto Finn Sivebæk 1 Historien Anvendelse af genetisk viden i forvaltning i DK 1994 Hansen et al. 1993 -? Nielsen et

Læs mere

Appendiks A. Entreprenørskabsundervisning i befolkningen, specielt blandt unge

Appendiks A. Entreprenørskabsundervisning i befolkningen, specielt blandt unge Appendiks A. Entreprenørskabsundervisning i befolkningen, specielt blandt unge Redegørelsen ovenfor er baseret på statistiske analyser, der detaljeres i det følgende, et appendiks for hvert afsnit. Problematikken

Læs mere

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer

1. Afrikansk plante med mulig gavnlig virkning på diabetes type II. 2. Bestemmelse af genomer hos forskellige arter organismer Eksamensspørgsmål til biobu juni 2012 1. Afrikansk plante med mulig gavnlig virkning på diabetes type II Forklar hvordan insulin er opbygget, dets dannelse og virkemåde. Hvad er årsagen til diabetes type

Læs mere

Hvad sker der med Christan IV s skillingemønter under den store kroneudmøntning 1618-1622

Hvad sker der med Christan IV s skillingemønter under den store kroneudmøntning 1618-1622 numismatisk rapport 95 5 Hvad sker der med Christan IV s skillingemønter under den store kroneudmøntning 1618-1622 Der er ingen tvivl om, at den mest urolige periode i Christian IV s mønthistorie er årene

Læs mere

ÅBENT HUS ANALYSE FORÅRET 2015 ANALYSENS INDHOLD

ÅBENT HUS ANALYSE FORÅRET 2015 ANALYSENS INDHOLD ÅBENT HUS ANALYSE FORÅRET 2015 ANALYSENS INDHOLD I foråret 2015 besøgte CompanYoung tre af landets universiteters åbent hus-arrangementer. Formålet hermed var at give indblik i effekten af åbent hus og

Læs mere

Magnetfelter og børnekræft - er der en sammenhæng?

Magnetfelter og børnekræft - er der en sammenhæng? NOTAT NP92-961b JKJ/BT-DGR 4. december 1997 Magnetfelter og børnekræft - er der en sammenhæng? Revideret januar 1993 NOTAT NP92-961b 2 1. Om børnekræft I perioden fra 1945 og frem til i dag har udviklingen

Læs mere

Hjerner i et kar - Hilary Putnam. noter af Mogens Lilleør, 1996

Hjerner i et kar - Hilary Putnam. noter af Mogens Lilleør, 1996 Hjerner i et kar - Hilary Putnam noter af Mogens Lilleør, 1996 Historien om 'hjerner i et kar' tjener til: 1) at rejse det klassiske, skepticistiske problem om den ydre verden og 2) at diskutere forholdet

Læs mere

Ekstrakter - rammebevillinger

Ekstrakter - rammebevillinger Ekstrakter - rammebevillinger Professor Bente Vilsen Aarhus Universitet Biokemi 4.736.000 kr. Natrium-kalium pumpen sidder i membranen på alle celler og er livsnødvendig for at opretholde deres funktion.

Læs mere

Effekt af nedsættelse af promillegrænsen

Effekt af nedsættelse af promillegrænsen Effekt af nedsættelse af promillegrænsen Inger Marie Bernhoft Civilingeniør Danmarks TransportForskning/Ermelundsvej Ermelundsvej 101, 2820 Gentofte, Danmark Baggrund Pr. 1. marts 1998 blev promillegrænsen

Læs mere

NOTAT. Projekt om rejsetidsvariabilitet

NOTAT. Projekt om rejsetidsvariabilitet NOTAT Dato J. nr. 15. oktober 2015 2015-1850 Projekt om rejsetidsvariabilitet Den stigende mængde trafik på vejene giver mere udbredt trængsel, som medfører dels en stigning i de gennemsnitlige rejsetider,

Læs mere

STORT ER POTENTIALET?

STORT ER POTENTIALET? ARBEJDSPLADSLOKALISERING - HVOR Baggrund STORT ER POTENTIALET? - En analyse af pendlertrafik i Frederiksborg Amt Af Civilingeniør Morten Agerlin, Anders Nyvig A/S Blandt de langsigtede midler til påvirkning

Læs mere

Eksempel på logistisk vækst med TI-Nspire CAS

Eksempel på logistisk vækst med TI-Nspire CAS Eksempel på logistisk vækst med TI-Nspire CAS Tabellen herunder viser udviklingen af USA's befolkning fra 1850-1910 hvor befolkningstallet er angivet i millioner: Vi har tidligere redegjort for at antallet

Læs mere

Du er, hvad du spiser

Du er, hvad du spiser Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Accelererer mejeriprodukter Huntingtons Sygdom? Er der et link mellem indtaget af mælkeprodukter

Læs mere

Kræft var sjældent i oldtiden 25. december 2010 kl. 07:30

Kræft var sjældent i oldtiden 25. december 2010 kl. 07:30 Kræft var sjældent i oldtiden 25. december 2010 kl. 07:30 Ny forskning antyder, at kræft var en sjælden sygdom i oldtiden. Det strider imod mange kræftforskeres opfattelse af sygdommen. Af Andreas R. Graven,

Læs mere

HELSINGØR KOMMUNE Borgerundersøgelse af kommunens image 2017

HELSINGØR KOMMUNE Borgerundersøgelse af kommunens image 2017 HELSINGØR KOMMUNE Borgerundersøgelse af kommunens image 2017 Indhold Om 2017 undersøgelsen... 2 Undersøgelsens brug af indeks... 3 Læsning af grafik... 4 Overblik over kommunes image... 5 Udvikling af

Læs mere

Skabelsesberetninger

Skabelsesberetninger Troels C. Petersen Niels Bohr Instituttet Big Bang til Naturvidenskab, 7. august 2017 Skabelsesberetninger 2 Tidlig forestilling om vores verden 3 13.8 milliarder år siden Big Bang 4 Universets historie

Læs mere

Ny teknologi til analyse af vores gener ændrer måden, vi forebygger og behandler sygdom på. Nye markedsmuligheder for Exiqon

Ny teknologi til analyse af vores gener ændrer måden, vi forebygger og behandler sygdom på. Nye markedsmuligheder for Exiqon Ny teknologi til analyse af vores gener ændrer måden, vi forebygger og behandler sygdom på Nye markedsmuligheder for Exiqon De seneste års store teknologiske gennembrud har gjort, at vi i dag nemt og økonomisk

Læs mere

Dansk og/eller Samtidshistorieopgaven

Dansk og/eller Samtidshistorieopgaven Dansk og/eller Samtidshistorieopgaven I skal i løbet af 2. år på HH skrive en større opgave i Dansk og /eller Samtidshistorie. Opgaven skal i år afleveres den 7/12-09 kl. 12.00 i administrationen. I bekendtgørelsen

Læs mere

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement

DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement DNA analyse af spyt-prøver fra et får, et rådyr samt et formodet ulve-ekskrement Notat fra DCE - Nationalt Center for Miljø og Energi Dato: 4. juni 2013 Liselotte Wesley Andersen Institut for Bioscience

Læs mere

Analyseinstitut for Forskning

Analyseinstitut for Forskning Analyseinstitut for Forskning Folk og forskning Forskningsformidling - Danskernes kilder til viden om forskning Notat 2001/2 ISSN: 1399-8897 Analyseinstitut for Forskning/ The Danish Institute for Studies

Læs mere

Genbrug af behandlingsformer

Genbrug af behandlingsformer Forskningsnyheder om Huntingtons Sygdom På hverdagssprog Skrevet af forskere. Til det globale HS-fællesskab Genbrug af et lægemiddel giver os ny indsigt i HS Et eksisterende lægemiddel kan booste HS-hjernecellerne

Læs mere